Nucleic Acids Research, Vol. 18, No. 21 6319

Construction of a human chromosome 3 specific Noti linking library using a novel cloning procedure Eugene R.Zabarovsky1 2, Ferenc Boldog1, Teryl Thompson3, David Scanlon3 Gosta Winberg1, Zoltan Marcsek1, Rikard Erlandsson', Eric J.Stanbridge3, George Klein1 and Janos Sumegil 'Department of Tumor Biology, Karolinska Institutet, Box 60400, S-104 01 Stockholm, Sweden, 2Engelhardt Institute of Molecular Biology, USSR Academy of Science, Vavilov Street 32, Moscow 117984, USSR and 3Department of Microbiology and Molecular Genetics, California College of Medicine, Irvine, CA 92717, USA Received July 9, 1990; Revised and Accepted October 8, 1990

ABSTRACT Two new diphasmid vectors (lambda SK1 7 and SK22) and a novel procedure to construct linking libraries are described. A partial filling-in reaction provides counterselection against false linking clones in the library, and obviates the need for supF selection. The diphasmid vectors, in combination with the novel selection procedure, have been used to construct a chromosome 3 specific NotI linking library from a human chromosome 3/mouse microcell hybrid cell line. The application of the new vectors and the strong biochemical and biological selections resulted in a library of 60.000 NotI linking clones. As practically all of them are real NotI linking clones (no false recombinants) the library represents approximately 3.000 human recombinants (equal to 10- 15 genomic equivalents of chromosome 3). Previously published methods for construction of linking libraries are compared with the procedure described in the present paper. The advantages of the new vectors and the novel protocol are discussed. INTRODUCTION Recent cytogenetic and molecular (RFLP) studies have suggested a critical role for chromosomal aberrations on the short arm of chromosome 3 in the development of the VHL disease (1), lung (2), breast (3) and renal cell carcinomas (RCC) (4,5). Cytogenetically, most of the RCC cases can be characterized by deletions of the short arm of chromosome 3 from 3pl3 to 3pter (4). RFLP analysis of tumor-derived DNA revealed allelic losses of known polymorphic DNA markers localized to various parts of 3p suggesting the possible involvement of a tumor suppressor gene, probably on the telomeric side of D3F15S2 marker, in the origin and/or evolution of RCC (5). The search for a suppressor gene in the affected region is however hampered by the size of the chromosomal segment involved. Large areas exist for which no unique sequences are yet available. The gap between the resolution of cytogenetic and conventional molecular methods has been successfully bridged using long range mapping and cloning techniques(6). One of our

approaches for the isolation of the RCC gene is based on the long range mapping which requires a sufficient number of DNA clones from the human chromosome 3 in order to physically connect them. For this purpose the generation of a chromosome 3 specific NotI linking library seemed to be optimal, since a limited number of NotI linking clones (approx. 200-300) can cover the entire chromosome 3 and provide a basis for long range mapping. Although several alternative procedures have been described for the construction of linking libraries (6-9) all of them have limitations, the requirement for size separation of the source genomic DNA, the insertion of foreign DNA fragments in order to select for the target sequences, and the possibility of illegitimate ligation resulting in the occurrence of false linking clones. This prompted us to develop new lambda vectors and a new procedure for cloning NotI linking fragments. This new technology allows a highly selective and efficient cloning of the linking sequences without the need for inserting selective markers.

MATERIALS AND METHODS Cell lines MCH 903.1: is a mouse-human microcell hybrid containing a single copy of human chromosome 3, derived from a normal human diploid fibroblast, as its only human component (Fig. 1). Retention of chromosome 3 resulted from integration of the bacterial neomycin resistance gene into this chromosome following infection of human fibroblasts with retroviral vector pZipNeo. The chromosome 3 was transferred to A9 mouse cells via microcell fusion. 293: Ela transformed human embryonal kidney cell line (10). TK1O (11), TK164 (11), KRC/Y (12): RCC cell lines with different chromosome 3 aberrations. Bacteria and Phages The following E. Coli strains were used: NM646 (13), NM621 (13), XLl-blue (14)

Isolation of DNA The cellular, lambda phage and the plasmid DNA were isolated according to methods described previously (15-17).

6320 Nucleic Acids Research, Vol. 18, No. 21

tA

*Xrok

d1 A

'

3..~~~~~~~~~N

ALsr^ r .;.,

4 7.7k.b.p.

Fig. Fig. 1. Metaphase spread of a G-II stained microcell hybrid MCH 903.1. The arrow head points to the single copy of human chromosome 3. No other human chromosomal material is present. Inset: G-banded chromosome 3 from the same microcell hybrid.

Enzymes Restriction enzymes were purchased from Amersham, New England Biolabs , Boehringer Mannheim and Bioexcellence, T4 DNA ligase was purchased from Boehringer Mannheim. Southern transfer and hybridization The transfer and the hybridization conditions of conventional Southern analysis were as described elsewhere (15). In order to remove the repetitive sequences of the NotI linking fragments we have used a prereassociation technique according to Sealey et al. (18). The plaque and colony hybridizations were performed according to standard protocols (15). The isolation of the DNA for PFGE analysis and the conditions for the electrophoresis, transfer and hybridization were done as previously described (19, 20).

Construction of lambda SK17 and lambda SK22 Lambda SK22 has been constructed by introducing the EcoRIEcoRI fragment from EMBL3 (21) into BamHI cleaved lambda gES7 (22, 23) through a double stranded oligonucleotide

GATCATGCCATGGCATGTTAGGCTAGCCTAGGCCGGCGCGGCCGCTCGAGCCGAATTCGCCGGATCC. The 67

2. Schematic maps of lambda SK17 and lambda SK22 vectors.

fragments were concentrated using 2-butanol, precipitated with ethanol, washed with 70% of ethanol and dissolved in water. The non-ligated, non-circularized DNA fragments were prevented from cloning into the lambda vectors by destroying the BamHI cohesive ends in a partial filling-in reaction (500 1l of total volume containing 100 ,uM dGTP and dATP and 40 u of Klenow enzyme /Boehringer Mannheim/), for 30 min at room temperature (25, 26). The reaction was stopped by adding equal volumes of phenol and chloroform:isoamylalcohol. The extraction was repeated twice and followed by precipitation with ethanol. The DNA samples were dissolved in 200 tl of TE-buffer and subsequently digested with 160 u of NotI for two hours. The DNAs were precipitated, dissolved in 100 ,tl of TE-buffer and ligated to NotI+EcoRI cleaved SK17 and SK22 arms. The concentration of genomic DNA was 500 /tg/rnl and of the lambda DNAs was 130 ytg/ml. The ligation reaction was performed at room temperature, overnight. From each ligation reaction 2.5 ytg DNA was packaged. The procedure resulted in 4.2-4.3 x 104 recombinants with SK17 and 1.8-2.0 x 104 with SK22 vectors. The efficiency of packaging was 5 x 108 pfu/4tg of wild type lambda DNA. The phages were grown in E. Coli NM646 which is non-permissive for the growth of non-recombinant phages. Subeloning of NotI-linking fragments into plasmid form. From each lambda library 2 ,ug of lambda DNA was isolated, digested with Sall (Boehringer Mannheim) at 37°C for one hour, and subsequently heat inactivated. The Sall digested DNA (0.5 ,tg) was self-ligated in 100 pl endvolume with 20 u of T4 ligase (Boehringer Mannheim) at room temperature for 1 h. E. Coli

nucleotides long sequence contains recognition sites for restriction enzymes in the following order: NcoI, AvrII, Sfil, NaeI, NotI, XhoI, EcoRI, BamHI. Lambda SK17 was constructed from lambda SK22 by introducing the 3,5 kb long insert from p4KL-1 plasmid (23, 24).

XL1-blue cells were transformed according to Alexander et al. (27) with 0.2 itg ligated DNA from each library.

Construction of NotI-linking library

RESULTS

DNA from MCH 903.1 human microcell/mouse hybrid cell line (100 Atg) containing a single copy of human chromosome 3 was completely digested with 200 u of BamHI (Boehringer Mannheim) for 1 h at 37°C. The reaction was stopped by heating the sample to 700C for 20 min. The reaction mixture was divided into two equal aliquots. The first aliquot was diluted to 20 ml (2.5 yg DNA/ml) and the DNA was self-ligated in the presence of 300 u of T4 DNA ligase (Boehringer Mannheim). The second aliquot was diluted to 40 ml (1.3 4Ig DNA/ml) and the DNA selfligated in the presence of 500 u of T4 DNA ligase. Both ligation reactions were made overnight at 20°C. The ligated DNA

Two lambda vectors, the SK17 and the SK22 were constructed as described above

(Fig. 2). Using the cloning procedure described in Materials and Methods (see Fig. 3) we constructed NotI linking libraries in

SK 17 and in SK22, applying two different DNA concentrations during the self-circularization step. The packaging of 8 ,tg genomic DNA resulted in approximately 60,000 recombinants in the unamplified libraries. 5% of the 60,000 recombinants hybridized to 32P-labeled total human DNA. 16 clones were randomly selected and cleaved with BamHI and NotI, respectively (8 of them are shown in Fig. 4). It was

Nucleic Acids Research, Vol. 18, No. 21 6321

A

A M 1 2 3 4 5 6 7 8 9 10 11 12

XSK1 7 XSK22

NOTI + ECO RI, PEG

6000

B M

1 2 345 67 89101112

I igatIon with genomic DNA

B genomic DNA

a

Fig. 4. Analysis of eight lambda clones from Notl linking libraries constructed in SK22 (A) and SK17 (B) vectors. M: size marker (lambda HindIl), lanes on A: 1-3: clone NL90, 4-6: clone NL91, 7-9: NL93, 10-12: NL93, lanes on B: 1-3: clone NL94, 4-6: clone NL95, 7-9: NL96, 10-12: NL97. Lanes 1, 4, 7, 10: fragments obtained by BamHI digestion. Lanes 2, 5, 8, 11: fragments of BamHI-NotI double digestion. Lanes 3, 6, 9, 12: fragments obtained by NotI digestion.

C 5C

N'

a

GATC

a

GA3

3'A

TAG

a

5'G'CATC 3AG

3'

C--~

-

4~~~

K( C6) AGGTC

TACS I3' N

S.,3

A3,Go

CTAG

ligation

with

arms

Fig. 3. Flow chart diagram of the cloning procedure. A: Preparation of the arms. B: Preparation of the genomic DNA. (for details see Materials and Methods)

N-Notl, B-BamHI

found that all of the 16 clones contained inserts with a single BamHI site. NotI digestion released the insert, suggesting that all contained a NotI linking fragment. The size range of the fragments was long enough (3.5-17 kb) to contain repetitive elements which made possible the selection for human sequences in the lambda libraries. They had different cleavage patterns suggesting that they were independent clones (Fig. 4). Three clones were further investigated. The inserts were isolated, labelled and hybridized to BamHI cleaved MCH 903.1 DNA separated by gel electrophoresis and transferred to GeneScreen (NEN) membranes. The NotI inserts hybridized to BamHI fragments of the genomic DNA identical in size with the NotI inserts of the lambda clones (Fig. 5). The identification of these clones as NotI linking fragments (i.e. sequences extending across a NotI site) was performed, for instance, as follows. The two fragments containing opposite halves of the NotI site in clone NL125 were hybridized to PFGE

6322 Nucleic Acids Research, Vol. 18, No. 21 A 1 2 3 4 5 6 7

1 2 3 4 5 6 7 8 9 1011 121314 M

B

72 3 4 5 6 7

Fl. 5 Souther analysis of genoic DNA (A) and lambda clones NLIOI, NL102, NLl03 (B). A: Agarose gel electrophoresis of BamHiI digested MCH 903.1 DNA fragments (1,3, 5). The DNA was transferred and hybridized with Nol inserts of lambda clones NLlO 1: lane 2; NL 102: lane 4; NL 103: lane 6. B: Agarose gel electrophoresis of Nodl digested DNA from lambda clones (1, 3, 5). The DNAs were transferred and hybridized with their own Nodl inserts (2, 4, 6). NLIOI: lanes and 2. NLI02 lanes 3 and 4. NLl03: lanes 5 and 6. Lanes A7 and B7: size marker (lambda HinduI). Sections A and B represent two parts of the same agarose gel.

Fig. 7. Analysis of 14 plasmid clones from Notd linking libraries constructed in SK17 (lanes 1-5) and SK22 (lanes 6-14) vectors. The samples were digested with Notd. M: size marker (lambda Hindil). Lanes 13 and 14 are examples of plasmid clones with one Notd site (see Discussion).

^3 4

1 23 4

1

2

3 4 i

.. i

A

B

1 2 3 4 5

1 2345

B

A^

W

.4'.

980 800

t;600 | 4 50 280

Fig. 6. Southern analysis of NotI digested human DNA samples. The same filter was hybridized with 'left part' (A), 'right part' (C), and the entire insert (B) of clone NL125. The DNA samples were isolated from the following cell lines1: 293; 2: TK10; 3: TK164;: KRC/Y. GeneLine (Beckman) instrument, 60 sec pulse time for 18 hours. Size marker: Saccharomyces cerevisiae (334) chromosomes.

blots, prepared from Notl cleaved human DNA. The two DNA fragments detected Notd fragments of 700 kb and 870 kb in size respectively (Fig. 6). Parts of the libraries were transferred to plasmid form and E coli XLl-blue cells were transformed with the plasmid DNA. We obtained a total of 80,000 plasmid clones. Of these, 5 % contained human sequences in accordance with the results obtained from the analysis of the phage clones. NotI digestion of randomly isolated plasmid clones show that a majority (12 out of 14) of the clones have two NotI sites (Fig. 7). To verify that the transfer of linking clones to plasmid form by the method described does not result in rearrangement, we hybridized the inserts from 5 random plasmid clones with different restriction maps to the Bam HI digested MCH 903.1 DNA, exploiting the same strategy that was used for the lambda

11.2 9.16 7.13 5.09

4.07 3.05

-

Ps~=

F

916li -li*

7.13 5.09 4.07 3.05

-U| -

U

Fig. 8. Analysis of plasmid clones NL1, NL2, NL3, NL4 and NL5. A: Agarose gel electrophoresis of NotI and Bam HI digested DNA from plasmid clones NLI (1), NL2 (2), NL3 (3), NL4 (4) and NL5 (5). B: Hybridization of the inserts from plasmid clones NL1 (1), NL2 (2), NL3 (3), NL4 (4) and NL5 (5) to the Bam HI digested MCH 903.1 DNA separated by agarose gel electrophoresis and transferred to the Hybond-N filters. Sizes of the markers are given in kb.

clones (Fig. 5). This experiment demonstrates that the plasmids contain Notd-linking fragments (Fig. 8).

DISCUSSION Several features make the two lambda vectors, SK17 and SK22, suitable for construction of linking and jumping libraries: i) the size of the lambda arms has been designed so that without insert they do not produce viable phages; ii) the cloning capacity of the two lambda vectors is between 0.2-15.4 kb for SK17 and 3.7-18.9 kb for SK22. The broad size range of the clonable inserts into these vectors allows one to clone the majority of

Nucleic Acids Research, Vol. 18, No. 21 6323 genomic fragments, generated by digestion with common like BamHI, PstI, BglIl, EcoRI; iii) the incorporation of the polylinker region into the vectors allows for the use of biochemical selection in addition to biological selection. The common cloning sites in both vectors are BamHI, EcoRI, NotI, NaeI, and SfiI. In addition SacI, AvrII, XhoI and XbaI sites are also available for cloning in SK22; iv) both SK17 and SK22 contain red and gam genes. The existence of these two genes in the stuffer fragment enables biological counter-selection in P2-lysogenic strains of E. Coli (NM646, Q539, NM539 etc). Both vectors allow for specific labelling of 5' or 3' ends of the inserts using standard sequencing and reverse sequencing primers. Small inserts can be amplified by PCR using the same standard primers. The inserts can be transmitted to plasmid and SS form by using the SailI, ClaI or BspME enzymes, which cleave mammalian DNA relatively infrequently. The two lambda vectors have been successfully used in combination with a novel procedure, described in the Materials and Methods in constructing a NotI linking library. The previously described cloning techniques (6-9) include different methods for the selection of the NotI linking clones. Despite the proven efficacy of these methods for obtaining Notd linking clones, we wish to point out several limitations to their use. In the protocol described by Poustka and Lehrach (6) the target DNA was partially digested with Sau3A, and size selected to obtain 10-20 kb fragments. These steps require large amounts of DNA that is not always available, especially when using biopsies and similar in vivo materials. The DNA was then diluted and circularised in the presence of a supF marker plasmid. The circular products were digested with NotI and ligated into a NotI digested suppressor-dependent vector (NotEMBL3A) and plated on a suppressor negative host. In a modification of this protocol (8) the size selection was omitted. Instead, an additional dephosphorylation step of the target DNA was employed. Since commercial phosphatases are often impure and since ligase preparations often contain some kinase activity, this approach may present technical problems. Also inactivation of phosphatases can be incomplete, leading to some degradation of the DNA ends. Although dephosphorylation of the target DNA serves the same purpose as the partial filling-in used in our protocol a number of additional considerations must be taken into account. First, partial filling-in with Klenow polymerase is a reaction that provides a higher fidelity of modification than dephosphorylation (see for example ref. 29). Second, we use it before, not after NotI digestion, so the NotI sticky ends are protected during the reaction. Third, partial filling-in prevents the modified ends from ligating to any sticky ends (note that we have two protruding nucleotides on the target DNA and on the vector arms-four), whereas dephosphorylation forbid only ligation between dephosphorylated molecules, not ligation to other sticky ends (see ref. 9 for examples of the illegitimate ligation products). Fourth, by dephosphorylation, the short Notd linking fragments are prevented from cloning into lambda replacement vectors (such as NotEMBL3A), whereas in our scheme these fragments may be recovered in the libraries as catenates of NotI fragments. Other differences will be mentioned further. In another protocol described by Wallace et al. (9) completely digested target DNA was used. Their vector (Ch3A lacXN) had a maximum cloning capacity of 12 kb, which imposes a limit on the genomic representation of the library. In their case the selection was likewise based on the incorporation of the supF

enzymes,

marker into the recombinant Notd linking clones. A disadvantage of this approach became apparent when it was noted that a high (80%) ratio of lambda clones contained supF but lacked genomic DNA sequences. This demonstrates the possibility of illegitimate ligation of fragments with BamHI sticky ends into NotI sites. The supF selection used in both methods has some other disadvantages. It is difficult to predict and find the optimal ratio of genomic DNA to marker plasmid. Moreover, because the supF marker plasmid is used in excess and is dephosphorylated, it may block both ends of the same genomic fragment decreasing the efficiency of the circularisation (self-ligation) and increasing the possibility of ligation to other genomic DNA fragments, e. g. intermolecular ligation. Artificial linking clones may arise where the two parts of a 'linking' clone represent disjunct fragments in the genome. The supF function is dependent on its environment (28). The suppressor dependent vectors may revert to suppressor independent ones, although some of the vectors used are multiple amber mutants, that lower the likelihood of such event. A third approach introduced by Ito and Sakaki (7) is based on a previous selection of HTF islands, reducing the genomic representation of the NotI linking library. Furthermore, the small size of the clones (several hundred bp) makes it difficult to select the clones of interest from hybrid cell lines on the basis of species specific repetitive sequences. Because of the small size it is also difficult to label the fragments to the high specific activity required to probe PFGE blots. In order to improve the existing cloning procedures and to avoid their limitations we have developed a new cloning procedure. The major features and advantages are as follows: 1: It is possible to use complete BamHI digestion instead of partial Sau3A because of the cloning capacity of our SK17 and SK22 vectors

(0.2-18.9 kb).

2: To facilitate the selection of NotI linking fragments and prevent the nonhomologous ligation of BamHI fragments to the NotI cleaved lambda arms we used a partial filling in reaction. The partial filling in of BamHI sites also prevents the coligation and cloning of DNA sequences coming from nonadjacent sites of the genome, into one lambda clone. The application of this step has two main consequences -the use of the supF marker is obviated and ligation of the noncircular products to the arms is prevented. 3: Using both biochemical and biological selection we were able to enrich for recombinants in our linking libraries. 4: The vectors used allow for the transmission of the linking library into plasmid and SS form. 5: The NotI linking clones are suitable for direct sequencing using standard sequencing primers, that is quite useful for STS-approach (STS - sequence tagged site). 6: After circularisation and partial filling-in the genomic DNA can be used for preparing any other linking library by simply digesting with the needed enzyme. Dephosphorylation or other additional operations are not required. 7: A similar approach is useful for the construction of jumping libraries. 8: The procedure described above is simple, fast, and does not need size-separation or dephosphorylation. The analysis of 16 random phage clones showed that all of them were recombinants with the predicted structure. The average insert (results were calculated from about 80 samples) size was 7.5 kb in the case of lambda SK17 and 10.5 kb in the case of lambda SK22 libraries, so small Notd fragments do not constitute a high proportion of the clones obtained in this system. It is possible that some of the Bam HI fragments containing NotI sites are larger than the capacity of SK22. It is difficult to

6324 Nucleic Acids Research, Vol. 18, No. 21

predict how many such fragments exist in the human genome, but clearly, they can not be numerous. There are several ways to improve representativity. First, one may use also NotEMBL3A, SK4 or SK25 (8,23) in parallel with SK17 and SK22. This will increase cloning capacity up to 23.4 kb. But inserts in these vectors can not be transmitted into plasmid form and some Bam HI fragments can be larger than 23.4 kb. Second, one may construct a NotI-linking library using partial digestion with frequently cutting enzymes like MboI (8). However, this way is not as convenient as complete digestion and creates some additional problems. Third, one may construct a NotI-linking library using genomic DNA digested not only with Bam HI but in parallel with BglIl, Eco RI or other restriction enzymes. In this the case genomic DNA's can even be mixed after digestion and circularisation and subsequent steps can be performed jointly in the same tube. The transmission of the libraries into plasmid form resulted in plasmids with two NotI sites in approximately 80% of the cases. The reason for the structural changes in the remaining 20% is the presence of a SalI site within the insert. Because the pBR322 ori sequence is located in the left arm of lambda SK17 and SK22, the plasmid clones with one NotI site (see Fig. 7) may still represent real linking clones (if the SalI site is on the right side on the BamHI site) or just Notd restriction site clones (if the SailI site is on the left side of the BamHI site). Our analysis of 80 plasmid clones (data not presented) showed that approximately 90% of them were real linking clones with an internal BamHI site. This is in good agreement with a 50% chance of having a SalI site on either the left or the right side of the BamHI site. Our cloning strategy makes it possible to demonstrate directly using a Southern blot analysis, that the clones obtained are real NotI linking clones. A particular NotI insert in a lambda or plasmid clone should have the same size as the genomic BamHI fragment carrying that same Notd site. On the other hand, if a particular NotI insert is not a real linking fragment, it will give two hybridizing bands in the Southern analysis. This prediction was borne out for all 8 randomly picked NotI linking clones (3 lambda clones and 5 clones after plasmid conversion, see Fig. 5 and Fig. 8). Assuming that the average distance between two nonmethylated Notd sites is approximately 500 kb- I Mb, the number of NotI sites in the mammalian genome may be estimated at around 3-4,000. Our unamplified library contained 60,000 independent recombinants from the human chromosome 3/ mouse microcell hybrid cell line. Approximately 3,000 clones hybridized to total human DNA indicating their human chromosome 3 origin. About 300 Notd linking clones spaced on chromosome 3 are sufficient to physically connect them. The method described in this paper should be useful for the construction of junction libraries in order to facilitate the mapping of complex genomes. We have used it successfully for constructing other Nod, XhoI and SalI linking libraries.

ACKNOWLEDGEMENT This investigation was supported by PHS grant 5 RO1 CA14054-15 awarded by the National Cancer Institute, DHHS, and by the Swedish Cancer Society. E. R. Z., F. B., G. W., Z. M. and J. S. are recipients of fellowships from the Cancer Research Institute and Concern Foundation, F. B. and Z. M. were supported by the Swedish Cancer Society, R. E. has received stipend from Syskonen Svenssons Foundation for

Medical Research, F. B. received stipend from Tatjana and Jacob Kamras' forskningsfond and Z. M. was supported by the Swedish Institute.

REFERENCES 1. Seizinger et al. (1988) Nature 332, 268-269 2. Naylor S.L., Johnson B.E., Minna J.D., Sakaguchi A.Y. (1987) Nature 329, 451-54 3. Devilee P., van den Broek M., Kuipers-Dijkshoorn N., Kolluri R., Meera Khan P., Pearson P.L., Cornelisse C.J. (1989) Genomics 5, 554-560 4. Kovacs G., Frisch S. (1989) Cancer Res 49, 651-659 5. Kovacs G., Erlandsson R., Boldog F., Ingvarsson S., Muller-Brechlin R., Klein G., Sumegi J. (1988) Proc Natl Acad Sci USA 85, 1571-1575 6. Poustka A. and Lehrach H. (1986) Trends in Genet. 2, 174-179 7. Ito T. and Sakai Y. (1988) Nucl. Acids Res. 16, 9177-9184 8. Pohl T.M., Zimmer M., MacDonald M.E., Smith B., Bucan M., Poustka A., Volinia S., Searle S., Zehetner G., Wasmuth J.J., Gusella J., Lehrach H. and Frischauf A-M. (1989) Nucl. Acids Res. 16, 9185-9198 9. Wallace M.R., Fountain J.W., Brereton A.M. and Collins F.S. (1989) Nucl. Acids Res. 17, 1665-1677 10. Graham F., Smiley J., Russel W.G.C. and Naim R.G. (1977) J. Gen. Virol. 36, 59-72. 11. Bear A., Clayman R.V., Elbers J., Limas C., Wang N., Stone K., Gebhard R., Prigge W. and Palmer J. (1987) Cancer Res. 47, 3856-3862 12. Yano H., Maruiwa M., Sugihara S., Kojiro M., Noda S. and Eto K. (1988) In Vitro Cell. Dev. Biol. 24, 9-17 13. Whittaker P.A., Campbell A.J.B., Southern E.M. and Murray N.E. (1988) Nucl. Acids Res. 16, 6725-6736 14. Bullock W.O., Fernandez J.M. and Short J.M. (1987) Biotechniques 5, 376-379 15. Maniatis T., Fritsch E.F. and Sambrook J. (1982) Molecular cloning: A Laboratory Manual. Cold Spring Harbour 16. Zabarovsky E.R. and Turina O.V. (1988) Nucl. Acids Res. 16, 10925 17. Asubel F.M., Brent R., Kingston R.E., Moore D.D., Seidman J.G., Smith J.A., Struhl K. (1987- 1990) Current protocols in molecular biology. John Wiley & Sons, Inc., New York, Chicester, Brisbane, Toronto, Singapore 18. Sealey P.G., Whittaker P.A. and Southern E.M. (1985) Nucl. Acids Res. 13, 1905-1922 19. Boldog F., Erlandsson R., Klein G., Sumegi J. (1989) Cancer Genet.Cytogenet. 42, 295-306 20. Minarovits J., Steinitz M., Boldog F., Imreh S., Wirschubsky Z., Ingvarsson S., Hedenskog M., Minarovits-Kormuta S., Klein G. (1990) Int.J.Cancer 45, 514-520 21. Frischauf A-M., Lehrach H., Poustka A. and Murray N. (1983) J. Mol. Biol. 170, 827-842 22. Zabarovsky E.R., Turina O.V. and Kisselev L.L. (1989) Nucl. Acids Res. 17, 4407 23. Zabarovsky E.R., Winberg G. and Klein G. (1990) manuscript, submitted for publication 24. Zabarovsky E.R., Zagorskaya E.G. and and Kisselev L.L. (1989) Nucl. Acids Res. 17, 4408 25. Huang M-C. and Wensinck P.C. (1984) Nucl. Acids Res. 12, 1863- 1874 26. Zabarovsky E.R. and Allimnets R.L. (1986) Gene 42, 119-123 27. Alexander D.C., McKnight T.D. and Williams B.G. (1984) Gene 31, 79-89 28. Collins F.S. and Weissman S.M. (1984) Proc. Natl Acad. Sci. USA 81, 6812-6816. 29. Mead D., Goiffon V., Crowell V., Fiandt M. and Morris B. (1988) Promega Notes 14, 1-5