Journal of Microbiological Methods 100 (2014) 1–7

Contents lists available at ScienceDirect

Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth

Construction of an inducible system for the analysis of essential genes in Yersinia pestis☆ D.C. Ford ⁎,1, P.M. Ireland 1, H.L. Bullifent, R.J. Saint, E.V. McAlister 2, M. Sarkar-Tyson, P.C.F. Oyston Defence Science and Technology Laboratory, Porton Down, Salisbury, Wiltshire SP4 0JQ, UK

a r t i c l e

i n f o

Article history: Received 18 November 2013 Received in revised form 20 January 2014 Accepted 25 January 2014 Available online 11 February 2014 Keywords: Conditional lethal Yersinia pestis Essential genes Antibiotic targets DeoD PyrH

a b s t r a c t Yersinia pestis, a Gram negative bacterium, causes bubonic and pneumonic plague. Emerging antibiotic resistance in clinical isolates is driving a need to develop novel antibiotics to treat infection by this transmissible and highly virulent pathogen. Proteins required for viability, so called essential genes, are attractive potential therapeutic targets, however, confirmation of essentiality is problematic. For the first time, we report the development of a system that allows the rapid determination of Y. pestis gene essentiality through mutagenesis and inducible expression of a plasmid borne copy of the target gene. Using this approach, we have confirmed the uridine monophosphate kinase PyrH as an essential protein in Y. pestis. This methodology and the tools we have developed will allow the confirmation of other putative essential genes in this dangerous pathogen, and facilitate the identification of novel targets for antimicrobial development. © 2014 Published by Elsevier B.V.

1. Introduction Yersinia pestis is a Gram-negative bacterium which has evolved relatively recently from Yersinia pseudotuberculosis (Achtman et al., 1999) with at least 2000 cases of plague being notified to the World Health Organisation annually (Gage and Kosoy, 2005). However, unlike its enteropathogenic ancestor, Y. pestis causes bubonic and pneumonic plague, with the latter form being particularly acute and rapidly fatal unless treated (Stenseth et al., 2008). Primarily a disease of rodents, humans are incidental hosts and bubonic plague arises when the organism is transmitted from an infected host by fleas (Chouikha and Hinnebusch, 2012). A secondary pneumonia can arise during bubonic plague, whereas primary pneumonic plague develops following inhalation of the pathogen; pneumonic cases generate infectious aerosols and as such pose a significant risk to close contacts (Stenseth et al., 2008). Treatment of plague has relied upon broad spectrum antibiotics such as streptomycin, chloramphenicol, tetracycline and fluoroquinolones (Kilonzo et al., 1992; Meyer, 1950; Wagle, 1948), but prompt initiation of therapy is essential. There has been a rise in the reported incidence of plague, particularly in Africa, and as a consequence it is categorised as a

☆ © Crown Copyright 2013. Published with the Permission of the Defence Science and Technology Laboratory on Behalf of the Controller of HMSO. ⁎ Corresponding author. Tel.: +44 1980 614283; fax: +44 1980 614307. E-mail address: [email protected] (D.C. Ford). 1 These authors have contributed equally to this study. 2 Present address: Imperial College, London SW7 2AZ, UK .

http://dx.doi.org/10.1016/j.mimet.2014.01.017 0167-7012/© 2014 Published by Elsevier B.V.

re-emerging disease (Duplantier et al., 2005; Schrag and Wiener, 1995). The virulence of Y. pestis and ease of transmission by aerosol exposure has led to the pathogen being categorised as a level A biothreat agent by the CDC (Inglesby et al., 2000). Recent discoveries of antibiotic resistant strains of Y. pestis have increased the necessity to develop novel antimicrobials for treatment (Galimand et al., 2006; Guiyoule et al., 2001). Various approaches have been undertaken to identify novel antibiotic targets, including antivirulence strategies (Rasko and Sperandio, 2010), molecular profiling (Chan et al., 2010), and identification of attenuating (Robinson et al., 2005) and essential genes (Duffield et al., 2010). There has been considerable debate regarding which type is the ‘best’ antimicrobial target, essential targets or attenuating targets. On the one hand essential genes are absolutely required for the survival of the bacterium, they are usually highly conserved between species and targeting these gene products would both eradicate the bacterial population and result in clearance of infection. However, these inhibitors may also have the undesirable effect of affecting the host microbiota and may increase the selective pressure for drug resistant mutations. On the other hand, targeting virulence factors would affect a bacterium's virulence without inhibiting its growth or stripping the host microbiota. This would reduce the selective pressure for drug resistance, but virulence factors can be very species-specific, and antimicrobials that target virulence factors would thus be narrow spectrum. Essential gene products are considered by many to be better targets for the development of novel broad spectrum antimicrobials, and a number of methods have been used to identify them. For example,

2

D.C. Ford et al. / Journal of Microbiological Methods 100 (2014) 1–7

whole genome transposon mutagenesis has been used in a number of bacteria such as Francisella novicida, Escherichia coli and Pseudomonas aeruginosa (Gallagher et al., 2007; Hagiwara et al., 2003; Liberati et al., 2006) and more recently the high-throughput approach of transposondirected insertion-site sequencing (TraDis) was used to identify the essential gene set of Salmonella enterica Serovar Typhimurium (Langridge et al., 2009). Essential genes have also been identified using complete gene inactivation methods such as plasmid insertion mutagenesis (Kobayashi et al., 2003) or allelic replacement (Baba et al., 2006): those genes for which repeated attempts failed to generate mutants, remain candidates for further analysis. This has resulted in the identification of a large number of potentially essential genes in numerous bacteria, which have been collated in the Database for Essential Genes (DEG) enabling in silico approaches to identify essential genes exploiting this information, supported by genomic, proteomic and pathway data which is also freely available (Chong et al., 2006; Duffield et al., 2010). Despite being promising drug targets, genes identified in this way need to be confirmed as essential, and whilst identification of essential genes in one bacterium can hint at essentiality in other species, this extrapolation cannot be made without confirmation in the specific bacterium of interest, as essentiality is often a product of the environment. This has been achieved using conditional mutagenesis to target specific genes in well characterised pathogens for which diverse genetic tools are available, such as E. coli and Bacillus subtilis (Baba et al., 2006; Kobayashi et al., 2003). Such methods are not available for Y. pestis, therefore the aim of this study was to develop the tools that enable confirmation of putative essential genes in the Yersinia species. Here we report the construction of an expression plasmid containing the rhamnose-regulated promoter of E. coli. Once a gene is placed under the control of the promoter the chromosomal copy is deleted under inducing conditions using λ Red mutagenesis. Essentiality is assessed through culture in glucose. 2. Materials and methods 2.1. Bacterial strains and culture conditions The bacterial strains used in this study are listed in Table 1. Strains of Y. pestis, were grown in blood agar base (BAB) broth or BAB agar supplemented with hemin (0.025%) incubated at 28 °C.

Y. pseudotuberculosis and E. coli were grown in Luria-Bertani (LB) broth (Atlas, 2004) and LB-agar incubated at 28 °C. Where required, media was supplemented with 25 μg/ml chloramphenicol, 25 μg/ml kanamycin and 100 μg/ml of trimethoprim. All work undertaken with Yersinia strains was performed under appropriate laboratory containment conditions in accordance with relevant legislative requirements. The use of antibiotic markers was approved for this work, reviewed locally by a genetic manipulation safety committee and also approved nationally by the UK health and safety authorities. 2.2. Construction of the rhamnose inducible plasmid pBADrha Plasmids used in this study are listed in Table 1. An expression plasmid was constructed that would allow tight control of gene expression from a rhamnose-inducible promoter. The rhamnose inducible promoter and regulatory control genes rhaR-rhaS-PrhaB were isolated from pSCrhaB2 by NsiI and HindIII restriction digestion. The 2093 bp fragment was ligated into the similarly digested pBAD33 and the resulting construct was designated pBADrha. The rhamnose-inducible pBADrha contained the low copy p15A replicon (12–22 copies per cell (Chang and Cohen, 1978; Cozzarel et al., 1968)), a chloramphenicol resistance cassette and a multiple cloning site for ease of manipulation (Fig. 1). 2.3. Generation of conditional lethal Y. pseudotuberculosis or Y. pestis strains The Y. pseudotuberculosis ΔpyrH, ΔdeoD conditional mutants were constructed using a modified λ red mutagenesis method (Derbise et al., 2003). All plasmids created in this study are listed in Table 1 and oligonucleotide primers used are listed in Table 2. Briefly, primers designed for gene disruption included a 20 bp sequence complementary to the 5′ or 3′ of the kanamycin resistance gene of the plasmid pK2 minus the cognate promoter region, followed by 50 bp of upstream or downstream sequence of the Y. pseudotuberculosis genome flanking the gene of interest. PCR products were generated using plasmid pK2 as a template. Excess template was digested with DpnI and the PCR product purified using Millipore Microcon Ultracel YM-100. PCR products were transformed into Y. pseudotuberculosis/pAJD434/pBADrha-

Table 1 Bacterial strains and plasmids. Strain or plasmid

Description

Source or reference Promega

Y. pestis GB pBADrha-pyrH

Host cloning strain. endA1, recA1, gyrA96, thi, hsdR17 (r–k, m+ k ), relA1, supE44, Δ(lac-proAB), [F′ traD36, proAB, laqIqZΔM15]. Sequenced strain Y. pseudotuberculosis IP32953 containing pAJD434 Y. pseudotuberculosis IP32953 containing pAJD434 and pBADrha-pyrH Y. pseudotuberculosis IP32953 containing pAJD434 and pBADrha-deoD Y. pseudotuberculosis IP32953 containing a kanamycin cassette in place of the chromosomal pyrH gene and containing pBADrha-pyrH Y. pestis GB containing a kanamycin cassette in place of the chromosomal deoD gene and containing pBADrha-deoD Biovar Orientalis, fully virulent Y. pestis GB containing pAJD434 Y. pestis GB containing pAJD434 and pBADrha-pyrH Y. pestis GB containing a kanamycin cassette in place of the chromosomal pyrH gene and containing pBADrha-pyrH, cured of the pAJD434 plasmid by heat-shock Y. pestis GB containing pBADrha-pyrH, cured of the pAJD434 plasmid by heat-shock

Plasmids pSCrhaB2 pBAD33 pBADrha pBADrha-pyrH pBADrha-deoD pK2 pAJD434

Rhamnose induced expression vector oripBBR1 rhaR rhaS PrhaB Tpr mob+ Arabinose-induced expression vector, orip15 PBAD Catr Rhamnose induced expression vector, orip15 rhaR rhaS PrhaB Catr pBADrha containing the Y. pseudotuberculosis pyrH gene pBADrha containing the Y. pseudotuberculosis deoD gene pGEM®-T-Easy vector with a KanR cassette at the Bgl II restriction site Arabinose inducible λ red recombinase genes

Strains E. coli JM109 Y. Y. Y. Y. Y.

pseudotuberculosis IP32953 pseudotuberculosis/pAJD434 pseudotuberculosis/pAJD434/pBADrha-pyrH pseudotuberculosis/pAJD434/pBADrha-deoD pseudotuberculosis IP32953 ΔpyrH-C

Y. pseudotuberculosis IP32953 ΔdeoD-C Y. pestis GB Y. pestis/pAJD434 Yersinia pestis/pAJD434/pBADrha-pyrH Y. pestis ΔpyrH-C

a. Tpr denotes trimethoprim resistance; CatR denotes chloramphenicol resistance; and KanR denotes kanamycin resistance.

(Chain et al., 2004) This study This study This study This study This study (Hill et al., 1997) This study This study This study This study

(Cardona and Valvano, 2005) (Guzman et al., 1995) This study This study This study (Taylor et al., 2005) (Maxson and Darwin, 2004)

D.C. Ford et al. / Journal of Microbiological Methods 100 (2014) 1–7

3

Fig. 1. Map of the rhamnose inducible conditional complementation plasmid pBADrha. A rhamnose inducible promoter was utilised from pscrhaB2 (Cardona and Valvano, 2005) to control expression of pyrH in Y. pestis. dhfr, trimethoprim resistance cassette; OripBBR1, BBR1 origin of replication; mob, mobilization domain; Para, arabinose inducible promoter; araC, Para regulatory gene; CAT, chloramphenicol resistance cassette; PrhaB, rhamnose inducible promoter; rhaR and rhaS, regulatory genes of the rhamnose promoter; rrnBT1T2 transcriptional terminator; M13ori, M13 origin of replication; and p15Aori, p15A origin of replication.

pyrH or Y. pseudotuberculosis/pAJD434/pBADrha-deoD by electroporation. Following overnight incubation at 28 °C in LB supplemented with 0.8% w/v arabinose to induce expression of the recombinase and 0.02% w/v rhamnose to induce plasmid expression of PyrH or DeoD, transformants were selected on L-agar supplemented with kanamycin and rhamnose (0.02%) for 48 h at 28 °C. Transformants were screened by PCR using gene-specific primers (Table 2). Mutant strains were cured of the pAJD434 plasmid by growth at 37 °C in LB medium supplemented with kanamycin, rhamnose (0.02%) and

Table 2 Oligonucleotides used in this study. Name Rha_checkF Rha_checkR deoDF deoDR deoDdelF

Sequence

GATATAGGCGCCAGCAACCG AAAGCGCCTGAATTCGCGAC GCTTAGCATATGGCAACGCCACATATTAATG GCTAGTCTAGATTACGCGTTATCACCCAGTAAC ACCGCAATTAAGTTAACATATTAATTCTCTGATTTTTAAGGAAAGTGATT ATGAGCCATATTCAACGGG deoDdelR ACCGCTGAAGAAAGAAAAAACCGCTGGAAAGGGAGAAGCTTGAGACGC GATTAGAAAAACTCATCGAGCATC deoDcheckF TGAGCTGAGCGAGTCAGTTC deoDcheckR TGGAAAGGGAGAAGCTTGAG deoDFrtpcr GGGTGATTTCGCCGACGTTG deoDRrtpcr GCGTTATCACCCAGTAACAC cmkFrtpcr CCCGGTGATAACCGTTGATG cmkRrtpcr GCATAAGCCAGCGCCTGTTC pyrHF CTGCATTAATTTACTGCTGCTTAGGACAC pyrHR TGGCCTGCAGTTATTTAGCGATCAATGTCC pyrHdelF TAGCGCACACCGCTGCTGTGAGTATCTGACGGTCAAGTCTCCAATATTAT ACAAGGGGTGTTATGAGCC pyrHdelR AAAGGGGCAGACAGAACAATGTGCTTACCCCTGATAATAAGGTCTGTCGC TTAGAAAAACTCATCGAGCATC pyrHcheckF TCACTCGATACCCGTGATAC pyrHcheckR CCCTTGGAAACTGGTTAC yscCF ACAACTGGCTCTGCTAGA yscCR TCACAATACGCCACGCTT lcrVF TCTACCCGAGGATGCCATTC lcrVR TCTAGCAGACGTTGCATCAC

calcium chloride (2.5 mM) for a minimum of 30 h. Cured mutant strains, designated Y. pseudotuberculosis ΔpyrH-C, and Y. pseudotuberculosis ΔdeoD-C were screened for the virulence plasmid pYV by PCR using primers for the yscC gene (Table 2) located on this plasmid. The Y. pestis ΔpyrH-C mutant was constructed as described for the Y. pseudotuberculosis ΔpyrH-C mutant above using the same pBADrhapyrH plasmid as the sequence of the pyrH gene (YPTB3001) was identical in Y. pestis (YPO1046). The method for generating the mutant in Y. pestis was the same with the exception of the use of BAB media and BAB-hemin agar and the screening of mutant strains for the virulence plasmid pCD1 using primers for the lcrV gene (Table 2).

2.4. Growth studies of Y. pseudotuberculosis and Y. pestis strains Y. pseudotuberculosis and Y. pestis strains were recovered from glycerol stocks onto BAB agar containing 0.02% w/v rhamnose and incubated for 48 h at 28 °C. All strains were suspended to an OD590 of 0.06 in 50 ml LB or BAB broth and incubated with shaking (200 rpm) overnight at 28 °C. This pre-incubation in the absence of inducer or repressor (rhamnose or glucose respectively) was necessary to allow the metabolism of intracellular rhamnose and/or the titration of PyrH or DeoD through replication. Both wild-type and mutant strains grew to a similar density during overnight incubation (data not shown). The bacteria were pelleted by centrifugation and washed once with LB or BAB broth before being re-suspended to an OD590 of 0.06 in the two test media: LB or BAB + 0.02% w/v rhamnose and LB or BAB + 0.1% w/v glucose. Growth curves were performed in a 96 well microtitre plate format. Outer wells were filled with 200 μl distilled water to reduce evaporation and test wells with 200 μl of each test culture. Each growth condition was tested three times each with six technical replicates. A sterile gas permeable membrane (Breathe-Easy, Diversified Biotech) was used to seal the 96-well plates. Growth curves were generated using a microplate reader (Multiskan FC, Thermo Scientific) housed in a class III biological safety cabinet. The plate was incubated at 28 °C with shaking at 5 Hz, amplitude 15 mm and the OD595 recorded every 15 min for 9 h.

4

D.C. Ford et al. / Journal of Microbiological Methods 100 (2014) 1–7

2.5. RT-PCR of strains under induced or repressed conditions Mutant strains were grown in either inducing (0.02% rhamnose) or repressing (0.1% glucose) conditions to mid-exponential phase and the RNA extracted from each sample using the RNeasy mini kit (Qiagen) according to the manufacturer's instructions. Contaminating DNA was removed from the samples with TURBO DNase (Ambion) according to the manufacturer's instructions. The remaining RNA was reverse transcribed using the Enhanced Avian HS RT-PCR kit (Sigma-Aldrich). PCR's using Taq polymerase were carried out using samples following DNase treatment and reverse transcription using the RT-PCR primers specific to deoD or a control gene (cmk) listed in Table 2. 2.6. Virulence studies Female BALB/c age-matched mice, approximately six weeks old, were used in this study. The mice had access to food and water and were grouped together in cages of six animals under 12 h light/dark cycles. For challenge with Y. pestis, the animals were handled under bio-safety level III containment conditions within a half-suit isolator, compliant with British Standard BS5726. All investigations involving animals were carried out according to the requirements of the Animal (Scientific Procedures) Act 1986. Humane endpoints were strictly observed and animals deemed incapable of survival were humanely killed by cervical dislocation. BALB/c mice are susceptible to infection, with the median lethal dose for Y. pestis strain GB being 1 colony forming unit (cfu) by the sub-cutaneous (sc) route of infection (Russell et al., 1995). Y. pestis strains were grown in 10 ml of BAB broth supplemented with 0.02% rhamnose, shaking (200 rpm) overnight at 28 °C. Cultures were diluted 1 in 10 in BAB broth and grown to exponential phase with shaking (200 rpm) at 28 °C to an OD595 of 0.6. This suspension was then serially diluted with sterile PBS and retrospective viable counts were determined by plating out dilutions on BAB agar supplemented with 0.02% rhamnose and kanamycin (25 μg/ml) for the mutant strain. Groups of six mice were challenged with 0.1 ml of the 1 × 10 − 4 dilution (1000 cfu) of wild type Y. pestis GB, Y. pestis ΔpyrH-C or Y. pestisGB pBADrha-pyrH by the sc route and the infection monitored for 12 days. Y. pestisGB pBADrha-pyrH was included to determine whether the complementation plasmid added a physiological burden to the strain which may be detrimental to growth in vivo. 2.7. Statistical analyses Growth curve data (using optical density readings) was analysed by repeated measures univariate general linear model using the statistical analysis software SPSS version 18.0 (IBM™). Each bacterial strain was analysed separately using sugar source as the testing variable and time as the repeated measure. Time was always found to play a significant role in culture optical density (P b 0.001, in all cases). Suitability for data for linear modelling was confirmed using Levene's tests for unequal variance. The survival data from the virulence studies was analysed using a Log-rank (Mantel-Cox) test to compare the curves. 3. Results and discussion 3.1. Development of a genetic system for the construction of conditional mutants in Y. pseudotuberculosis Initially, the tools and methodology for confirmation of essentiality were developed in Y. pseudotuberculosis, as a safer and easier to handle alternative to Y. pestis. This also gave confidence in the target selected for inactivation in Y. pestis. The validation of the essential target was then undertaken in a fully virulent strain of Y. pestis. The use of λ Red recombinase by our laboratory to generate mutants in Y. pseudotuberculosis has been reported previously (Walker et al.,

2012). The first stage of this process was the transformation of Y. pseudotuberculosis IP32953 with the plasmid carrying the gene encoding the recombinase to generate the strain Y. pseudotuberculosis/ pAJD434. Similarly, Y. pestis/pAJD434 was created by the introduction of pAJD434 into strain GB by electroporation and subsequent selection on BAB hemin agar supplemented with trimethoprim (100 μg/ml) at 28 °C for 48 h. In a previous study we identified a panel of predicted essential proteins, including DeoD and PyrH, that were conserved across a number of different bacterial genera, and validated our approach with a simple experiment to determine whether mutants could be generated in the test bacterium Y. pseudotuberculosis (Duffield et al., 2010). No mutants were generated following several rounds of mutagenesis targeting the deoD and pyrH genes (data not shown), indicating that they may well be essential to viability of Y. pseudotuberculosis. The pyrH and deoD genes were selected as proof of principle targets to confirm essentiality as they are essential in other bacteria (Ingraham and Neuhard, 1972; Lee et al., 2007; Liechti and Goldberg, 2012; Smallshaw and Kelln, 1992) and are both enzymes in key metabolic pathways, making them attractive antimicrobial targets (Lee et al., 2007.; Yoshida et al., 2012). To definitively confirm the essentiality of these genes, we devised an approach to construct a conditional mutant, where a plasmid borne copy of the deleted gene is expressed under the tight regulation of an inducible promoter. To enable the conditional expression of the putatively essential gene, we constructed a plasmid, pBADrha (Fig. 1), with the gene of interest under the control of the rhamnose inducible promoter PrhaB. The tightly controlled PrhaB promoter allows gene expression at low concentrations of rhamnose that are not osmotically stressful to the bacteria and has been used successfully to characterise several essential genes in Burkholderia species (Cardona and Valvano, 2005; Juhas et al., 2012.; Ortega et al., 2007). The plasmid pBADrha-pyrH was constructed through ligation of the PCR amplified (primers pyrHF and pyrHR) pyrH gene as an AseI/PstI fragment into pBADrha that had been digested with NdeI and PstI. Whilst NdeI and AseI have compatible ends, the resulting ligation disrupted the ATG translational start codon so the native pyrH ribosome binding site (RBS) and start codon was included in the forward primer. The plasmid pBADrha-deoD was constructed through ligation of the PCR amplified (primers deoDF and deoDR) deoD gene as an NdeI/XbaI fragment into pBADrha that had been digested with NdeI and XbaI: this puts the deoD gene under the direct control of the native rhamnose promoter and RBS. The resulting plasmids, pBADrha-pyrH and pBADrha-deoD were confirmed by sequencing prior to transformation of Y. pseudotuberculosis/pAJD434 by electroporation. Following overnight incubation at 28 °C in BAB broth, transformants were selected using LB-agar supplemented with chloramphenicol and trimethoprim for 48 h at 28 °C. Transformants were screened by PCR with primers rha_checkF and R (Table 2) for the presence of either pBADrha-pyrH or pBADrha-deoD and the resulting strains, Y. pseudotuberculosis/pAJD434/pBADrha-pyrH and Y. pseudotuberculosis/ pAJD434/pBADrha-deoD were used as a background for the chromosomal deletion of pyrH or deoD respectively using λ Red mutagenesis, as described previously (Derbise et al., 2003). The mutants were cured of pAJD434 and confirmed for the presence of the large virulence plasmid, which can be unstable in vitro. The strains were designated Y. pseudotuberculosis IP32953 ΔpyrH-C and Y. pseudotuberculosis IP32953 ΔdeoD-C. Growth of the Y. pseudotuberculosis ΔpyrH-C and Y. pseudotuberculosis ΔdeoD-C mutants was assessed in LB broth in a 96-well format, under permissive conditions (0.02% w/v rhamnose), where the plasmid borne copy of the mutated gene was induced, and non-permissive (0.1% w/v glucose) conditions, where it was repressed. As expected, the rate of growth of wild-type Y. pseudotuberculosis was identical under both conditions (P = 0.211). The growth observed for Y. pseudotuberculosis ΔdeoD-C mirrored that of the wild type (P = 0.775). In contrast the growth of Y. pseudotuberculosis ΔpyrH-C was significantly inhibited in the nonpermissive media (P b 0.001) (Fig. 2). Neither of the mutant strains

D.C. Ford et al. / Journal of Microbiological Methods 100 (2014) 1–7

Growth (OD595)

0.6

5

3.2. Validation of the conditional mutagenesis approach in Y. pestis

0.4

0.2

0.0 0

1

2

3

4

5

6

7

8

Time (h) Fig. 2. Growth of Y. pseudotuberculosis IP32953, ΔpyrH-C is significantly reduced under non-permissive conditions (0.1% w/v glucose) relative to permissive (0.02% w/v rhamnose) (P ≤ 0.001) No difference in wild type or ΔdeoD–C growth was observed under these conditions (P = 0.211 and P = 0.775 respectively). Wild type 0.02% rhamnose (Δ), wild type 0.1% glucose (▲), ΔdeoD-C 0.02% rhamnose (□),ΔdeoD –C 0.1% glucose (■),ΔpyrH-C 0.02% rhamnose (○),ΔpyrH-C 0.1% glucose (●). The figure is representative of three independent experiments with six technical replicates for each value.

was able to exactly match the wild type growth under permissive conditions, which may be a result of aberrant expression of either PyrH or DeoD from a non-native promoter and/or the impact of plasmid copy number. From this data we have concluded that pyrH is an essential gene in Y. pseudotuberculosis but deoD is not. This is in contrast to our previous hypothesis for deoD, which we expected to be essential (Duffield et al., 2010). DeoD functions as a nucleotide phosphorylase in the purine salvage pathway, a pathway which is growth limiting for all bacteria. Based upon both our own results, where we were previously unable to construct a mutant of deoD in Y. pseudotuberculosis, and entries in the DEG suggesting that deoD is essential in 11 other bacterial strains (Bacillus subtilis, E. coli, F. novicida, Haemophilus influenza, Helicobacter pylori, Mycoplasma genitalium, Mycoplasma pulmonis, Staphylococcus aureus, Streptococcus pneumoniae, Salmonella typhimurium and Vibrio cholerae) (Duffield et al., 2010; Liechti and Goldberg, 2012), this target had a high likelihood of being essential. However in our tightly controlled conditionally lethal system, it clearly is shown to be nonessential. Thus deoD may just have been a difficult target to mutate in Y. pseudotuberculosis, demonstrating the importance of constructing conditional mutants in the pathogen of interest to definitively prove essentiality. To verify that deoD is not essential and that growth under repression was not due to mutation in the regulatory regions of the complementation plasmid RT-PCR was performed. deoD was expressed in the presence of rhamnose (Fig. 3 lane 3) but was repressed in the presence of glucose (Fig. 3 lane 6) further validating deoD as a gene not essential for replication. Primers deoDFrtpcr and deoDRrtpcr were used to assess deoD gene expression (687 bp) and cmk was used as a control gene with primers cmkFrtpcr and cmkRrtpcr (645 bp). Y. pseudotuberculosis contains two other enzymes in the purine salvage pathway, GuaC and Gpt which could functionally substitute DeoD, in addition to the presence of a de novo purine synthesis pathway, which may explain why DeoD is not essential in this species.

The system was developed in Y. pseudotuberculosis as a model for Y. pestis, the aetiological agent of plague, since Y. pseudotuberculosis and Y. pestis have high levels of genome conservation (Chain et al., 2004) and Y. pseudotuberculosis can be used as a safe model to work up methods for subsequent validation in Y. pestis. Ultimately, in the quest for novel antimicrobials for the treatment of plague, we wished to validate the approach in Y. pestis, rather than extrapolating from Y. pseudotuberculosis. The identification of pyrH as an essential gene in our model organism Y. pseudotuberculosis, suggests that this may be a good target to pursue for the development of new antimicrobials for the treatment of Y. pestis. However, as DeoD did not appear to be essential in Y. pseudotuberculosis, we did not progress this target for mutagenesis in the plague bacillus and focussed on PyrH. We constructed a conditional mutant of the pyrH gene in Y. pestis, designated Y. pestis ΔpyrH-C. The Y. pestis ΔpyrH-C mutant was constructed as described for the Y. pseudotuberculosis ΔpyrH-C mutant above using the same pBADrha-pyrH plasmid, as the sequence of the pyrH gene was identical in both Y. pseudotuberculosis and Y. pestis. The growth of wild-type Y. pestis was identical under both permissive (0.02% w/v rhamnose) and non-permissive (0.1% w/v glucose) conditions (P = 0.700). However Y. pestis ΔpyrH-C growth was significantly reduced under non-permissive conditions, a consequence of repressing expression of PyrH, but grew when cultured in permissive conditions through induction of the plasmid borne pyrH gene (P b 0.001) (Fig. 3). These mirror the results obtained for Y. pseudotuberculosis ΔpyrH-C and confirms that pyrH is similarly an essential gene for the viability of Y. pestis in vitro. Again, growth of Y. pestis ΔpyrH-C under permissive conditions was lower than observed for Y. pestis GB, likely caused by aberrant expression of PyrH from a non-native promoter and/or the impact of plasmid copy number. It has been previously suggested that Y. pestis may not be able to utilise rhamnose as a carbon source (Charusanti et al., 2011). However, in our study we have shown that the rhamnose can interact with the plasmid-encoded rhamnose regulatory proteins to induce expression of PyrH. It has also been reported that glucose can inhibit growth of Y. pestis due to its metabolism resulting in an acidic pH (Higuchi and Carlin, 1957; Higuchi and Carlin, 1958), a problem which we encountered. However, this was overcome by optimising the concentration of glucose used for repression of the PrhaB promoter to permit growth whilst still repressing expression of PyrH (data not shown). It is important to note that a gene found to be essential in vitro is not necessarily essential in vivo. An example of this in Y. pestis is the aroA gene, a component of the bacterial biochemical pathway for the synthesis of aromatic amino acids. The intact pathway is required for growth on defined media lacking aromatic amino acids, a phenotype which can be rescued by addition of aromatic amino acids, but a ΔaroA strain of Y. pestis was still virulent in vivo in a mouse model of infection (Oyston et al., 1996). Hence a gene can only be said to be essential within a particular context. It was therefore necessary to demonstrate that the pyrH gene was essential for Y. pestis viability in vivo. Groups of 6 Balb/c mice were infected with 1000 cfu Y. pestis GB, Y. pestis ΔpyrH-C grown in the presence of rhamnose to induce pyrH, and Y. pestis GB pBADrha-pyrH and observed for a period of 12 days. All mice challenged with Y. pestis GB and Y. pestis GB pBADrha-pyrH had succumbed to infection by day 6 (Fig. 4), showing that possession of the plasmid was not exerting an excessive physiological burden detrimental to growth in vivo. In contrast,

Fig. 3. Expression of deoD in Y. pseudotuberculosis ΔdeoD-C can be induced or repressed through incubation with rhamnose or glucose respectively as determined by RT-PCR. Lane 1, genomic WT DNA positive control; lane 2, no DNA control; lane 3, cDNA from induced condition; lane 4, RNA from induced condition; lane 5, cDNA from induced conditions with control gene primer pair; lane 6, cDNA from repressed condition; lane 7, RNA from repressed condition; and lane 8, cDNA from repressed conditions with control gene primer pair.

6

D.C. Ford et al. / Journal of Microbiological Methods 100 (2014) 1–7

Growth (OD595)

0.25

nature of genes in these bacterial species. PyrH has been shown to be a suitable target for inhibitors in a recent study with S. aureus (Doig et al., 2013). Therefore with the confirmation of PyrH as an essential protein in Y. pestis, its ubiquitous representation across bacterial species and low sequence homology/substrate specificity to eukaryotes (Yan and Tsai, 1999), this is a promising target for the development of novel broad-spectrum antibiotics.

0.20 0.15 0.10

Acknowledgements

0.05 We thank Tom Laws for performing statistical analysis of the data within this manuscript.

0.00 0

1

2

3

4

5

6

7

8

Time (h) Fig. 4. Growth of Y. pestis GB ΔpyrH-C is significantly reduced under non-permissive conditions (0.1% w/v glucose) relative to permissive (0.02% w/v rhamnose) (P ≤ 0.001). No difference in wild type growth was observed under these conditions (and P = 0.700). Wild type 0.02% rhamnose (Δ), wild type 0.1% glucose (▲), ΔpyrH-C 0.02% rhamnose (○), and ΔpyrH-C 0.1% glucose (●). The figure is representative of three independent experiments with six technical replicates for each value.

100% of mice challenged with Y. pestis ΔpyrH-C survived (P = 0.01). In the in vivo environment, where rhamnose is not present, induction of the PrhaB promoter of pBADrha-pyrH and subsequent complementation of PyrH will not occur, thus demonstrating that pyrH is essential for in vivo viability of Y. pestis in a mouse model of infection and this defect cannot be complemented by the acquisition of nutrients from the host. Determination of the bacterial burden in the blood and spleen showed that mice infected with the mutant strain had cleared the infection (data not shown). (See Fig. 5.) 4. Conclusions The conditional mutagenesis system constructed in this study has been used to determine the essentiality or otherwise of two genes in the Yersinia species. We have confirmed the integrity of this system for this purpose as one gene, pyrH, was confirmed to be essential in vitro, whereas another gene, deoD, was clearly non-essential. This was despite DeoD looking just as promising a target as PyrH in previous studies, where it has been indicated to be essential in a range of bacterial species including Y. pseudotuberculosis (Duffield et al., 2010). However, for reasons that are not clear, it appears that deoD is just difficult to mutate in Y. pseudotuberculosis rather than essential. The approach has confirmed that PyrH is essential for viability of both Y. pseudotuberculosis and Y. pestis. We have also shown that the conditional mutants can be utilised to determine gene essentiality in vivo by demonstrating that the pyrH gene is essential for viability of Y. pestis in a mouse model of infection. This is the first conditional mutagenesis system described for Yersinia and will provide a useful tool for confirming the essential

Fig. 5. ΔpyrH-C is significantly attenuated in a murine model of infection [log-rank (Mantel–Cox) test p b 0.01]. Mice challenged sc with 1000 CFU: Y. pestis GB (∙∙∙), Y. pestis ΔpyrH-pBADR-pyrH (−−−) and Y. pestis pBADR-pyrH (−−).

References Achtman, M., Zurth, K., Morelli, C., Torrea, G., Guiyoule, A., Carniel, E., 1999. Yersinia pestis, the cause of plague, is a recently emerged clone of Yersinia pseudotuberculosis. Proc. Natl. Acad. Sci. U. S. A. 96, 14043–14048. Atlas, R.M., 2004. Handbook of microbiological media, 3rd. (8-12). Baba, Tomoya, Ara, Takeshi, Hasegawa, Miki, Takai, Yuki, Okumura, Yoshiko, Baba, Miki, Datsenko, Kirill A., Tomita, Masaru, Wanner, Barry L., Mori, Hirotada, 2006. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2, 2006.0008. Cardona, S.T., Valvano, M.A., 2005. An expression vector containing a rhamnose-inducible promoter provides tightly regulated gene expression in Burkholderia cenocepacia. Plasmid 54, 219–228. Chain, P.S.G., Carniel, E., Larimer, F.W., Lamerdin, J., Stoutland, P.O., Regala, W.M., Georgescu, A.M., Vergez, L.M., Land, M.L., Motin, V.L., Brubaker, R.R., Fowler, J., Hinnebusch, J., Marceau, M., Medigue, C., Simonet, M., Chenal-Francisque, V., Souza, B., Dacheux, D., Elliott, J.M., Derbise, A., Hauser, L.J., Garcia, E., 2004. Insights into the evolution of Yersinia pestis through whole-genome comparison with Yersinia pseudotuberculosis. Proc. Natl. Acad. Sci. U. S. A. 101, 13826–13831. Chan, J.N.Y., Nislow, C., Emili, A., 2010. Recent advances and method development for drug target identification. Trends Pharmacol. Sci. 31, 82–88. Chang, A.C.Y., Cohen, S.N., 1978. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from P15A cryptic miniplasmid. J. Bacteriol. 134, 1141–1156. Charusanti, Pep, Chauhan, Sadhana, McAteer, Kathleen, Lerman, Joshua A., Hyduke, Daniel R., Motin, Vladimir L., Ansong, Charles, Adkins, Joshua N., Palsson, Bernhard O., 2011. An experimentally-supported genome-scale metabolic network reconstruction for Yersinia pestis CO92. BMC Syst. Biol. 5. Chong, Chan Eng, Lim, Boon San, Nathan, Sheila, Mohamed, Rahmah, 2006. In silico analysis of Burkholderia pseudomallei genome sequence for potential drug targets. In Silico Biol. 6, 341–346. Chouikha, I., Hinnebusch, B.J., 2012. Yersinia-flea interactions and the evolution of the arthropod-borne transmission route of plague. Curr. Opin. Microbiol. 15, 239–246. Cozzarel, N.R., Kelly, R.B., Kornberg, A., 1968. A minute circular DNA from Escherichia coli 15. Proc. Natl. Acad. Sci. U. S. A. 60, 992–999. Derbise, A., Lesic, B., Dacheux, D., Ghigo, J.M., Carniel, E., 2003. A rapid and simple method for inactivating chromosomal genes in Yersinia. FEMS Immunol. Med. Microbiol. 38, 113–116. Doig, Peter, Gorseth, Elise, Nash, Tory, Patten, Arthur, Gao, Ning, Blackett, Carolyn, 2013. Screening-based discovery of the first novel ATP competitive inhibitors of the Staphylococcus aureus essential enzyme UMP kinase. Biochem. Biophys. Res. Commun. 437, 162–167 (19-7). Duffield, Melanie, Cooper, Ian, McAlister, Erin, Bayliss, Marc, Ford, Donna, Oyston, Petra, 2010. Predicting conserved essential genes in bacteria: in silico identification of putative drug targets. Mol. Biosyst. 6, 2482–2489. Duplantier, J.M., Duchemin, J.B., Chanteau, S., Carniel, E., 2005. From the recent lessons of the Malagasy foci towards a global understanding of the factors involved in plague reemergence. Vet. Res. 36, 437–453. Gage, K.L., Kosoy, M.Y., 2005. Natural history of plague: perspectives from more than a century of research. 505–528. Galimand, Marc, Carniel, Elisabeth, Courvalin, Patrice, 2006. Resistance of Yersinia pestis to antimicrobial agents. Antimicrob. Agents Chemother. 50, 3233–3236. Gallagher, Larry A., Ramage, Elizabeth, Jacobst, Michael A., Kaul, Rajinder, Brittnacher, Mitchell, Manoil, Colin, 2007. A comprehensive transposon mutant library of Francisella novicida, a bioweapon surrogate. Proc. Natl. Acad. Sci. U. S. A. 104, 1009–1014. Guiyoule, A., Gerbaud, G., Buchrieser, C., Galimand, M., Rahalison, L., Chanteau, S., Courvalin, P., Carniel, E., 2001. Transferable plasmid mediated resistance to streptomycin in a clinical isolate of Yersinia pestis. Emerg. Infect. Dis. 7, 43–48. Guzman, L.M., Belin, D., Carson, M.J., Beckwith, J., 1995. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P-BAD promoter. J. Bacteriol. 177, 4121–4130. Hagiwara, D., Sugiura, M., Oshima, T., Mori, H., Aiba, H., Yamashino, T., Mizuno, T., 2003. Genome wide analyses revealing a signaling network of the RcsC-YojN-RcsB phosphorelay system in Escherichia coli. J. Bacteriol. 185, 5735–5746. Higuchi, K., Carlin, C.E., 1957. Studies on the nutrition and physiology of pasteurella-pestis.1. A casein hydrolyzate medium for the growth of pasteurella-pestis. J. Bacteriol. 73, 122–129. Higuchi, K., Carlin, C.E., 1958. Studies on the nutrition and physiology of pasteurella-pestis.2. A defined medium for the growth of pasteurella-pestis. J. Bacteriol. 75, 409–413.

D.C. Ford et al. / Journal of Microbiological Methods 100 (2014) 1–7 Hill, J., Leary, S.E.C., Griffin, K.F., Williamson, E.D., Titball, R.W., 1997. Regions of Yersinia pestis V antigen that contribute to protection against plague identified by passive and active immunization. Infection and Immunity 65, 4476–4482. Inglesby, T.V., Dennis, D.T., Henderson, D.A., Bartlett, J.G., Ascher, M.S., Eitzen, E., Fine, A.D., Friedlander, A.M., Hauer, J., Koerner, J.F., Layton, M., McDade, J., Osterholm, M.T., O'Toole, T., Parker, G., Perl, T.M., Russell, P.K., Schoch-Spana, M., Tonat, K., 2000. Plague as a biological weapon — medical and public health management. JAMA 283, 2281–2290. Ingraham, J.L., Neuhard, J., 1972. Cold sensitive mutants of Salmonella typhimurium defective in uridine Mmonophosphate kinase (Pyrh). J. Biol. Chem. 247, 6259–6265. Juhas, M., Stark, M., von Mering, C., Lumjiaktase, P., Crook, D.W., Valvano, M.A., Eberl, L., 2012. High confidence prediction of essential genes in Burkholderia Cenocepacia. PLoS One 7. Kilonzo, B.S., Makundi, R.H., Mbise, T.J., 1992. A decade of plague epidemiology and control in the western Usambara mountains, north east Tanzania. Acta Trop. 50, 323–329. Kobayashi, K., Ehrlich, S.D., Albertini, A., Amati, G., Andersen, K.K., Arnaud, M., Asai, K., Ashikaga, S., Aymerich, S., Bessieres, P., Boland, F., Brignell, S.C., Bron, S., Bunai, K., Chapuis, J., Christiansen, L.C., Danchin, A., Debarbouille, M., Dervyn, E., Deuerling, E., Devine, K., Devine, S.K., Dreesen, O., Errington, J., Fillinger, S., Foster, S.J., Fujita, Y., Galizzi, A., Gardan, R., Eschevins, C., Fukushima, T., Haga, K., Harwood, C.R., Hecker, M., Hosoya, D., Hullo, M.F., Kakeshita, H., Karamata, D., Kasahara, Y., Kawamura, F., Koga, K., Koski, P., Kuwana, R., Imamura, D., Ishimaru, M., Ishikawa, S., Ishio, I., Le Coq, D., Masson, A., Mauel, C., Meima, R., Mellado, R.P., Moir, A., Moriya, S., Nagakawa, E., Nanamiya, H., Nakai, S., Nygaard, P., Ogura, M., Ohanan, T., O'Reilly, M., O'Rourke, M., Pragai, Z., Pooley, H.M., Rapoport, G., Rawlins, J.P., Rivas, L.A., Rivolta, C., Sadaie, A., Sadaie, Y., Sarvas, M., Sato, T., Saxild, H.H., Scanlan, E., Schumann, W., Seegers, J.F.M.L., Sekiguchi, J., Sekowska, A., Seror, S.J., Simon, M., Stragier, P., Studer, R., Takamatsu, H., Tanaka, T., Takeuchi, M., Thomaides, H.B., Vagner, V., van Dijl, J.M., Watabe, K., Wipat, A., Yamamoto, H., Yamamoto, M., Yamamoto, Y., Yamane, K., Yata, K., Yoshida, K., Yoshikawa, H., Zuber, U., Ogasawara, N., 2003. Essential Bacillus subtilis genes. Proc. Natl. Acad. Sci. U. S. A. 100, 4678–4683. Langridge, G.C., Phan, M.D., Turner, D.J., Perkins, T.T., Parts, L., Haase, J., Charles, I., Maskell, D.J., Peters, S.E., Dougan, G., Wain, J., Parkhill, J., Turner, A.K., 2009. Simultaneous assay of every Salmonella Typhi gene using one million transposon mutants. Genome Res. 19, 2308–2316. Lee, S.E., Kim, S.Y., Kim, C.M., Kim, M.K., Kim, Y.R., Jeong, K., Ryu, H.J., Lee, Y.S., Chung, S.S., Choy, H.E., Rhee, J.H., 2007. The pyrH gene of Vibrio vulnificus is an essential in vivo survival factor. Infect. Immun. 75, 2795–2801. Liberati, N.T., Urbach, J.M., Miyata, S., Lee, D.G., Drenkard, E., Wu, G., Villanueva, J., Wei, T., Ausubel, F.M., 2006. An ordered, nonredundant library of Pseudomonas aeruginosa strain PA14 transposon insertion mutants. Proc. Natl. Acad. Sci. U. S. A. 103, 2833–2838.

7

Liechti, G., Goldberg, J.B., 2012. Helicobacter pylori relies primarily on the purine salvage pathway for purine nucleotide biosynthesis. J. Bacteriol. 194, 839–854. Maxson, M.E., Darwin, A.J., 2004. Identification of inducers of the phage shock protein system and comparison to the regulation of the RpoE and Cpx Yersinia enterocolitica extracytoplasmic stress responses. J. Bacteriol. 186, 4199–4208. Meyer, K.F., 1950. Modern therapy of plague. Jama 144, 982–985. Ortega, X.P., Cardona, S.T., Brown, A.R., Loutet, S.A., Flannagan, R.S., Campopiano, D.J., Govan, J.R.W., Valvano, M.A., 2007. A putative gene cluster for aminoarabinose biosynthesis is essential for Burkholderia cenocepacia viability. J. Bacteriol. 189, 3639–3644. Oyston, P.C.F., Russell, P., Williamson, E.D., Titball, R.W., 1996. An aroA mutant of Yersinia pestis is attenuated in guinea-pigs, but virulent in mice. Microbiology-Uk 142, 1847–1853. Rasko, D.A., Sperandio, V., 2010. Anti-virulence strategies to combat bacteria-mediated disease. Nat. Rev. Drug Discov. 9, 117–128. Robinson, V.L., Oyston, P.C.F., Titball, R.W., 2005. A dam mutant of Yersinia pestis is attenuated and induces protection against plague. FEMS Microbiol. Lett. 252, 251–256. Russell, P., Eley, S.M., Hibbs, S.E., Manchee, R.J., Stagg, A.J., Titball, R.W., 1995. A comparison of plague vaccine, Usp and Ev76 vaccine induced protection against Yersinia pestis in a murine model. Vaccine 13, 1551–1556. Schrag, S.J., Wiener, P., 1995. Emerging infectious disease — what are the relative roles of ecology and evolution. Trends Ecol. Evol. 10, 319–324. Smallshaw, J.C., Kelln, R.A., 1992. Cloning, nucleotide sequence and expression of the Escherichia coli K-12 pyrH gene encoding UMP kinase. Genet. (Life Sci Adv) 11, 59–65. Stenseth, Nils Chr, Atshabar, Bakyt B., Begon, Mike, Belmain, Steven R., Bertherat, Eric, Carniel, Elisabeth, Gage, Kenneth L., Leirs, Herwig, Rahalison, Lila, 2008. Plague: past, present, and future. PLoS. Med. 5, 9–13. Taylor, V.L., Titball, R.W., Oyston, P.C.F., 2005. Oral immunization with a dam mutant of Yersinia pseudotuberculosis protects against plague. Microbiology 151, 1919–1926. Wagle, P.M., 1948. Recent advances in the treatment of bubonic plague. Indian J. Med. Sci. 2, 489–494. Walker, Nicola J., Clark, Elizabeth A., Ford, Donna C., Bullifent, Helen L., McAlister, Erin V., Duffield, Melanie L., Acharya, K., Oyston, Petra C., 2012. Structure and function of cytidine monophosphate kinase from Yersinia pseudotuberculosis, essential for virulence but not for survival. Open Biol. 2. Yan, H.G., Tsai, M.D., 1999. Nucleoside monophosphate kinases: structure, mechanism, and substrate specificity. Adv. Enzymol. 73, 103–134. Yoshida, T., Nasu, H., Namba, E., Ubukata, O., Yamashita, M., 2012. Discovery of a compound which acts as a bacterial UMP kinase PyrH inhibitor. FEMS Microbiol. Lett. 330, 121–126.