71
Pkus Research, 22 (1991) 71-78 0 1991 Elsevier Science Publishers B.V. All rights reserved Old-1702/91/$03.50
VIRUS 00722
Construction
R.V. Blackburn
of an infectious cDNA clone of echovirus 6 ‘, V.R. Racaniello
’ and V,F. Righthand
’
’ Department of Immunolo~ and Microb~olo~, Wayne State University, Detroit, MI 48201, U.S.A. and 2 Department of ~icrob~olo~,
Co~~b~ ~n~oersi~ College of Physicians and pigeons, NY 10032, U.S.A.
New York,
(Received 31 July 1991; revision received and accepted 23 September 1991)
Summary A complete cDNA copy of the echovirus 6 genome was constructed. Complementary DNA was reversed transcribed from viral RNA. Subgenomic cDNAs were obtained by direct cloning and polymerase chain reactions. Full length cDNA was constructed into the Bluescript II vector (pBSI1) using unique, overlapping, restriction sites of four clones. The cDNA was infectious and produced echovirus 6 particles that behaved in the same manner as the parental virus. Echovirus 6; Infectious cDNA; Enterovirus
The enterovirus genus of the picornaviridae family consists of approximately 70 viruses that infect humans. They were originally subgrouped by their source of isolation into polioviruses, coxsackieviruses and echoviruses. The echoviruses are the largest subgroup of enteroviruses and can cause acute diseases such as myocarditis, pericarditis, pleurodynia, myositis and encephalitis (Bell and Grist, 1971). They have also been implicated in chronic neurological and cardiac diseases (Kandolf, 1988). Despite their importance as pathogens, studies on the molecular biology of the echoviruses have been limited. Co~es~~deffce to: V.F. Righthand, Department University, Detroit, MI 48201, U.S.A.
of Immunolo~
and Mi~robiolo~,
Wayne State
72
A major contribution to the study of the molecular genetics of enteroviruses came from the construction of an infectious DNA copy of poliovirus 1 (Racaniello and Baltimore, 1981). Subsequently, infectious cDNAs were constructed for virulent and attenuated strains of the three poliovirus types (Semler et al., 1984, Omata et al., 1984) and Coxsackie B3 (Kandolf and Hofschneider, 1985). These cDNAs have been used to prepare infectious recombinants of different virus strains, and have facilitated the identification of genomic regions responsible for specific functions such as replicase recognition sites (Johnson and Semler, 1988) host range (La Monica et al., 19861, and neurovirulence (Murray et al., 1988). Also, the availability of infectious cDNAs have permitted construction of antigenic chimeras for potenial use as safe vaccines (Minor et al., 1990; Kitson et al., 1991). In this paper, we present the first construction of an infectious cDNA of echovirus 6. The Charles strain of echovirus 6 (Barron and Karzon, 1965) was used for these studies. The virus was grown in WISH cells and purified by density gradient centrifugation in sucrose or cesium chloride. Virion RNA was extracted with equal volumes of phenol : chloroform : isoamyl alcohol (24 : 24 : 1) as described previously (Righthand and Blackburn, 1989). A modified procedure of Moss et al. (19891 was used to generate echovirus 6 cDNA. Approximately 1 pg virion RNA was used as a template for first strand cDNA synthesis by 2 U/ml avian myeloblastosis virus reverse transcriptase (Pharmacia Fine Chemicals, Piscataway, NJ) using 30 pg/ml ohgo(dT), as a primer. The RNA/cDNA molecules were resolved by size on 1% alkaline agarose gels (Maniatis et al., 1982) and visualized by autoradiography of the dried gels. Second strand cDNA was generated by replacement synthesis on the RNA/cDNA hybrid (250 pug>with RNAase H and E. coli DNA polymerase (Ticehurst et al., 1983). Double strand cDNAs were extracted with equal volumes of phenol : chloroform (1: 1) and purified by column chromatography (Biospin 6 columns, Bio-Rad, Richmond, CA), precipitated with ethanol and resuspended in sterile deionized water. The cDNA was inserted into the PstI site of plasmid pUC9 by the addition of oligo(dG)-oligo(dC1 homopolymer tails (Ticehurst et al., 1983). Ampicillin resistant clones, recovered after transformation of competent E. coli cells (JM 101 or DHSa), were screened for inserts by colony hybridization (Grunstein and Hogness, 1977) with the complete cDNA copy of poliovirus 1 Mahoney (Racaniello and Baltimore, 1981) at low stringency (37 o 0. The size of the inserts was determined by digestion with Pst I and the clones were mapped by restriction and partial sequence analysis (Fig. 1). Plasmid DNA was prepared from overnight 5 ml cultures using the Qiagen column purification system (Studio City, CA). Clones containing cDNA inserts of 2 kb or larger were partially sequenced from the Ml3 forward and reverse priming sites on pUC9. Denaturation of double-stranded templates was carried out on 2-4 pg DNA in 0.4 N NaOH in a volume of 10 ~1 for 10 min at 37 “C. The appropriate primer (5 pmol) was added to denatured template DNA and precipitated in 0.3 M sodium acetate and 100 ~1 ethanol at -80 o C for 10 min. DNA was recovered by centrifugation and the pellet resuspended in 10 ~1 1 X SequenaseTM reaction buffer (USBC, Cleveland, OH). The labeling reaction was initiated by addition of 4
73
kilobase
RNA P2
5’ NCR
pE6lkb P3B
+poly A
?
T t
T
p112
P
tp
?
?
c;l
T
?
ti
PS5
PE6
3’NCR
P3
?
?
1
1
1
XbaI BamHI SRUI Not1 BamHI Bgl I1 Fig. 1. Map of cloned echovirus 6 cDNAs. Restriction sites and positions of subgenomic echovirus 6 cDNA clones relative to the viral RNA genome (top) and the genome length cDNA insert in pE6 (bottom).The Not1 site present in clone pE61 kb was introduced by PCR using a synthetic oligonucleotide primer. Not1 and SmaI sites in clone pE6 are the pBSI1 polylinker sites used to construct the full-length clone.
~1 35Sequetide TM (DuPont-NEN, Boston, MA) and 3 units of SequenaseTM polymerase for 3 min at 23 “C. Termination and stop reactions were carried out in accordance with SequenaseTM kit instructions. All of the 241 cDNA clones mapped to the 3’ half of the echovirus 6 genome from nucleotide 3555 to nucleotide 7398. The nucleotides were numbered on the basis of the Coxsackievirus B3 sequence (Lindberg et al., 19871, since nucleotide comparisons of sequence from echovirus 6 cDNA clones to other picornavirus sequences indicated that echovirus 6 had greater identity to the Coxsackie B viruses (appro~mately 75% or more) than to the other enteroviruses (approximately 60%) in all regions examined (unpubIished data). Clones ~112 (3.8 kb) and ~55 (3.3 kb) were selected for use in construction of the full-length echovirus 6 cDNA (Fig. 1). Clone ~112 represented the entire 3’ half of the genome but lacked a poly A tail. The smaller clone ~55 contained a short poly A tail (14 residues) and overlapped ~112 at an unique X&I site. Repeated attempts to generate and clone 5 proximal echovirus 6 cDNAs by the above described procedure were only partially successful. It is possible that
74
TABLE 1 ~ti~o~ucleotide
primers used in polymerase chain reaction experiments
Primer name
Primer sequence
5’ NCR (Nor I)
5'GTCCA
GCGECCGC (NotI)
3’ VP4/VP2 (-1
3'
TGTTAAAACAGC
1
ATCGGGCCACACTCCATACCC 1071
5’ NCR (XWI?
5' TCTAGA fxbd)
3’ 2A/2B (SalI)
3’
3'
10
TCCGGCCCCTGAATGCGGC 449
CGGTACCTTGTTCCGCAGT 3754
5' 1050 3' 467
CAGCTG
5'
3736(SulI)
complemental strand primers, 5’NCRWof I) and 3’VP4/VPZ( - 1 were used to amplify the extreme S’ end (1075 bases) of the ecbovirus 5 genomic cDNA in polymerase chain reaction experiments. The second primer set, ~~NC~~~I~ and 3’2A/2B Gz~I>~ amplified a 3.3 kb region of the genomic DNA which contained part of the 5’ noncoding region, the viral capsid and protease 24 coding regions. Nucleotide numbering based on Coxsackieuirus B3 nomenclature.
self-priming of the first cDNA strand occurred and prevented tailing of the 5’ end of the cDNA and its insertion into pUC 9. In order to circumvent this problem, polymerase chain reaction (PCR) strategies were employed to obtain cDNA clones representing the 5’ half of the genome. Gli~~~~cl~otide primers (Table 1) were designed based upon echovirus 6 nucleic acid sequence data and sequence from regions found to be conserved in many enteroviruses (Stanway et al., 1984). The extreme 5’ nucieotide enterovirus conserved sequence, TTAAAACAGC (Rivera et al., 1988), and the complemental echovirus 6 sequence spanning the VP4/VP2 junction (GGGTATGGAGTGTGGCCCGAT) were used to construct primers ~5’NCR(~~~I~ and 3’VP4/VP2(>, rcspectively~ to amphfy the extreme 5’ 1 kb cfone of echovirus 6. The enterovirus conserved 5’ non-coding region (NCR) sequence ITCCGGCCCCTGAATGCGGC) and the echovirus 6 specific compfementary sequence (TGACGCCITCTTCCATGGC~, spanning the 2A/2B junction, were used to synthesize opposing primers flanking a 3.3 kb region of the echovirus 6 genome (5’NCR(XbaI) and 3’2A/2B(SaTI)). PCR was carried out on first strand cDNA products (RNA/cDNA hybrids) with the thermostable Tuq polymerase (Amplitaq TM Perkin Elmer Cetus, Norwalk, CT) by denaturing at 94 ’ C for 1 min, annealing at 55 o C for l-2 min, and extending at 72 o C for 5 min for a total of 30 cycles in a 100 ~1 reaction volume, PCR products were brought to 0.5 M Tris-Cl (pH 7.6) and 0.1 M MgCl, and blunt-bided by treatment with 2 units of Klenow pofymerase (30 min, 23 * C>. The products were resolved on 0.8% agarose gels and appropriate sized DNA fragments were removed and purified by the glass powder technique using Gene CleanTM (Bio 101, La Jolla, CA). The cDNAs were then ligated into the pBSII vector (Stratagene, La Jolla, CA) at the H&II site and transfo~ed into competent DH5tu E. coli ceils and plated for ampicillin resistant colonies. Plasmid DNA was prepared from overnight 5 ml
75
cultures by the Qiagen (Studio City, CA) mini-prep protocol. Overlapping 1 kb and 3.3 kb cDNA clones were recovered and designated as pE61 kb and p3B, respectively (Fig. 1). These cDNA cIones represented the 5’ half of the echovirus 6 genome. Four subgenomic cDNA inserts in pUC9 and pBSI1 were selected to construct the complete echovirus 6 genomic cDNA. Clones pE6lkb and ~33 were combined through a unique overlapping BarnHI site and the primer/plasmid specific Nat1 site to construct the entire 5’ half of the genome in a pBSI1 clone designated pRB1 (Fig. 2). Clone ~55, containing the extreme 3’ echovirus 6 genomic sequences including a poly A tail, was combined with clone ~112 through the overlapping X&z1 site and a &a1 site located in the pUC9 polylinker to create the clone designated pRB2 containing the complete 3’ half of the echovirus 6 genome. The NotI/BglII cDNA fragment of pRBl and the BglII/.SmaI fragment of pRB2 were obtained by restriction digestion and gel purification. These fragments were placed in a three-way ligation reaction with pBSI1 cleaved with NotI and SmaI using T4 DNA Iigase (USBC, Cleveland, OH) as per manufacturer instructions. The pBSI1 vector was selected for final construction to facilitate RNA transcription from the flanking T3 and T7 promotors. The ligated DNA was transformed into competent DH5ar cells. The recombinant full length cDNA clone, pE6, was amplified and purified by Qiagen midi-plasmid preparations for subsequent transfection experiments. The greater efficiency of RNA transcipts in transfection is documented (Van Der Werf et al., 1986). Although the echovirus cDNA was cIoned into a vector that contained promoters for in vitro transcription of RNA, there were not any unique restriction sites in pBSI1 that would allow linearization and transcription of the insert. Therefore, the infectivity of the cDNA was tested directiy in transfection experiments. Precautions were taken to use materials and working areas that were free of virus. WISH cell monolayers (2 X lo6 cells) were transfected with 10 pg of cloned genomic echovirus 6 cDNA (pE6) in the presence of either 1 mg/ml DE&-de&an (5 X lo6 Mw, Sigma, St. Louis, MO) or 1 mg/ml LipofectinTM (BRL, Gaithersburg, MD). Clones p3B and the infectious cDNA pVR 101 clone of poliovirus (Racaniello and Baltimore, 1981) were used as negative and positive controls, respectively. Also, uninoculated cells, that were treated with reagents only, were included as mock-transfected ceils. Cells were observed daily for the presence of cytopathic effect. When 80% of the cells were lysed, supernates were collected and tested for the presence of virus by plaque assay on WISH cell monolayers at 37 *C (Righthand and Hughes, 1984). Cells transfected with pE6 produced large plaques (4-6 mm> similar to those produced by the parental virus. An average yield of 1.4 X lo5 plaque forming units (PFU) per ml of virus was recovered from transfected cells. The cDNA clone (10 ,ug) was treated with 100 pg/ml of either DNAase I or pancreatic RNAase for 1 h a 23°C before transfection of WISH cells in the presence of LipofectinTM. DNAase treatment eliminated the infectivity of the cDNA clone. However, the infectivity of the clone was not inactiviated by pretreatment with RNAase. These results suggested that our cDNA preparation was not contaminated by echovirus 6 virions or RNA.
Fig. 2. Construction of the full-length echovirus 6 cDNA. Four subgenomic cDNA clones were combined to construct the full length clone. The Not I/BrrmHI restriction fragment of clone pE6lkb cDNA was inserted into the NofI/LlamHI restricted p3B clone to construct clone pRB1 (BSII) containing the 5’ half of the genome. The 3’ half of the gcnomic cDNA, including a 14 residue poly A tail (shaded arcas), was constructed by ligation of the XbuI/.Smal cDNA restriction fragment of ~55 into the similarly digested ~112 clone to give clone pRB2 (pUC 9). The NofI/BgOI fragment of pRB1 and the Bg!II/SmuI fragment of pRB2 were joined in a three way ligation with Nu~I/Smal cleaved pBSl1 to complete the full-length genomic construct, designated pE6. This cDNA insert in BSII is flanked by phage T3 and T7 transcription promotors (dashed areas). Nucleotide numbering based on Coxsackievirus B3 nomenclature.
77
TABLE 2 Neutralization assay of virus from cells transfected with pE6 DNA Inoculum
Antiserum
PFU/ml
Neutralization (o/o)
pE6 DNA
none anti-echovirus 6 anti-poliovirus I
221 16 271
93 0
none anti-echovirus 6 anti-poliovirus I
133 4 135
_ 97 0
Echovirus 6 virions
Supernates from transfected cells were preincubated (23OC, 30 min) with either phosphate buffered saline (pH 7.2) or antiserum (1:l) before assay on WISH monolayers (3-4/sample). Echovirus 6 samples were treated in the same manner and used as positive controls.
Insertion of unique markers into the infectious cDNA will be made to facilitate identification of RNA transcripts in future studies. Recovered viruses from cells transfected with pE6 were identified by neutralization with anti-serum prepared against echovirus 6 (Table 2). Supernates recovered from transfected cells were preincubated (23 OC, 30 min) with equal volumes of either Dulbecco’s phosphate buffered saline (pH 7.21, anti-echovirus 6 serum, or anti-poliovirus, type I serum before plaque assay on WISH monolayers (3-4/ sample). Anti-virus sera were prepared in rabbits and had 50% neutralization titers of approximately 1: 2500. Echovirus 6 was treated in the same manner and used as positive control. As indicated in Table 2, 93% of the infectivity recovered from transfected cells was neutralized specifically by echovirus 6 anti-serum. Thus, the cDNA behaved antigenically as the parent virus. The successful production of infectious, antigenically specific echovirus 6 by a cDNA copy of the viral RNA suggested that any mutation(s) that may have been introduced through PCR amplification of the 5’ end cDNA did not overtly affect the neutralization epitopes of the capsid or cytopathology of the viruses relative to the parent echovirus 6 from which the cDNA was derived. Additional sequence data of independently generated cDNA clones showed that the 5’ noncoding region was identical to that of the wild type echovirus 6 (manuscript in preparation). The availability of an infectious cDNA clone of echovirus 6 will enable us to examine further the structure of this genome and to compare it to genomes of other enteroviruses. This infectious clone will also be suitable for construction of recombinants with infectious cDNA clones from the mutant genomes produced by cells persistently infected with echovirus 6 (Gibson and Righthand, 1985; Righthand and Blackbum, 1989). Such recombinants will facilitate the investigation of the molecular basis of pathogenesis by Iytic and persistent strains of echovirus 6. We thank Tracey Pousak and Theresa Gratsch for their excellent. technical assistance. The oligonucleotide primers were prepared by June Snow of the Macromolecular Core Facility of Wayne State University. This work was supported by Public Health Service Grant AI-22644 to V.F.R. The research was performed as partial fulfillment of the requirements for a Ph.D. degree for R.V.B.
78
References Barron, A.L. and Karzon, D.T. (1965) Studies of mutants of ECHO virus 6. I. Biological and serological characteristics. Am. J. Epidemiol. 81, 323-332. Bell, T.J. and Grist, N.R. (1971) Echo viruses, carditis, and acute pleurodynia. Am. Heart J. 82,133-135. Gibson, J.P. and Righthand, V.F. (1985) Persistence of echovirus 6 in cloned human cells. J. Virol. 54, 219-223. Grunstein, M. and Hogness, D.S. (1977) Colony hybridization of cloned DNA’s that contain a specific gene. Proc. Natl. Acad. Sci. U.S.A. 74, 961-965. Johnson, V.H. and Semler, B. (1988) Defined recombinants of poliovirus and coxsackievirus: sequencespecific deletions and functional substitutions in the 5’-noncoding regions of viral RNAs. Virology 162, 47-57. Kandolf, R. (1988) The impact of recombinant DNA technology on the study of enteroviral heart disease. In: M. Bendinelli and H.Friedman (Eds.), Coxsackie Viruses: a general update. p.293-318. Plenum, New York, NY. Kandolf, R. and Hofschneider, P.H. (1985) Molecular cloning of the genome of a cardiotropic Coxsackie B3 virus: full-length reverse-transcribed recombinant cDNA generates infectious virus in mammalian cells. Proc. Natl. Acad. Sci. U.S.A. 82, 4818-4822. Kitson, J.D.A., Burke, K.L., Pullen, L.A., Belsham, G.J. and Almond, J.W.(1991) Chimeric polioviruses that include sequences derived from two independent antigenic sites of foot-and-mouth disease virus (FMDV) induce neutralizing antibodies against FMDV in guinea pigs. J. Virol. 65, 3068-3075. La Monica, N., Meriam, C. and Racaniello, V.R. (1986) Mapping of sequences required for mouse neurovirulence of poliovirus type 2 Lansing. J. Virol. 57, 515-525. Lindberg, A.M., Stalhandske, P.O.K. and Pettersson, U. (1987) Genome of Coxackie virus B3. Virology 156, 50-63. Maniatis, T., Fritsch, E. and Sambrook, J. (1982) Molecular cloning: a laboratory manual. p.234. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Minor, P.D., Ferguson, M., Katrak, K., Wood, P., John, A., Howlett, J., Dunn, G., Burke, K., and Almond, J.W. (1990) Antigenic structure of chimeras of type 1 and type 3 poliovirus involving antigenic site 1. J.Gen. Virol. 71, 2543-2551. Moss, E.G., O’Neill, R.E. and Racaniello, V.R. (1989) Mapping of attenuating sequences of an avirulent poliovirus Type 2 strain. J.Virol. 63, 1884-1890. Murray, M.G., Bradley, J., Yang, X-F., Wimmer, E., Moss, E.G. and Racaniello, V.R. (1988) Poliovirus host range is determined by a short amino acid sequence in neutralization antigenic site 1. Science 241, 213-215. Omata, T., Kohara, M., Sakai, Y., Kameda, A., Imura, N. and Nomoto, A.(19841 Cloned infectious complementary DNA of the poliovirus Sabin I genome: biochemical and biological properties of the recovered virus.Gene 32,1-10. Racaniello, V.R. and Baltimore, D. (1981) Cloned poliovirus complementary DNA is infectious in mammalian cells. Science 214, 916-919. Righthand, V.F. and Blackburn, R.V. (1989) Steady-state infection by echovirus 6 associated with nonlytic viral RNA and an unprocessed capsid polypeptide. J. Virol. 63, 5268-5275. Righthand, V.F. and Hughes, P.F. (1984) Isolation of a specific enhancer for echovirus 6 from uninfected permissive host cells. Infect. Immun.9, 134-141. Rivera, V.M., Welsh, J.D. and Maizel, Jr., J.V. (1988) Comparative sequence analysis of the 5’ noncoding region of the enteroviruses and rhinoviruses. Virology 165, 42-50. Semler, B.L., Dorner, A.J. and Wimmer, E. (1984) Production of an infectious poliovirus from cloned cDNA is dramatically increased by SV40 transcription and replication signals. Nucleic Acids Res. 12, 5123-5141. Stanway, G., Hughes, P.J., Mountford, R.C., Minor, P.D. and Almond, J.W.(1984) The complete nucleotide sequence of a common cold virus: human rhinovirus 14. Nucleic Acids Res. 12, 7859-7875. Ticehurst, J.R., Racaniello, V.R., Baroudy, B.M., Baltimore, D., Purcell, R.H. and Feinstone, S.M. (1983) Molecular cloning and characterization of hepatitis A virus cDNA. Proc. Natl. Acad. Sci. U.S.A. 80, 5885-5889. Van Der Werf, S., Bradley, J., Wimmer, E., Studier, F.W. and Dunn, J.J.(1986) Synthesis of infectious poliovirus RNA by purified T7 RNA polymerase. Proc. Natl. Acad. Sci. U.S.A. 83, 2330-2334.
Pkus Research, 22 (1991) 71-78 0 1991 Elsevier Science Publishers B.V. All rights reserved Old-1702/91/$03.50
VIRUS 00722
Construction
R.V. Blackburn
of an infectious cDNA clone of echovirus 6 ‘, V.R. Racaniello
’ and V,F. Righthand
’
’ Department of Immunolo~ and Microb~olo~, Wayne State University, Detroit, MI 48201, U.S.A. and 2 Department of ~icrob~olo~,
Co~~b~ ~n~oersi~ College of Physicians and pigeons, NY 10032, U.S.A.
New York,
(Received 31 July 1991; revision received and accepted 23 September 1991)
Summary A complete cDNA copy of the echovirus 6 genome was constructed. Complementary DNA was reversed transcribed from viral RNA. Subgenomic cDNAs were obtained by direct cloning and polymerase chain reactions. Full length cDNA was constructed into the Bluescript II vector (pBSI1) using unique, overlapping, restriction sites of four clones. The cDNA was infectious and produced echovirus 6 particles that behaved in the same manner as the parental virus. Echovirus 6; Infectious cDNA; Enterovirus
The enterovirus genus of the picornaviridae family consists of approximately 70 viruses that infect humans. They were originally subgrouped by their source of isolation into polioviruses, coxsackieviruses and echoviruses. The echoviruses are the largest subgroup of enteroviruses and can cause acute diseases such as myocarditis, pericarditis, pleurodynia, myositis and encephalitis (Bell and Grist, 1971). They have also been implicated in chronic neurological and cardiac diseases (Kandolf, 1988). Despite their importance as pathogens, studies on the molecular biology of the echoviruses have been limited. Co~es~~deffce to: V.F. Righthand, Department University, Detroit, MI 48201, U.S.A.
of Immunolo~
and Mi~robiolo~,
Wayne State
72
A major contribution to the study of the molecular genetics of enteroviruses came from the construction of an infectious DNA copy of poliovirus 1 (Racaniello and Baltimore, 1981). Subsequently, infectious cDNAs were constructed for virulent and attenuated strains of the three poliovirus types (Semler et al., 1984, Omata et al., 1984) and Coxsackie B3 (Kandolf and Hofschneider, 1985). These cDNAs have been used to prepare infectious recombinants of different virus strains, and have facilitated the identification of genomic regions responsible for specific functions such as replicase recognition sites (Johnson and Semler, 1988) host range (La Monica et al., 19861, and neurovirulence (Murray et al., 1988). Also, the availability of infectious cDNAs have permitted construction of antigenic chimeras for potenial use as safe vaccines (Minor et al., 1990; Kitson et al., 1991). In this paper, we present the first construction of an infectious cDNA of echovirus 6. The Charles strain of echovirus 6 (Barron and Karzon, 1965) was used for these studies. The virus was grown in WISH cells and purified by density gradient centrifugation in sucrose or cesium chloride. Virion RNA was extracted with equal volumes of phenol : chloroform : isoamyl alcohol (24 : 24 : 1) as described previously (Righthand and Blackburn, 1989). A modified procedure of Moss et al. (19891 was used to generate echovirus 6 cDNA. Approximately 1 pg virion RNA was used as a template for first strand cDNA synthesis by 2 U/ml avian myeloblastosis virus reverse transcriptase (Pharmacia Fine Chemicals, Piscataway, NJ) using 30 pg/ml ohgo(dT), as a primer. The RNA/cDNA molecules were resolved by size on 1% alkaline agarose gels (Maniatis et al., 1982) and visualized by autoradiography of the dried gels. Second strand cDNA was generated by replacement synthesis on the RNA/cDNA hybrid (250 pug>with RNAase H and E. coli DNA polymerase (Ticehurst et al., 1983). Double strand cDNAs were extracted with equal volumes of phenol : chloroform (1: 1) and purified by column chromatography (Biospin 6 columns, Bio-Rad, Richmond, CA), precipitated with ethanol and resuspended in sterile deionized water. The cDNA was inserted into the PstI site of plasmid pUC9 by the addition of oligo(dG)-oligo(dC1 homopolymer tails (Ticehurst et al., 1983). Ampicillin resistant clones, recovered after transformation of competent E. coli cells (JM 101 or DHSa), were screened for inserts by colony hybridization (Grunstein and Hogness, 1977) with the complete cDNA copy of poliovirus 1 Mahoney (Racaniello and Baltimore, 1981) at low stringency (37 o 0. The size of the inserts was determined by digestion with Pst I and the clones were mapped by restriction and partial sequence analysis (Fig. 1). Plasmid DNA was prepared from overnight 5 ml cultures using the Qiagen column purification system (Studio City, CA). Clones containing cDNA inserts of 2 kb or larger were partially sequenced from the Ml3 forward and reverse priming sites on pUC9. Denaturation of double-stranded templates was carried out on 2-4 pg DNA in 0.4 N NaOH in a volume of 10 ~1 for 10 min at 37 “C. The appropriate primer (5 pmol) was added to denatured template DNA and precipitated in 0.3 M sodium acetate and 100 ~1 ethanol at -80 o C for 10 min. DNA was recovered by centrifugation and the pellet resuspended in 10 ~1 1 X SequenaseTM reaction buffer (USBC, Cleveland, OH). The labeling reaction was initiated by addition of 4
73
kilobase
RNA P2
5’ NCR
pE6lkb P3B
+poly A
?
T t
T
p112
P
tp
?
?
c;l
T
?
ti
PS5
PE6
3’NCR
P3
?
?
1
1
1
XbaI BamHI SRUI Not1 BamHI Bgl I1 Fig. 1. Map of cloned echovirus 6 cDNAs. Restriction sites and positions of subgenomic echovirus 6 cDNA clones relative to the viral RNA genome (top) and the genome length cDNA insert in pE6 (bottom).The Not1 site present in clone pE61 kb was introduced by PCR using a synthetic oligonucleotide primer. Not1 and SmaI sites in clone pE6 are the pBSI1 polylinker sites used to construct the full-length clone.
~1 35Sequetide TM (DuPont-NEN, Boston, MA) and 3 units of SequenaseTM polymerase for 3 min at 23 “C. Termination and stop reactions were carried out in accordance with SequenaseTM kit instructions. All of the 241 cDNA clones mapped to the 3’ half of the echovirus 6 genome from nucleotide 3555 to nucleotide 7398. The nucleotides were numbered on the basis of the Coxsackievirus B3 sequence (Lindberg et al., 19871, since nucleotide comparisons of sequence from echovirus 6 cDNA clones to other picornavirus sequences indicated that echovirus 6 had greater identity to the Coxsackie B viruses (appro~mately 75% or more) than to the other enteroviruses (approximately 60%) in all regions examined (unpubIished data). Clones ~112 (3.8 kb) and ~55 (3.3 kb) were selected for use in construction of the full-length echovirus 6 cDNA (Fig. 1). Clone ~112 represented the entire 3’ half of the genome but lacked a poly A tail. The smaller clone ~55 contained a short poly A tail (14 residues) and overlapped ~112 at an unique X&I site. Repeated attempts to generate and clone 5 proximal echovirus 6 cDNAs by the above described procedure were only partially successful. It is possible that
74
TABLE 1 ~ti~o~ucleotide
primers used in polymerase chain reaction experiments
Primer name
Primer sequence
5’ NCR (Nor I)
5'GTCCA
GCGECCGC (NotI)
3’ VP4/VP2 (-1
3'
TGTTAAAACAGC
1
ATCGGGCCACACTCCATACCC 1071
5’ NCR (XWI?
5' TCTAGA fxbd)
3’ 2A/2B (SalI)
3’
3'
10
TCCGGCCCCTGAATGCGGC 449
CGGTACCTTGTTCCGCAGT 3754
5' 1050 3' 467
CAGCTG
5'
3736(SulI)
complemental strand primers, 5’NCRWof I) and 3’VP4/VPZ( - 1 were used to amplify the extreme S’ end (1075 bases) of the ecbovirus 5 genomic cDNA in polymerase chain reaction experiments. The second primer set, ~~NC~~~I~ and 3’2A/2B Gz~I>~ amplified a 3.3 kb region of the genomic DNA which contained part of the 5’ noncoding region, the viral capsid and protease 24 coding regions. Nucleotide numbering based on Coxsackieuirus B3 nomenclature.
self-priming of the first cDNA strand occurred and prevented tailing of the 5’ end of the cDNA and its insertion into pUC 9. In order to circumvent this problem, polymerase chain reaction (PCR) strategies were employed to obtain cDNA clones representing the 5’ half of the genome. Gli~~~~cl~otide primers (Table 1) were designed based upon echovirus 6 nucleic acid sequence data and sequence from regions found to be conserved in many enteroviruses (Stanway et al., 1984). The extreme 5’ nucieotide enterovirus conserved sequence, TTAAAACAGC (Rivera et al., 1988), and the complemental echovirus 6 sequence spanning the VP4/VP2 junction (GGGTATGGAGTGTGGCCCGAT) were used to construct primers ~5’NCR(~~~I~ and 3’VP4/VP2(>, rcspectively~ to amphfy the extreme 5’ 1 kb cfone of echovirus 6. The enterovirus conserved 5’ non-coding region (NCR) sequence ITCCGGCCCCTGAATGCGGC) and the echovirus 6 specific compfementary sequence (TGACGCCITCTTCCATGGC~, spanning the 2A/2B junction, were used to synthesize opposing primers flanking a 3.3 kb region of the echovirus 6 genome (5’NCR(XbaI) and 3’2A/2B(SaTI)). PCR was carried out on first strand cDNA products (RNA/cDNA hybrids) with the thermostable Tuq polymerase (Amplitaq TM Perkin Elmer Cetus, Norwalk, CT) by denaturing at 94 ’ C for 1 min, annealing at 55 o C for l-2 min, and extending at 72 o C for 5 min for a total of 30 cycles in a 100 ~1 reaction volume, PCR products were brought to 0.5 M Tris-Cl (pH 7.6) and 0.1 M MgCl, and blunt-bided by treatment with 2 units of Klenow pofymerase (30 min, 23 * C>. The products were resolved on 0.8% agarose gels and appropriate sized DNA fragments were removed and purified by the glass powder technique using Gene CleanTM (Bio 101, La Jolla, CA). The cDNAs were then ligated into the pBSII vector (Stratagene, La Jolla, CA) at the H&II site and transfo~ed into competent DH5tu E. coli ceils and plated for ampicillin resistant colonies. Plasmid DNA was prepared from overnight 5 ml
75
cultures by the Qiagen (Studio City, CA) mini-prep protocol. Overlapping 1 kb and 3.3 kb cDNA clones were recovered and designated as pE61 kb and p3B, respectively (Fig. 1). These cDNA cIones represented the 5’ half of the echovirus 6 genome. Four subgenomic cDNA inserts in pUC9 and pBSI1 were selected to construct the complete echovirus 6 genomic cDNA. Clones pE6lkb and ~33 were combined through a unique overlapping BarnHI site and the primer/plasmid specific Nat1 site to construct the entire 5’ half of the genome in a pBSI1 clone designated pRB1 (Fig. 2). Clone ~55, containing the extreme 3’ echovirus 6 genomic sequences including a poly A tail, was combined with clone ~112 through the overlapping X&z1 site and a &a1 site located in the pUC9 polylinker to create the clone designated pRB2 containing the complete 3’ half of the echovirus 6 genome. The NotI/BglII cDNA fragment of pRBl and the BglII/.SmaI fragment of pRB2 were obtained by restriction digestion and gel purification. These fragments were placed in a three-way ligation reaction with pBSI1 cleaved with NotI and SmaI using T4 DNA Iigase (USBC, Cleveland, OH) as per manufacturer instructions. The pBSI1 vector was selected for final construction to facilitate RNA transcription from the flanking T3 and T7 promotors. The ligated DNA was transformed into competent DH5ar cells. The recombinant full length cDNA clone, pE6, was amplified and purified by Qiagen midi-plasmid preparations for subsequent transfection experiments. The greater efficiency of RNA transcipts in transfection is documented (Van Der Werf et al., 1986). Although the echovirus cDNA was cIoned into a vector that contained promoters for in vitro transcription of RNA, there were not any unique restriction sites in pBSI1 that would allow linearization and transcription of the insert. Therefore, the infectivity of the cDNA was tested directiy in transfection experiments. Precautions were taken to use materials and working areas that were free of virus. WISH cell monolayers (2 X lo6 cells) were transfected with 10 pg of cloned genomic echovirus 6 cDNA (pE6) in the presence of either 1 mg/ml DE&-de&an (5 X lo6 Mw, Sigma, St. Louis, MO) or 1 mg/ml LipofectinTM (BRL, Gaithersburg, MD). Clones p3B and the infectious cDNA pVR 101 clone of poliovirus (Racaniello and Baltimore, 1981) were used as negative and positive controls, respectively. Also, uninoculated cells, that were treated with reagents only, were included as mock-transfected ceils. Cells were observed daily for the presence of cytopathic effect. When 80% of the cells were lysed, supernates were collected and tested for the presence of virus by plaque assay on WISH cell monolayers at 37 *C (Righthand and Hughes, 1984). Cells transfected with pE6 produced large plaques (4-6 mm> similar to those produced by the parental virus. An average yield of 1.4 X lo5 plaque forming units (PFU) per ml of virus was recovered from transfected cells. The cDNA clone (10 ,ug) was treated with 100 pg/ml of either DNAase I or pancreatic RNAase for 1 h a 23°C before transfection of WISH cells in the presence of LipofectinTM. DNAase treatment eliminated the infectivity of the cDNA clone. However, the infectivity of the clone was not inactiviated by pretreatment with RNAase. These results suggested that our cDNA preparation was not contaminated by echovirus 6 virions or RNA.
Fig. 2. Construction of the full-length echovirus 6 cDNA. Four subgenomic cDNA clones were combined to construct the full length clone. The Not I/BrrmHI restriction fragment of clone pE6lkb cDNA was inserted into the NofI/LlamHI restricted p3B clone to construct clone pRB1 (BSII) containing the 5’ half of the genome. The 3’ half of the gcnomic cDNA, including a 14 residue poly A tail (shaded arcas), was constructed by ligation of the XbuI/.Smal cDNA restriction fragment of ~55 into the similarly digested ~112 clone to give clone pRB2 (pUC 9). The NofI/BgOI fragment of pRB1 and the Bg!II/SmuI fragment of pRB2 were joined in a three way ligation with Nu~I/Smal cleaved pBSl1 to complete the full-length genomic construct, designated pE6. This cDNA insert in BSII is flanked by phage T3 and T7 transcription promotors (dashed areas). Nucleotide numbering based on Coxsackievirus B3 nomenclature.
77
TABLE 2 Neutralization assay of virus from cells transfected with pE6 DNA Inoculum
Antiserum
PFU/ml
Neutralization (o/o)
pE6 DNA
none anti-echovirus 6 anti-poliovirus I
221 16 271
93 0
none anti-echovirus 6 anti-poliovirus I
133 4 135
_ 97 0
Echovirus 6 virions
Supernates from transfected cells were preincubated (23OC, 30 min) with either phosphate buffered saline (pH 7.2) or antiserum (1:l) before assay on WISH monolayers (3-4/sample). Echovirus 6 samples were treated in the same manner and used as positive controls.
Insertion of unique markers into the infectious cDNA will be made to facilitate identification of RNA transcripts in future studies. Recovered viruses from cells transfected with pE6 were identified by neutralization with anti-serum prepared against echovirus 6 (Table 2). Supernates recovered from transfected cells were preincubated (23 OC, 30 min) with equal volumes of either Dulbecco’s phosphate buffered saline (pH 7.21, anti-echovirus 6 serum, or anti-poliovirus, type I serum before plaque assay on WISH monolayers (3-4/ sample). Anti-virus sera were prepared in rabbits and had 50% neutralization titers of approximately 1: 2500. Echovirus 6 was treated in the same manner and used as positive control. As indicated in Table 2, 93% of the infectivity recovered from transfected cells was neutralized specifically by echovirus 6 anti-serum. Thus, the cDNA behaved antigenically as the parent virus. The successful production of infectious, antigenically specific echovirus 6 by a cDNA copy of the viral RNA suggested that any mutation(s) that may have been introduced through PCR amplification of the 5’ end cDNA did not overtly affect the neutralization epitopes of the capsid or cytopathology of the viruses relative to the parent echovirus 6 from which the cDNA was derived. Additional sequence data of independently generated cDNA clones showed that the 5’ noncoding region was identical to that of the wild type echovirus 6 (manuscript in preparation). The availability of an infectious cDNA clone of echovirus 6 will enable us to examine further the structure of this genome and to compare it to genomes of other enteroviruses. This infectious clone will also be suitable for construction of recombinants with infectious cDNA clones from the mutant genomes produced by cells persistently infected with echovirus 6 (Gibson and Righthand, 1985; Righthand and Blackbum, 1989). Such recombinants will facilitate the investigation of the molecular basis of pathogenesis by Iytic and persistent strains of echovirus 6. We thank Tracey Pousak and Theresa Gratsch for their excellent. technical assistance. The oligonucleotide primers were prepared by June Snow of the Macromolecular Core Facility of Wayne State University. This work was supported by Public Health Service Grant AI-22644 to V.F.R. The research was performed as partial fulfillment of the requirements for a Ph.D. degree for R.V.B.
78
References Barron, A.L. and Karzon, D.T. (1965) Studies of mutants of ECHO virus 6. I. Biological and serological characteristics. Am. J. Epidemiol. 81, 323-332. Bell, T.J. and Grist, N.R. (1971) Echo viruses, carditis, and acute pleurodynia. Am. Heart J. 82,133-135. Gibson, J.P. and Righthand, V.F. (1985) Persistence of echovirus 6 in cloned human cells. J. Virol. 54, 219-223. Grunstein, M. and Hogness, D.S. (1977) Colony hybridization of cloned DNA’s that contain a specific gene. Proc. Natl. Acad. Sci. U.S.A. 74, 961-965. Johnson, V.H. and Semler, B. (1988) Defined recombinants of poliovirus and coxsackievirus: sequencespecific deletions and functional substitutions in the 5’-noncoding regions of viral RNAs. Virology 162, 47-57. Kandolf, R. (1988) The impact of recombinant DNA technology on the study of enteroviral heart disease. In: M. Bendinelli and H.Friedman (Eds.), Coxsackie Viruses: a general update. p.293-318. Plenum, New York, NY. Kandolf, R. and Hofschneider, P.H. (1985) Molecular cloning of the genome of a cardiotropic Coxsackie B3 virus: full-length reverse-transcribed recombinant cDNA generates infectious virus in mammalian cells. Proc. Natl. Acad. Sci. U.S.A. 82, 4818-4822. Kitson, J.D.A., Burke, K.L., Pullen, L.A., Belsham, G.J. and Almond, J.W.(1991) Chimeric polioviruses that include sequences derived from two independent antigenic sites of foot-and-mouth disease virus (FMDV) induce neutralizing antibodies against FMDV in guinea pigs. J. Virol. 65, 3068-3075. La Monica, N., Meriam, C. and Racaniello, V.R. (1986) Mapping of sequences required for mouse neurovirulence of poliovirus type 2 Lansing. J. Virol. 57, 515-525. Lindberg, A.M., Stalhandske, P.O.K. and Pettersson, U. (1987) Genome of Coxackie virus B3. Virology 156, 50-63. Maniatis, T., Fritsch, E. and Sambrook, J. (1982) Molecular cloning: a laboratory manual. p.234. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Minor, P.D., Ferguson, M., Katrak, K., Wood, P., John, A., Howlett, J., Dunn, G., Burke, K., and Almond, J.W. (1990) Antigenic structure of chimeras of type 1 and type 3 poliovirus involving antigenic site 1. J.Gen. Virol. 71, 2543-2551. Moss, E.G., O’Neill, R.E. and Racaniello, V.R. (1989) Mapping of attenuating sequences of an avirulent poliovirus Type 2 strain. J.Virol. 63, 1884-1890. Murray, M.G., Bradley, J., Yang, X-F., Wimmer, E., Moss, E.G. and Racaniello, V.R. (1988) Poliovirus host range is determined by a short amino acid sequence in neutralization antigenic site 1. Science 241, 213-215. Omata, T., Kohara, M., Sakai, Y., Kameda, A., Imura, N. and Nomoto, A.(19841 Cloned infectious complementary DNA of the poliovirus Sabin I genome: biochemical and biological properties of the recovered virus.Gene 32,1-10. Racaniello, V.R. and Baltimore, D. (1981) Cloned poliovirus complementary DNA is infectious in mammalian cells. Science 214, 916-919. Righthand, V.F. and Blackburn, R.V. (1989) Steady-state infection by echovirus 6 associated with nonlytic viral RNA and an unprocessed capsid polypeptide. J. Virol. 63, 5268-5275. Righthand, V.F. and Hughes, P.F. (1984) Isolation of a specific enhancer for echovirus 6 from uninfected permissive host cells. Infect. Immun.9, 134-141. Rivera, V.M., Welsh, J.D. and Maizel, Jr., J.V. (1988) Comparative sequence analysis of the 5’ noncoding region of the enteroviruses and rhinoviruses. Virology 165, 42-50. Semler, B.L., Dorner, A.J. and Wimmer, E. (1984) Production of an infectious poliovirus from cloned cDNA is dramatically increased by SV40 transcription and replication signals. Nucleic Acids Res. 12, 5123-5141. Stanway, G., Hughes, P.J., Mountford, R.C., Minor, P.D. and Almond, J.W.(1984) The complete nucleotide sequence of a common cold virus: human rhinovirus 14. Nucleic Acids Res. 12, 7859-7875. Ticehurst, J.R., Racaniello, V.R., Baroudy, B.M., Baltimore, D., Purcell, R.H. and Feinstone, S.M. (1983) Molecular cloning and characterization of hepatitis A virus cDNA. Proc. Natl. Acad. Sci. U.S.A. 80, 5885-5889. Van Der Werf, S., Bradley, J., Wimmer, E., Studier, F.W. and Dunn, J.J.(1986) Synthesis of infectious poliovirus RNA by purified T7 RNA polymerase. Proc. Natl. Acad. Sci. U.S.A. 83, 2330-2334.
