Plasmid 79 (2015) 15–21
Contents lists available at ScienceDirect
Plasmid j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y p l a s
Short Communication
Construction of a directional T vector for cloning PCR products and expression in Escherichia coli Xiu-Yi Liang 1, Zhi-Cheng Liang 1, Zhi Zhang, Jiao-Jiao Zhou, Shi-Yu Liu, Sheng-Li Tian * Shenzhen Key Laboratory of Microbial Genetic Engineering, College of Life Sciences, Shenzhen University, Shenzhen 518060, China
A R T I C L E
I N F O
Article history: Received 22 October 2014 Accepted 19 January 2015 Available online 11 February 2015 Communicated by Richard Calendar Keywords: T vector Directional cloning Prokaryotic expression XcmI cassette
A B S T R A C T
In order to clone PCR products and express them effectively in Escherichia coli, a directional cloning system was constructed by generating a T vector based on pQE-30Xa. The vector was prepared by inserting an XcmI cassette containing an endonuclease XcmI site, a kanamycin selective marker, a multiple-cloning-site (MCS) region and an opposite endonuclease XcmI site into the vector pQE-30Xa. The T vector pQE-T with single overhanging dT residues at both 3′ ends was obtained by digesting with the restriction enzyme XcmI. For directional cloning, a BamHI site was introduced to the ends of the PCR products. A BamHI site was also located on the multiple cloning site of pQE-T. The PCR products were ligated with pQE-T. The directionally inserted recombinants were distinguished by using BamHI to digest the recombinants because there are two BamHI sites located on the both sides of PCR fragment. In order to identify the T-vector functions, the 14-3-3-ZsGreen and hRBP genes were amplified and a BamHI site was added to the ends of the genes to confirm this vector by ligation with pQE-T. Results showed that the 14-3-3-ZsGreen and hRBP were cloned to the vector pQE-T directly and corresponding proteins were successfully produced. It was here demonstrated that this directional vector is capable of gene cloning and is used to manipulate gene expression very easily. The methodology proposed here involves easy incorporation of the construct into other vectors in various hosts. © 2015 Elsevier Inc. All rights reserved.
1. Introduction With the increase of the number of species whose genomes have been sequenced, genome databases and the information they contain are becoming more abundant. These data accelerate the life science research process in projects ranging from the design of primers for DNA amplification, to studies of protein structure (Eisenberg et al., 2000; Vukmirovic and Tilghman, 2000). In general, polymerase chain reaction (PCR) is common for gene amplification in
* Corresponding author. Shenzhen Key Laboratory of Microbial Genetic Engineering, College of Life Sciences, Shenzhen University, Room S415, Nanshan District, Shenzhen, Guangdong 518060, China. Fax: +86 0755 26534274. E-mail address: [email protected] (S.-L. Tian). 1 The authors made equal contribution to this work. http://dx.doi.org/10.1016/j.plasmid.2015.01.003 0147-619X/© 2015 Elsevier Inc. All rights reserved.
vitro (Borovkov and Rivkin, 1997; Jeung et al., 2002; Lim et al., 2010). Cloning PCR products directly and efficiently is an effective method of gene conservation, amplification, sequencing, and expression (Liu et al., 2000). The T vector is widely used for the cloning of PCR products (Marchuk et al., 1991). Due to the terminal transferase activity of the Taq polymerase, PCR products have 3′ dA overhang at both ends. It is known that there is a dT residue at each 3′ end of T vectors, and PCR products can be cloned into T vectors with complementary 3′ dT overhangs. This is called the T–A cloning system. Because T–A cloning is easy to operate within a shorter time, it greatly improves the efficiency of PCR product ligation. Hence, the T vector method has become the most economical approach to the cloning of genes for expression, especially high-throughput cloning (Jo and Jo, 2001). However, there are three main problems in the use of traditional T vectors. One is a complicated process of extraction of plasmids; the other is difficulty to distinguish the positive
16
X.-Y. Liang et al./Plasmid 79 (2015) 15–21
recombinants carrying a plasmid with the insert from those not containing insert plasmids; the third is a sophisticated digestion of endonuclease identification of insert orientation. Traditional T vectors have been shown to be associated with white-blue screening for positive clone screening. However, the white-blue screen system is not always stable or stringent (Liu et al., 2010). When the insert is short, positive recombinants appear between blue and white in color. Moreover, the 5-bromo-4-chloro-3-indolyl-β-Dgalactopyranoside (X-Gal), the substrate of β-galactosidase, is required for the white-blue screening, which is relatively costly (Cheong et al., 2012; Liu et al., 2010; Ma et al., 2014). The other problem is that traditional T vectors cannot guarantee the directional cloning of the PCR products (Ma et al., 2014). Researchers must identify the direction of the insert fragments through restriction endonuclease digestion or DNA sequencing, which is time-consuming (Janner et al., 2013; Testori et al., 1994). Unlike traditional methods, pQE-T showed quicker vector expression construction, more accurate cloning, and fewer laborious and time-consuming steps such as those involving determination of the direction of PCR products. In order to overcome the problems of traditional T vectors, a T vector pQE-T based on pQE-30Xa was designed for directional cloning and prokaryotic expression. pQE-T can be used to clone PCR products directly. After the transformation and the extraction of the plasmids, the direction of insert can be determined by BamHI digestion. Here, fusion protein of 14-3-3 and ZsGreen (14-3-3-ZsGreen) and retinol binding protein from Homo sapiens (hRBP) can be successfully cloned and expressed.
2. Material and methods 2.1. Strains and vectors Escherichia coli JM107 was preserved in our laboratory. pQE-30Xa vector was purchased from Qiagen (Germany). pET-28a vector was purchased from Novagen (Germany). pMD-19T (simple) and pLVX-ZsGreen1-N1 vectors were purchased from Takara (Japan). Anti-His antibody (HRP conjugated) was purchased from Abmart (China). DNA sequencing and the primers used in this study were synthesized at the Beijing Genomics Institute (China) (Table 1).
2.2. DNA manipulation Molecular manipulations such as PCR, gel electrophoresis, plasmid extraction, and restriction endonuclease digestion were performed using standard techniques (Sambrook et al., 1989). All restriction enzymes were purchased from New England Biolabs and used in accordance with the manufacturer’s instructions. 2.3. Construction of pQE-T To obtain the XcmI cassette, kanamycin resistance gene is amplified by PCR using pET-28a vector as the template. PCR is carried out in a total volume of 50 μL with primer TP1, TP2, PCR buffer and Taq DNA polymerase. Two opposite XcmI sites are designed at both ends of the kanamycin resistance gene and designated as the XcmI cassette (Arashi-Heese et al., 1999). The XcmI cassette contained an endonuclease XcmI site, a kanamycin selective marker, an opposite endonuclease XcmI site, and EcoRI, NcoI, BamHI, and HindIII restriction enzyme sites. There is a His tag at the 3′ end of XcmI cassette. The XcmI cassette was linked into pMD-19T vector. The ligation product was transformed into E. coli JM107 competent cells and coated on LB plates containing ampicillin (100 mg/L) and kanamycin (50 mg/L). After plasmid extraction and testing by enzymatic digestions and DNA sequencing, the positive recombinant was identified and named pMD-Ka. The pMD-Ka was digested by restriction endonuclease EcoRI and HindIII to generate XcmI cassette with cohesive ends. The XcmI cassette was linked into expression vector pQE-30Xa digested by EcoRI and HindIII. The ligation product was transformed into E. coli JM107 competent cells, coated on LB plates containing ampicillin and kanamycin, and cultured at 37 °C for 14–16 h. The positive recombinant was identified and named pQE-Ka. A map of pQE-Ka and key sequences are shown in Fig. 1A. pQE-Ka was digested by XcmI to remove the kanamycin resistance gene and produce the prokaryotic expression T vector pQE-T (Fig 1B). 2.4. Preparation of interested gene and verification of T vector pQE-T In order to make protein expression in E. coli visible, the 14-3-3 gene isolated from Physarum polycephalum (GenBank
Table 1 Primers used in this study. Primers
Primer sequences (5′→3′)
Restriction enzyme sites (underlined)
TP1 TP2 1433-P1 1433-ZsG ZsG-P2 hRBP-P1 hRBP-P2
GAATTCATTAAAGAGGAGAAATTAACCATGGGATCCAGAATTTTAATGGGTATGAGCCATATTCAACGGG AAGCTTAATGATGATGATGATGATGTCCACCTTTTCTATGGTTAGAAAAACTCATCGAGC ATGACACACGACGAATTCCGCG AGGCCGTGCTTGGACTGGGCCATTGATTGTCCCTCAGTTTCTCTGGC GGATCCGGGCAAGGCGGAGCCGGAGGCG ATGAAGTGGGTGTGGGCGC GGATCCCAAAAGGTTTCTTTCTGATCTGCC
EcoRI, NcoI, BamHI, XcmI HindIII, XcmI EcoRI
Underlined are endonuclease sites.
BamHI BamHI
X.-Y. Liang et al./Plasmid 79 (2015) 15–21
17
Fig. 1. Plasmid map of pQE-Ka and pQE-T. (A) The XcmI cassette was inserted into EcoRI and HindIII sites of pQE-30Xa and generated the pQE-Ka. The key restriction enzyme sites are indicated. (B) T vector pQE-T was generated after pQE-Ka removed a kanamycin gene by XcmI digestion.
accession number: EF140724) was integrated with the ZsGreen gene, which (695 bp) is a variant of the wild-type Zoanthus sp. green fluorescent protein (Matz et al., 1999). The 14-3-3-ZsG fusion gene was amplified by using overlap PCR with the primers 1433-P1, 1433-ZsG, and ZsG-P2. To further verify the pQE-T vector function, Homo sapiens retinol binding protein 4 (hRBP) (GenBank accession number: NM_006744) gene (636 bp) was amplified by PCR from human liver cDNA with the primers hRBP-P1 and hRBPP2. A BamHI site is designed at the reverse primer for amplifying both genes to facilitate directional identification. To determine the direction of the insert gene, the recombinants were directly digested by endonuclease BamHI. Because the BamHI site is located at downstream primer, if an insert gene were cloned in the wrong direction, the two BamHI sites would be located closely. The recombinant plasmid digested by BamHI could not cleave an interested gene fragment. No corresponding band was visible after agarose gel electrophoresis. 2.5. Western blot analysis of products expressed in E. coli The transformed bacteria containing pQE-ZsGreen were plated on LB plates and cultured at 37 °C for 18 h to observe
fluorescent of colonies under blue light. The recombinants containing pQE-hRBP and pQE-ZsGreen were incubated at 37 °C for 8 h until the OD600 was around 0.8, respectively. Samples before IPTG induction were collected and IPTG was added to final concentration of 1 mmol/L to the medium to induce hRBP expression in E. coli (Studier, 2005, 2014). After adding IPTG, samples were taken out at 1, 3, 5, and 7 h respectively. Samples before and after IPTG induction were treated with lysis buffer and boiled at 100 °C water bath for 10 min and then loaded onto wells of 10% SDS–PAGE for electrophoresis. The gels were stained with Coomassie blue and Western blot analysis (Wang et al., 2014). Western blot analysis of 2 μg expressed protein was performed with HRP Conjugated Anti-His Tag Mouse Monoclonal Antibody (5C3) in 1:2000 dilution (Abbkine, CA, USA) using the protocol specified by the manufacturer. 2.6. In-gel digestion with trypsin The gel pieces in stained hRBP protein were excised from the SDS–PAGE gels in Eppendorf tube, washed with distilled water twice, distained with 200 μL solution (25 mM ammonium hydrogen carbonate, 50% acetonitrile), and incubated for 30 min at 37 °C until the particles were colorless.
18
X.-Y. Liang et al./Plasmid 79 (2015) 15–21
The gel pieces were covered by acetonitrile until gel pieces shrunk and became white; they were then dried by vacuum freeze dryer. Gel particles were incubated with 10 μL of 12.5 ng/mL trypsin (Promega, Madison, WI, USA) becoming transcript and 20 μL of 25 mM ammonium hydrogen carbonate and 10% acetonitrile were added into the Eppendorf tubes and incubated at 37 °C overnight. The supernatants from the trypsin-digested mixtures were collected in separate Eppendorf tubes, and peptides were incubated at 37 °C for 30 min using 50 μL extract solution (50% acetonitrile and 5% formic acid) and then crushed by ultrasonication for 15 min and centrifugated for 10 min with maximum speed. All supernatants derived from the peptide extracts were mixed and lyophilized for MALDITOF analysis.
2.7. MALDI-TOF analysis and MASCOT search All lyophilized samples were resolved in 0.1% TFA and the samples were mixed with 6 mg/mL CHCA matrix and spotted onto the sample board for drying, and they were then analyzed on a MALDI-TOF voyager DE-STR Analyzer (Applied Biosystems, Foster City, CA, USA). The operation parameters were as follows: Peptide mass fingerprints (PMF) were obtained in positive reflector mode. The mass range was set as 800–4000 Da. PMF was outputted in the peacklist text formatting. Proteins were identified using the MASCOT search engine (Matrix Science, London, UK) against the human protein SwissProt database (http://www.matrixscience.com) using the following search criteria: 20,210 peptides were cleaved by trypsin, maximum of 1 missed cleavage, and peptide mass tolerance was 0.45 Da. Mascot score is 80 (the threshold value is 56, p < 0.05), and the protein identified is Retinol-binding protein 4 (RET4_HUMAN).
3. Results 3.1. Construction and verification of directional T vector pQE-T The primers TP1 and TP2 were used to amplify kanamycin resistance gene by PCR. The EcoRI, NcoI, BamHI and XcmI sites were introduced at upstream of kanamycin resistance gene and the opposite XcmI site was designated at downstream of kanamycin resistance gene. It was named as the XcmI cassette. After PCR amplification, agarose electrophoresis showed a band of approximately 900 bp consistent with fragment of kanamycin resistance gene. The XcmI cassette was inserted into a pMD-19T vector to generate recombinant vector pMD-Ka. It was confirmed by endonucleases EcoRI and HindIII. The XcmI cassette was inserted between EcoRI and HindIII sites of pQE-30Xa to generate recombinant plasmid pQE-Ka. The pQE-Ka plasmid was digested by XcmI to remove the kanamycin resistance gene generating a T vector of approximately 3500 bp, indicating that the expression T vector pQE-T had been constructed successfully (Fig. 2).
Fig. 2. Identification of pQE-T by restriction enzyme digestion. M: TaKaRa 5000 DNA marker; 1: XcmI cassette amplified by PCR; 2: recombinant vector pMD-Ka; 3: pMD-Ka digested by EcoRI and HindIII, generating an approximately 750 bp band of Kanamycin gene with EcoRI, NcoI, BamHI, XcmI sites and a 2.69 kb vector band; 4: recombinant vector pQE-Ka; 5: pQE-Ka digested by EcoRI and HindIII generating an approximately 750 bp band of Kanamycin gene with EcoRI, NcoI, BamHI, XcmI sites and a 3.46 kb vector band; 6: pQE-Ka digested by XcmI generating an approximately 750 bp band of Kanamycin gene, XcmI sites and a 3.46 kb vector band.
3.2. ZsGreen and hRBP amplification and ligation into pQE-T ZsGreen and hRBP genes were amplified by PCR. They were linked to linearized pQE-T vector, and the products of ligation were transformed into E. coli JM107. Recombinant vectors pQE-hRBP and pQE-ZsGreen were verified by endonuclease BamHI. Only the recombinants whose insert gene was oriented in the correct direction could be verified by digestion of BamHI, as described previously. The bands corresponding to the PCR products appeared. These results suggested that ZsGreen and hRBP had been cloned into the pQE-T vector in the right direction (Fig. 3A, 3B). DNA sequencing indicated right sequence of ZsGreen and hRBP (data not shown).
3.3. Recombinant protein expression and analysis The 14-3-3-ZsG fusion gene was amplified by using overlap PCR with the primers 1433-P1, 1433-ZsG, and ZsG-P2 and then cloned into pQE-T and transformed into E. coli JM107, coated on an ampicillin LB plate. The positive recombinants in which the insert gene was oriented in the right direction showed strong green fluorescence under 446–464 nm excitation wavelength of blue light in Fig. 4. The result indicated that the PCR products were inserted into T vector pQE-T in 50% ratio of right direction. The proteins were extracted from the green colonies and SDS–PAGE analysis was carried out. Samples displayed an intense band of 60 kDa on SDS–PAGE and stained with Coomassie blue, corresponding to the predicted size of the
X.-Y. Liang et al./Plasmid 79 (2015) 15–21
A
19
B
Fig. 3. 14-3-3-ZsG and hRBP linked with pQE-T and identified by BamHI digestion. (A) M1: TaKaRa 2000 marker; 1: 14-3-3 PCR products; 2: 14-3-3ZsGreen PCR product; 3: recombinant vector pQE-14-3-3-ZsG; 4: pQE-14-3-3-ZsGreen digested by BamHI. (B) M: TaKaRa 5000 marker; 1: hRBP PCR product; 2: recombinant vector pQE-hRBP; 3: pQE-hRBP digested by BamHI.
Fig. 5. SDS–PAGE analysis for recombinant protein 14-3-3-ZsGreen in recombinant E. coli JM107. M: molecular mass standard protein; 1: E. coli JM107 control; 2: the expression of recombinant E. coli JM107 containing pQE-Ka induced by IPTG; 3–7: the expression of recombinant E. coli JM107 containing pQE-ZsGreen induced by IPTG for 0, 1, 3, 5, and 7 h, respectively. Fig. 4. Colonies of recombinant E. coli JM107 were observed under the blue light. The arrows indicated that colonies of recombinant E. coli JM107 containing plasmid pQE-ZsGreen emit bright green fluorescence.
fusion protein 14-3-3-ZsGreen. The results are shown in Fig. 5. In order to further prove the T vector’s function, the positive recombinants of pQE-hRBP with the insert gene in the right direction were selected for expression of hRBP. SDS– PAGE and Western blot analysis showed that the bands of protein expressed were about 25 kDa, which corresponds to the molecular weight of hRBP protein in Fig. 6. MALDI-TOF analysis suggested that the Mascot score was 80 (threshold is 56 score, p < 0.05), and the identification of the protein in the recombinant E. coli JM107 was confirmed by trypsin digestion and mass spectroscopy and it is retinol-binding protein 4.
4. Discussion Direct cloning of PCR product is a very useful technique in molecular biology for preparing clones of cDNA or genomic fragments, and the researchers must amplify DNA fragments with PCR and clone them into a proper vector. This requires researchers to characterize large numbers of transformants in order to ensure that the gene has been inserted in the correct orientation. The method proposed here was found to direct clone PCR products and to distinguish the recombinants with the correct direction inserts from those with incorrect inserts, and no cofactors are required (e.g. X-gal). In most cases, clones carrying cDNA
20
X.-Y. Liang et al./Plasmid 79 (2015) 15–21
Fig. 6. Time-course of hRBP expressed in recombinant E. coli JM107. (A) SDS–PAGE analysis. M: molecular mass standard protein; 1: E. coli JM107 control; 2: E. coli JM107 containing pQE-Ka induced by IPTG; 3–7: hRBP expression induced by IPTG for 0, 1, 3, 5 and 7 h, respectively. (B) Western blot analysis. 1: control: E. coli JM107; 2: hRBP expression before induction of IPTG; 3–7: hRBP expression induced by IPTG for 0, 1, 3, 5 and 7 h, respectively. Western blot analysis of 2 μg expressed protein was performed with HRP- Conjugated Anti-His Tag Mouse Monoclonal Antibody in 1:2000 dilution using the protocol specified by the manufacturer.
fragments in both directions were prepared in the conventional A-T cloning system. With the blue/white screening, the white positive colonies can be distinguished from the blue negative colonies, but the orientation of insert in the white positive colony is unknown (Guo and Bi, 2002). Although there are various methods of reducing the negative background, including GFP protein (Chalfie et al., 1994; Ito et al., 2000), toxic proteins (Johnson et al., 1996; Liu et al., 2010; Liu et al., 2011), and peptides (Riedel et al., 2013), they cannot be avoided to identify and confirm the direction of insertion (Wu et al., 2010). Here, we introduce a restriction site, the BamHI restriction site, to reverse primer for amplifying PCR products. When a PCR productwas inserted into the T vector, the BamHI restriction site may locate on the vector with either direction. The inserted PCR product is the key to determining the direction of the insert. After ligation of the PCR products and vector, there were two BamHI restriction sites on the recombinant plasmid. If the insertion of the PCR products were inserted with the correct orientation into vector, BamHI restriction sites will frank the PCR products, then using the endonuclease BamHI to digest the recombinant vector would produce DNA fragments with molecular weight approximately the same as the PCR product. The non-recombinants and the recombinants without a desired insertion could be excluded after electrophoresis.
Traditionally, two different restriction enzymes are used to digest the vector and PCR products before cloning. When there are other identical restriction enzyme sites existing on the vector or PCR fragments, the restriction site must be avoided or replaced. The conventional cloning T vectors, for example, pMD18, 19-T vector and pGEM-T vector, were frequently used in the molecular laboratories. However, much work remains to be done for identifying the insert orientation in the recombinants. Here we proposed the method that is more convenient than traditional methods, because the PCR products can be cloned directly without concerning the restriction enzyme sites. We have developed this method to construct eukaryotic expression T vectors with Xcm I sites, i.e. the T vectors can be used in yeast and mammalian cells (not published). This method is based on the restriction enzyme digestion of the recombinant to determine the correct orientation of the insert. The restriction enzyme XcmI (CCANNNNN/NNNNTGG), resulting in a one-base 3′-protruding end, was used for constructing such vectors. For similar purposes, restriction enzymes Eam11105I (GACNNN/NNGTC), AspEI (GACNNN/NNGTC), and AhdI (GACNNN /NNGTC) were also available (Ido and Hayami, 1997). In conclusion, a vector with two opposite XcmI restriction sites was developed for cloning and expression. This vector was verified by cloning and expressing the 14-3-3ZsGreen and hRBP protein. The DNA sequence of the T vector and the amino acid sequences of expressed proteins were confirmed by Western blot and MALDI-TOF peptide mass fingerprint. By cloning interested gene by using this T vector, we can identify the direction of the insert gene using one particular restriction enzyme digestion process. This methodology is easy to be manipulated to develop suitable constructs for use in various hosts and is appropriate for many kinds of applications because it requires no cofactors and is highly time- and cost-effective. Acknowledgments We thank Dr. Yong Wang and Shuiming Li for MALDITOF technical assistance and their comments and discussion on this manuscript. This work was partly supported by the grants from the Shenzhen Science & Technology Foundation (ZYC201105130092A). References Arashi-Heese, N., et al., 1999. XcmI site-containing vector for direct cloning and in vitro transcription of PCR product. Mol. Biotechnol. 12, 281–283. Borovkov, A.Y., Rivkin, M.I., 1997. XcmI-containing vector for direct cloning of PCR products. Biotechniques 22, 812–814. Chalfie, M., et al., 1994. Green fluorescent protein as a marker for gene expression. Science 263, 802–805. Cheong, D.E., et al., 2012. A cloning vector employing a versatile betaglucosidase as an indicator for recombinant clones. Anal. Biochem. 425, 166–168. Eisenberg, D., et al., 2000. Protein function in the post-genomic era. Nature 405, 823–826. Guo, B., Bi, Y., 2002. Cloning PCR products. an overview. Methods Mol. Biol. 192, 111–119. Ido, E., Hayami, M., 1997. Construction of T-tailed vectors derived from a pUC plasmid: a rapid system for direct cloning of unmodified PCR products. Biosci. Biotechnol. Biochem. 61. Ito, Y., et al., 2000. A T-extended vector using a green fluorescent protein as an indicator. Gene 245, 59–63.
X.-Y. Liang et al./Plasmid 79 (2015) 15–21
Janner, C.R., et al., 2013. pPCV, a versatile vector for cloning PCR products. Springerplus 2, 441. Jeung, J.U., et al., 2002. Construction of two pGEM-7Zf(+) phagemid T-tail vectors using AhdI-restriction endonuclease sites for direct cloning of PCR products. Plasmid 48, 160–163. Jo, C., Jo, S.A., 2001. A simple method to construct T-vectors using XcmI cassettes amplified by nonspecific PCR. Plasmid 45, 37–40. Johnson, E.P., et al., 1996. Plasmid RK2 toxin protein ParE: purification and interaction with the ParD antitoxin protein. J. Bacteriol. 178, 1420–1429. Lim, H.D., et al., 2010. Construction of a T-vector using an esterase reporter for direct cloning of PCR products. J. Microbiol. Biotechnol. 20, 1481– 1483. Liu, V.W., et al., 2000. One-step directional cloning of blunt-ended polymerase chain reaction products. Anal. Biochem. 287, 349–352. Liu, X., et al., 2010. T vector bearing KillerRed protein marker for red/white cloning screening. Appl. Microbiol. Biotechnol. 405, 272–274. Liu, X., et al., 2011. Positive selection vector using the KillerRed gene. Anal. Biochem. 412, 120–122. Ma, Z., et al., 2014. pKILLIN: a versatile positive-selection cloning vector based on the toxicity of Killin in Escherichia coli. Gene 544, 228–235. Marchuk, D., et al., 1991. Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Res. 19, 1154.
21
Matz, M.V., et al., 1999. Fluorescent proteins from nonbioluminescent Anthozoa species. Nat. Biotechnol. 17, 969–973. Riedel, T., et al., 2013. Complete sequence of the suicide vector pJP5603. Plasmid 69, 104–107. Sambrook, J., et al., 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Lab, Cold Spring Harbor, NY. Studier, F.W., 2005. Protein production by auto-induction in high density shaking cultures. Protein Expr. Purif. 41, 207–234. Studier, F.W., 2014. Stable expression clones and auto-induction for protein production in E. coli. Methods Mol. Biol. 1091, 17–32. Testori, A., et al., 1994. Direct cloning of unmodified PCR products by exploiting an engineered restriction site. Gene 143, 151–152. Vukmirovic, O.G., Tilghman, S.M., 2000. Exploring genome space. Nature 405, 820–822. Wang, D., et al., 2014. Knockdown expression of eukaryotic initiation factor 5 C-terminal domain containing protein extends lifespan in Drosophila melanogaster. Biochem. Biophys. Res. Commun. 446, 465–469. Wu, Q., et al., 2010. A series of novel directional cloning and expression vectors for blunt-end ligation of PCR products. Biotechnol. Lett. 32, 439–443.
Contents lists available at ScienceDirect
Plasmid j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y p l a s
Short Communication
Construction of a directional T vector for cloning PCR products and expression in Escherichia coli Xiu-Yi Liang 1, Zhi-Cheng Liang 1, Zhi Zhang, Jiao-Jiao Zhou, Shi-Yu Liu, Sheng-Li Tian * Shenzhen Key Laboratory of Microbial Genetic Engineering, College of Life Sciences, Shenzhen University, Shenzhen 518060, China
A R T I C L E
I N F O
Article history: Received 22 October 2014 Accepted 19 January 2015 Available online 11 February 2015 Communicated by Richard Calendar Keywords: T vector Directional cloning Prokaryotic expression XcmI cassette
A B S T R A C T
In order to clone PCR products and express them effectively in Escherichia coli, a directional cloning system was constructed by generating a T vector based on pQE-30Xa. The vector was prepared by inserting an XcmI cassette containing an endonuclease XcmI site, a kanamycin selective marker, a multiple-cloning-site (MCS) region and an opposite endonuclease XcmI site into the vector pQE-30Xa. The T vector pQE-T with single overhanging dT residues at both 3′ ends was obtained by digesting with the restriction enzyme XcmI. For directional cloning, a BamHI site was introduced to the ends of the PCR products. A BamHI site was also located on the multiple cloning site of pQE-T. The PCR products were ligated with pQE-T. The directionally inserted recombinants were distinguished by using BamHI to digest the recombinants because there are two BamHI sites located on the both sides of PCR fragment. In order to identify the T-vector functions, the 14-3-3-ZsGreen and hRBP genes were amplified and a BamHI site was added to the ends of the genes to confirm this vector by ligation with pQE-T. Results showed that the 14-3-3-ZsGreen and hRBP were cloned to the vector pQE-T directly and corresponding proteins were successfully produced. It was here demonstrated that this directional vector is capable of gene cloning and is used to manipulate gene expression very easily. The methodology proposed here involves easy incorporation of the construct into other vectors in various hosts. © 2015 Elsevier Inc. All rights reserved.
1. Introduction With the increase of the number of species whose genomes have been sequenced, genome databases and the information they contain are becoming more abundant. These data accelerate the life science research process in projects ranging from the design of primers for DNA amplification, to studies of protein structure (Eisenberg et al., 2000; Vukmirovic and Tilghman, 2000). In general, polymerase chain reaction (PCR) is common for gene amplification in
* Corresponding author. Shenzhen Key Laboratory of Microbial Genetic Engineering, College of Life Sciences, Shenzhen University, Room S415, Nanshan District, Shenzhen, Guangdong 518060, China. Fax: +86 0755 26534274. E-mail address: [email protected] (S.-L. Tian). 1 The authors made equal contribution to this work. http://dx.doi.org/10.1016/j.plasmid.2015.01.003 0147-619X/© 2015 Elsevier Inc. All rights reserved.
vitro (Borovkov and Rivkin, 1997; Jeung et al., 2002; Lim et al., 2010). Cloning PCR products directly and efficiently is an effective method of gene conservation, amplification, sequencing, and expression (Liu et al., 2000). The T vector is widely used for the cloning of PCR products (Marchuk et al., 1991). Due to the terminal transferase activity of the Taq polymerase, PCR products have 3′ dA overhang at both ends. It is known that there is a dT residue at each 3′ end of T vectors, and PCR products can be cloned into T vectors with complementary 3′ dT overhangs. This is called the T–A cloning system. Because T–A cloning is easy to operate within a shorter time, it greatly improves the efficiency of PCR product ligation. Hence, the T vector method has become the most economical approach to the cloning of genes for expression, especially high-throughput cloning (Jo and Jo, 2001). However, there are three main problems in the use of traditional T vectors. One is a complicated process of extraction of plasmids; the other is difficulty to distinguish the positive
16
X.-Y. Liang et al./Plasmid 79 (2015) 15–21
recombinants carrying a plasmid with the insert from those not containing insert plasmids; the third is a sophisticated digestion of endonuclease identification of insert orientation. Traditional T vectors have been shown to be associated with white-blue screening for positive clone screening. However, the white-blue screen system is not always stable or stringent (Liu et al., 2010). When the insert is short, positive recombinants appear between blue and white in color. Moreover, the 5-bromo-4-chloro-3-indolyl-β-Dgalactopyranoside (X-Gal), the substrate of β-galactosidase, is required for the white-blue screening, which is relatively costly (Cheong et al., 2012; Liu et al., 2010; Ma et al., 2014). The other problem is that traditional T vectors cannot guarantee the directional cloning of the PCR products (Ma et al., 2014). Researchers must identify the direction of the insert fragments through restriction endonuclease digestion or DNA sequencing, which is time-consuming (Janner et al., 2013; Testori et al., 1994). Unlike traditional methods, pQE-T showed quicker vector expression construction, more accurate cloning, and fewer laborious and time-consuming steps such as those involving determination of the direction of PCR products. In order to overcome the problems of traditional T vectors, a T vector pQE-T based on pQE-30Xa was designed for directional cloning and prokaryotic expression. pQE-T can be used to clone PCR products directly. After the transformation and the extraction of the plasmids, the direction of insert can be determined by BamHI digestion. Here, fusion protein of 14-3-3 and ZsGreen (14-3-3-ZsGreen) and retinol binding protein from Homo sapiens (hRBP) can be successfully cloned and expressed.
2. Material and methods 2.1. Strains and vectors Escherichia coli JM107 was preserved in our laboratory. pQE-30Xa vector was purchased from Qiagen (Germany). pET-28a vector was purchased from Novagen (Germany). pMD-19T (simple) and pLVX-ZsGreen1-N1 vectors were purchased from Takara (Japan). Anti-His antibody (HRP conjugated) was purchased from Abmart (China). DNA sequencing and the primers used in this study were synthesized at the Beijing Genomics Institute (China) (Table 1).
2.2. DNA manipulation Molecular manipulations such as PCR, gel electrophoresis, plasmid extraction, and restriction endonuclease digestion were performed using standard techniques (Sambrook et al., 1989). All restriction enzymes were purchased from New England Biolabs and used in accordance with the manufacturer’s instructions. 2.3. Construction of pQE-T To obtain the XcmI cassette, kanamycin resistance gene is amplified by PCR using pET-28a vector as the template. PCR is carried out in a total volume of 50 μL with primer TP1, TP2, PCR buffer and Taq DNA polymerase. Two opposite XcmI sites are designed at both ends of the kanamycin resistance gene and designated as the XcmI cassette (Arashi-Heese et al., 1999). The XcmI cassette contained an endonuclease XcmI site, a kanamycin selective marker, an opposite endonuclease XcmI site, and EcoRI, NcoI, BamHI, and HindIII restriction enzyme sites. There is a His tag at the 3′ end of XcmI cassette. The XcmI cassette was linked into pMD-19T vector. The ligation product was transformed into E. coli JM107 competent cells and coated on LB plates containing ampicillin (100 mg/L) and kanamycin (50 mg/L). After plasmid extraction and testing by enzymatic digestions and DNA sequencing, the positive recombinant was identified and named pMD-Ka. The pMD-Ka was digested by restriction endonuclease EcoRI and HindIII to generate XcmI cassette with cohesive ends. The XcmI cassette was linked into expression vector pQE-30Xa digested by EcoRI and HindIII. The ligation product was transformed into E. coli JM107 competent cells, coated on LB plates containing ampicillin and kanamycin, and cultured at 37 °C for 14–16 h. The positive recombinant was identified and named pQE-Ka. A map of pQE-Ka and key sequences are shown in Fig. 1A. pQE-Ka was digested by XcmI to remove the kanamycin resistance gene and produce the prokaryotic expression T vector pQE-T (Fig 1B). 2.4. Preparation of interested gene and verification of T vector pQE-T In order to make protein expression in E. coli visible, the 14-3-3 gene isolated from Physarum polycephalum (GenBank
Table 1 Primers used in this study. Primers
Primer sequences (5′→3′)
Restriction enzyme sites (underlined)
TP1 TP2 1433-P1 1433-ZsG ZsG-P2 hRBP-P1 hRBP-P2
GAATTCATTAAAGAGGAGAAATTAACCATGGGATCCAGAATTTTAATGGGTATGAGCCATATTCAACGGG AAGCTTAATGATGATGATGATGATGTCCACCTTTTCTATGGTTAGAAAAACTCATCGAGC ATGACACACGACGAATTCCGCG AGGCCGTGCTTGGACTGGGCCATTGATTGTCCCTCAGTTTCTCTGGC GGATCCGGGCAAGGCGGAGCCGGAGGCG ATGAAGTGGGTGTGGGCGC GGATCCCAAAAGGTTTCTTTCTGATCTGCC
EcoRI, NcoI, BamHI, XcmI HindIII, XcmI EcoRI
Underlined are endonuclease sites.
BamHI BamHI
X.-Y. Liang et al./Plasmid 79 (2015) 15–21
17
Fig. 1. Plasmid map of pQE-Ka and pQE-T. (A) The XcmI cassette was inserted into EcoRI and HindIII sites of pQE-30Xa and generated the pQE-Ka. The key restriction enzyme sites are indicated. (B) T vector pQE-T was generated after pQE-Ka removed a kanamycin gene by XcmI digestion.
accession number: EF140724) was integrated with the ZsGreen gene, which (695 bp) is a variant of the wild-type Zoanthus sp. green fluorescent protein (Matz et al., 1999). The 14-3-3-ZsG fusion gene was amplified by using overlap PCR with the primers 1433-P1, 1433-ZsG, and ZsG-P2. To further verify the pQE-T vector function, Homo sapiens retinol binding protein 4 (hRBP) (GenBank accession number: NM_006744) gene (636 bp) was amplified by PCR from human liver cDNA with the primers hRBP-P1 and hRBPP2. A BamHI site is designed at the reverse primer for amplifying both genes to facilitate directional identification. To determine the direction of the insert gene, the recombinants were directly digested by endonuclease BamHI. Because the BamHI site is located at downstream primer, if an insert gene were cloned in the wrong direction, the two BamHI sites would be located closely. The recombinant plasmid digested by BamHI could not cleave an interested gene fragment. No corresponding band was visible after agarose gel electrophoresis. 2.5. Western blot analysis of products expressed in E. coli The transformed bacteria containing pQE-ZsGreen were plated on LB plates and cultured at 37 °C for 18 h to observe
fluorescent of colonies under blue light. The recombinants containing pQE-hRBP and pQE-ZsGreen were incubated at 37 °C for 8 h until the OD600 was around 0.8, respectively. Samples before IPTG induction were collected and IPTG was added to final concentration of 1 mmol/L to the medium to induce hRBP expression in E. coli (Studier, 2005, 2014). After adding IPTG, samples were taken out at 1, 3, 5, and 7 h respectively. Samples before and after IPTG induction were treated with lysis buffer and boiled at 100 °C water bath for 10 min and then loaded onto wells of 10% SDS–PAGE for electrophoresis. The gels were stained with Coomassie blue and Western blot analysis (Wang et al., 2014). Western blot analysis of 2 μg expressed protein was performed with HRP Conjugated Anti-His Tag Mouse Monoclonal Antibody (5C3) in 1:2000 dilution (Abbkine, CA, USA) using the protocol specified by the manufacturer. 2.6. In-gel digestion with trypsin The gel pieces in stained hRBP protein were excised from the SDS–PAGE gels in Eppendorf tube, washed with distilled water twice, distained with 200 μL solution (25 mM ammonium hydrogen carbonate, 50% acetonitrile), and incubated for 30 min at 37 °C until the particles were colorless.
18
X.-Y. Liang et al./Plasmid 79 (2015) 15–21
The gel pieces were covered by acetonitrile until gel pieces shrunk and became white; they were then dried by vacuum freeze dryer. Gel particles were incubated with 10 μL of 12.5 ng/mL trypsin (Promega, Madison, WI, USA) becoming transcript and 20 μL of 25 mM ammonium hydrogen carbonate and 10% acetonitrile were added into the Eppendorf tubes and incubated at 37 °C overnight. The supernatants from the trypsin-digested mixtures were collected in separate Eppendorf tubes, and peptides were incubated at 37 °C for 30 min using 50 μL extract solution (50% acetonitrile and 5% formic acid) and then crushed by ultrasonication for 15 min and centrifugated for 10 min with maximum speed. All supernatants derived from the peptide extracts were mixed and lyophilized for MALDITOF analysis.
2.7. MALDI-TOF analysis and MASCOT search All lyophilized samples were resolved in 0.1% TFA and the samples were mixed with 6 mg/mL CHCA matrix and spotted onto the sample board for drying, and they were then analyzed on a MALDI-TOF voyager DE-STR Analyzer (Applied Biosystems, Foster City, CA, USA). The operation parameters were as follows: Peptide mass fingerprints (PMF) were obtained in positive reflector mode. The mass range was set as 800–4000 Da. PMF was outputted in the peacklist text formatting. Proteins were identified using the MASCOT search engine (Matrix Science, London, UK) against the human protein SwissProt database (http://www.matrixscience.com) using the following search criteria: 20,210 peptides were cleaved by trypsin, maximum of 1 missed cleavage, and peptide mass tolerance was 0.45 Da. Mascot score is 80 (the threshold value is 56, p < 0.05), and the protein identified is Retinol-binding protein 4 (RET4_HUMAN).
3. Results 3.1. Construction and verification of directional T vector pQE-T The primers TP1 and TP2 were used to amplify kanamycin resistance gene by PCR. The EcoRI, NcoI, BamHI and XcmI sites were introduced at upstream of kanamycin resistance gene and the opposite XcmI site was designated at downstream of kanamycin resistance gene. It was named as the XcmI cassette. After PCR amplification, agarose electrophoresis showed a band of approximately 900 bp consistent with fragment of kanamycin resistance gene. The XcmI cassette was inserted into a pMD-19T vector to generate recombinant vector pMD-Ka. It was confirmed by endonucleases EcoRI and HindIII. The XcmI cassette was inserted between EcoRI and HindIII sites of pQE-30Xa to generate recombinant plasmid pQE-Ka. The pQE-Ka plasmid was digested by XcmI to remove the kanamycin resistance gene generating a T vector of approximately 3500 bp, indicating that the expression T vector pQE-T had been constructed successfully (Fig. 2).
Fig. 2. Identification of pQE-T by restriction enzyme digestion. M: TaKaRa 5000 DNA marker; 1: XcmI cassette amplified by PCR; 2: recombinant vector pMD-Ka; 3: pMD-Ka digested by EcoRI and HindIII, generating an approximately 750 bp band of Kanamycin gene with EcoRI, NcoI, BamHI, XcmI sites and a 2.69 kb vector band; 4: recombinant vector pQE-Ka; 5: pQE-Ka digested by EcoRI and HindIII generating an approximately 750 bp band of Kanamycin gene with EcoRI, NcoI, BamHI, XcmI sites and a 3.46 kb vector band; 6: pQE-Ka digested by XcmI generating an approximately 750 bp band of Kanamycin gene, XcmI sites and a 3.46 kb vector band.
3.2. ZsGreen and hRBP amplification and ligation into pQE-T ZsGreen and hRBP genes were amplified by PCR. They were linked to linearized pQE-T vector, and the products of ligation were transformed into E. coli JM107. Recombinant vectors pQE-hRBP and pQE-ZsGreen were verified by endonuclease BamHI. Only the recombinants whose insert gene was oriented in the correct direction could be verified by digestion of BamHI, as described previously. The bands corresponding to the PCR products appeared. These results suggested that ZsGreen and hRBP had been cloned into the pQE-T vector in the right direction (Fig. 3A, 3B). DNA sequencing indicated right sequence of ZsGreen and hRBP (data not shown).
3.3. Recombinant protein expression and analysis The 14-3-3-ZsG fusion gene was amplified by using overlap PCR with the primers 1433-P1, 1433-ZsG, and ZsG-P2 and then cloned into pQE-T and transformed into E. coli JM107, coated on an ampicillin LB plate. The positive recombinants in which the insert gene was oriented in the right direction showed strong green fluorescence under 446–464 nm excitation wavelength of blue light in Fig. 4. The result indicated that the PCR products were inserted into T vector pQE-T in 50% ratio of right direction. The proteins were extracted from the green colonies and SDS–PAGE analysis was carried out. Samples displayed an intense band of 60 kDa on SDS–PAGE and stained with Coomassie blue, corresponding to the predicted size of the
X.-Y. Liang et al./Plasmid 79 (2015) 15–21
A
19
B
Fig. 3. 14-3-3-ZsG and hRBP linked with pQE-T and identified by BamHI digestion. (A) M1: TaKaRa 2000 marker; 1: 14-3-3 PCR products; 2: 14-3-3ZsGreen PCR product; 3: recombinant vector pQE-14-3-3-ZsG; 4: pQE-14-3-3-ZsGreen digested by BamHI. (B) M: TaKaRa 5000 marker; 1: hRBP PCR product; 2: recombinant vector pQE-hRBP; 3: pQE-hRBP digested by BamHI.
Fig. 5. SDS–PAGE analysis for recombinant protein 14-3-3-ZsGreen in recombinant E. coli JM107. M: molecular mass standard protein; 1: E. coli JM107 control; 2: the expression of recombinant E. coli JM107 containing pQE-Ka induced by IPTG; 3–7: the expression of recombinant E. coli JM107 containing pQE-ZsGreen induced by IPTG for 0, 1, 3, 5, and 7 h, respectively. Fig. 4. Colonies of recombinant E. coli JM107 were observed under the blue light. The arrows indicated that colonies of recombinant E. coli JM107 containing plasmid pQE-ZsGreen emit bright green fluorescence.
fusion protein 14-3-3-ZsGreen. The results are shown in Fig. 5. In order to further prove the T vector’s function, the positive recombinants of pQE-hRBP with the insert gene in the right direction were selected for expression of hRBP. SDS– PAGE and Western blot analysis showed that the bands of protein expressed were about 25 kDa, which corresponds to the molecular weight of hRBP protein in Fig. 6. MALDI-TOF analysis suggested that the Mascot score was 80 (threshold is 56 score, p < 0.05), and the identification of the protein in the recombinant E. coli JM107 was confirmed by trypsin digestion and mass spectroscopy and it is retinol-binding protein 4.
4. Discussion Direct cloning of PCR product is a very useful technique in molecular biology for preparing clones of cDNA or genomic fragments, and the researchers must amplify DNA fragments with PCR and clone them into a proper vector. This requires researchers to characterize large numbers of transformants in order to ensure that the gene has been inserted in the correct orientation. The method proposed here was found to direct clone PCR products and to distinguish the recombinants with the correct direction inserts from those with incorrect inserts, and no cofactors are required (e.g. X-gal). In most cases, clones carrying cDNA
20
X.-Y. Liang et al./Plasmid 79 (2015) 15–21
Fig. 6. Time-course of hRBP expressed in recombinant E. coli JM107. (A) SDS–PAGE analysis. M: molecular mass standard protein; 1: E. coli JM107 control; 2: E. coli JM107 containing pQE-Ka induced by IPTG; 3–7: hRBP expression induced by IPTG for 0, 1, 3, 5 and 7 h, respectively. (B) Western blot analysis. 1: control: E. coli JM107; 2: hRBP expression before induction of IPTG; 3–7: hRBP expression induced by IPTG for 0, 1, 3, 5 and 7 h, respectively. Western blot analysis of 2 μg expressed protein was performed with HRP- Conjugated Anti-His Tag Mouse Monoclonal Antibody in 1:2000 dilution using the protocol specified by the manufacturer.
fragments in both directions were prepared in the conventional A-T cloning system. With the blue/white screening, the white positive colonies can be distinguished from the blue negative colonies, but the orientation of insert in the white positive colony is unknown (Guo and Bi, 2002). Although there are various methods of reducing the negative background, including GFP protein (Chalfie et al., 1994; Ito et al., 2000), toxic proteins (Johnson et al., 1996; Liu et al., 2010; Liu et al., 2011), and peptides (Riedel et al., 2013), they cannot be avoided to identify and confirm the direction of insertion (Wu et al., 2010). Here, we introduce a restriction site, the BamHI restriction site, to reverse primer for amplifying PCR products. When a PCR productwas inserted into the T vector, the BamHI restriction site may locate on the vector with either direction. The inserted PCR product is the key to determining the direction of the insert. After ligation of the PCR products and vector, there were two BamHI restriction sites on the recombinant plasmid. If the insertion of the PCR products were inserted with the correct orientation into vector, BamHI restriction sites will frank the PCR products, then using the endonuclease BamHI to digest the recombinant vector would produce DNA fragments with molecular weight approximately the same as the PCR product. The non-recombinants and the recombinants without a desired insertion could be excluded after electrophoresis.
Traditionally, two different restriction enzymes are used to digest the vector and PCR products before cloning. When there are other identical restriction enzyme sites existing on the vector or PCR fragments, the restriction site must be avoided or replaced. The conventional cloning T vectors, for example, pMD18, 19-T vector and pGEM-T vector, were frequently used in the molecular laboratories. However, much work remains to be done for identifying the insert orientation in the recombinants. Here we proposed the method that is more convenient than traditional methods, because the PCR products can be cloned directly without concerning the restriction enzyme sites. We have developed this method to construct eukaryotic expression T vectors with Xcm I sites, i.e. the T vectors can be used in yeast and mammalian cells (not published). This method is based on the restriction enzyme digestion of the recombinant to determine the correct orientation of the insert. The restriction enzyme XcmI (CCANNNNN/NNNNTGG), resulting in a one-base 3′-protruding end, was used for constructing such vectors. For similar purposes, restriction enzymes Eam11105I (GACNNN/NNGTC), AspEI (GACNNN/NNGTC), and AhdI (GACNNN /NNGTC) were also available (Ido and Hayami, 1997). In conclusion, a vector with two opposite XcmI restriction sites was developed for cloning and expression. This vector was verified by cloning and expressing the 14-3-3ZsGreen and hRBP protein. The DNA sequence of the T vector and the amino acid sequences of expressed proteins were confirmed by Western blot and MALDI-TOF peptide mass fingerprint. By cloning interested gene by using this T vector, we can identify the direction of the insert gene using one particular restriction enzyme digestion process. This methodology is easy to be manipulated to develop suitable constructs for use in various hosts and is appropriate for many kinds of applications because it requires no cofactors and is highly time- and cost-effective. Acknowledgments We thank Dr. Yong Wang and Shuiming Li for MALDITOF technical assistance and their comments and discussion on this manuscript. This work was partly supported by the grants from the Shenzhen Science & Technology Foundation (ZYC201105130092A). References Arashi-Heese, N., et al., 1999. XcmI site-containing vector for direct cloning and in vitro transcription of PCR product. Mol. Biotechnol. 12, 281–283. Borovkov, A.Y., Rivkin, M.I., 1997. XcmI-containing vector for direct cloning of PCR products. Biotechniques 22, 812–814. Chalfie, M., et al., 1994. Green fluorescent protein as a marker for gene expression. Science 263, 802–805. Cheong, D.E., et al., 2012. A cloning vector employing a versatile betaglucosidase as an indicator for recombinant clones. Anal. Biochem. 425, 166–168. Eisenberg, D., et al., 2000. Protein function in the post-genomic era. Nature 405, 823–826. Guo, B., Bi, Y., 2002. Cloning PCR products. an overview. Methods Mol. Biol. 192, 111–119. Ido, E., Hayami, M., 1997. Construction of T-tailed vectors derived from a pUC plasmid: a rapid system for direct cloning of unmodified PCR products. Biosci. Biotechnol. Biochem. 61. Ito, Y., et al., 2000. A T-extended vector using a green fluorescent protein as an indicator. Gene 245, 59–63.
X.-Y. Liang et al./Plasmid 79 (2015) 15–21
Janner, C.R., et al., 2013. pPCV, a versatile vector for cloning PCR products. Springerplus 2, 441. Jeung, J.U., et al., 2002. Construction of two pGEM-7Zf(+) phagemid T-tail vectors using AhdI-restriction endonuclease sites for direct cloning of PCR products. Plasmid 48, 160–163. Jo, C., Jo, S.A., 2001. A simple method to construct T-vectors using XcmI cassettes amplified by nonspecific PCR. Plasmid 45, 37–40. Johnson, E.P., et al., 1996. Plasmid RK2 toxin protein ParE: purification and interaction with the ParD antitoxin protein. J. Bacteriol. 178, 1420–1429. Lim, H.D., et al., 2010. Construction of a T-vector using an esterase reporter for direct cloning of PCR products. J. Microbiol. Biotechnol. 20, 1481– 1483. Liu, V.W., et al., 2000. One-step directional cloning of blunt-ended polymerase chain reaction products. Anal. Biochem. 287, 349–352. Liu, X., et al., 2010. T vector bearing KillerRed protein marker for red/white cloning screening. Appl. Microbiol. Biotechnol. 405, 272–274. Liu, X., et al., 2011. Positive selection vector using the KillerRed gene. Anal. Biochem. 412, 120–122. Ma, Z., et al., 2014. pKILLIN: a versatile positive-selection cloning vector based on the toxicity of Killin in Escherichia coli. Gene 544, 228–235. Marchuk, D., et al., 1991. Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Res. 19, 1154.
21
Matz, M.V., et al., 1999. Fluorescent proteins from nonbioluminescent Anthozoa species. Nat. Biotechnol. 17, 969–973. Riedel, T., et al., 2013. Complete sequence of the suicide vector pJP5603. Plasmid 69, 104–107. Sambrook, J., et al., 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Lab, Cold Spring Harbor, NY. Studier, F.W., 2005. Protein production by auto-induction in high density shaking cultures. Protein Expr. Purif. 41, 207–234. Studier, F.W., 2014. Stable expression clones and auto-induction for protein production in E. coli. Methods Mol. Biol. 1091, 17–32. Testori, A., et al., 1994. Direct cloning of unmodified PCR products by exploiting an engineered restriction site. Gene 143, 151–152. Vukmirovic, O.G., Tilghman, S.M., 2000. Exploring genome space. Nature 405, 820–822. Wang, D., et al., 2014. Knockdown expression of eukaryotic initiation factor 5 C-terminal domain containing protein extends lifespan in Drosophila melanogaster. Biochem. Biophys. Res. Commun. 446, 465–469. Wu, Q., et al., 2010. A series of novel directional cloning and expression vectors for blunt-end ligation of PCR products. Biotechnol. Lett. 32, 439–443.
