88
ANTIBODIES AND ANTIGENS
[4]
immunotoxins, ~4-1s and for other biomedical applications still to be explored. Acknowledgments We thank Clare Corbett, Peter Keek, Walter F. StaffordI11,and Brenda Giust for their assistance in the conduct of this research and in the preparation of this chapter. Supportedin part by the National Institutes of Health, Grants CA 39870, CA 51880, and HL 19259.
[4] Construction of Single-Chain Fv Derivatives of Monoclonal Antibodies and Their Production in Escherichia coli By SYD JOHNSON a n d
ROBERT E. BIRD
A single-chain Fv (scFv) molecule consists of the variable domains of an antibody tethered together by a designed protein linker such that the antigen combining site is regenerated in a single protein. 1~ Either the VL or VH can be used as amino-terminal domain of an seFv. Because of several unique properties such as small size, ease of engineering, and stability even at low concentrations, scFvs may eventually be useful in the diagnosis and/or therapy of diseases such as cancer, where target antigens are often expressed preferentially on the surface of cells. Applications under development include the use of genetic fusions of scFvs to potent toxins 3 and the use of radiolabeled scFv molecules to image tumors that express antigens recognized by the scFv. 4 The generality of the scFv technology is based on the observation that the basic structure of the individual immunoglobulin domains is conserved in all antibodies. 5 It is then assumed that this framework structure is sufficiently stable that, so long as a linker or other i R. E. Bird, IC D. Hardman, J. W. Jacobson, S. Johnson, B. M. Kaufman, S.-M. Lee, T. Lee, S. H. Pope, G. S. Riordan, and M. Whitlow, Science 242, 423 (1988). 2 j. S. Huston, D. Levinson, M. Mudgett-Hunter, M.-S. Tai, J. Novotny, M. N. Margolies, R. J. Ridge, R. E. Brueeoleri, E. Haber, R. Crea, and H. Oppermann, Proc. Natl. Acad. Sci. U.S.A. 85, 5879 (1988). 3 V. K. Chaudhary, C. Queen, R. P. Junghans, T. A. Waldmann, D. J. FitzGerald, and I. Pastan, Nature (London) 339, 394 (1989). 4 D. Colcher, R. Bird, M. Roselli, K. D. Hardman, S. Johnson, S. Pope, S. W. Dodd, M. W. Pantoliano, D. E. Milenie, and J. Sehlom, J. Natl. Cancer Inst. 82, 1191 (1990). 5 E. A. Padlan, Q Rev. Biophys. 10, 35 (1977).
METHODS
IN E N Z Y M O L O G Y ,
VOL. 203
Copyri~t © 1991 by ~ P m ~ Inc. All dghm of mlmxluction in any form reserved.
[4]
SINGLE-CHAINFv
89
adjoining region does not interfere with the domain structure and the ability of the VL and Vn to associate, the individual domains will fold and associate to form a molecule that mimicks the antigen combining region of an antibody heterodimer. In addition to the applications described above, since the scFv is a stable replica of an Fv, it provides a useful research tool for testing modifications to the Fv, including complementarity-determining region (CDR) grafting and the study of antibody-antigen interactions. One important reason for this is the simplicity of the system; once the scFv gene is constructed, the gene can be modified and the resulting mutant scFv protein is easy to produce and subsequently test. Several different expression/production systems for scFv molecules have been developed, including secretion of active scFvs using Escherichia coli, 6 Bacillus subtilis, 7 yeast, s and mammalian cells, 9 and the refolding of insoluble, E. coli-produced protein.l,2 We believe that the refolding procedures that have been used offer the most reproducible system for producing large quantities of any scFv protein and are adaptable to almost any laboratory for the production of active protein. The secretion of active scFv protein will be extremely useful as a tool to develop genetic screens and selections for mutagenized or combinatorial libraries of scFvs. For example, active scFvs have been displayed on the surface of filamentous bacteriophage using the fusion phage technology developed by Smith. 1° Eventually secretion of active scFvs will replace refolding as the method of choice for production. However, we will restrict the content of this chapter to the development of scFvs by refolding the protein that has been produced in E. coli. X-Ray crystallographic determination of the three-dimensional structures of antibody variable domains has demonstrated that they fold into a nine-strand fl sheet with the residues that contact the antigen being in general confined to loops generated at the turns between strands of the ,0 structure. These residues were initially referred to as hypervariable regions, based on comparative sequence data," and are now referred to as complementarity-determining regions (CDRs) based on their function? 2 Each 6 R. Glockshuber, M. Malia, I. Pfitzinger, and A. Plfickthun, Biochemistry 29, 1362 (1990). 7 M. Pantoliano, P. Alexander, S. Dodd, P. Bryan, M. Rollence, J. Wood, and S. Fahnestock, J. Cell. Biochem. 13A, 91 (1989). 8 G. T. Davis, W. D. Bedzyk, E. W. Voss, and T. W. Jacobs, Bio/Technolgy9, 165 (1990). 9 S. Johnson, unpublished results (1990). 10G. Smith, Science 228, 1315 (1985). 11E. A. Kabat, T. T. Wu, M. Reid-Miller, H. M. Perry, and K. S. Gottesman, "Sequences of Proteins of Immunological Interest," 4th Ed., U.S. Department of Health and Human Services, Washington, D.C., 1987. 12T. T. Wu and E. A. Kabat, J. Exp. Med. 132, 211 (1970).
90
[4]
ANTIBODIES AND ANTIGENS
TABLE I LINKERS USED TO CONNECT V L AND V u SEQUENCES
Position
H 113
Antibody
VH-finker-VL Linker
...S -GGGGSGGGGSGGGGS ...S -GGGG SGGGGSGGGGS ... S-SGGGGSGGGGSGGGGSQ-...
L1 26-10~ Anti-tacb Anti-tac~
-.D... -Q...
VL-linker-V n
L105
Linker
HI
...L-KESGSVSSEQLAQFRSLD ...K-EGKSSGSGSESKST L 107 Linker
-Q... H1
...K-GSTSGSGKSSEGKG
-Q...
H2 -V...
Anti-BGHd 4-4-20d
B6.2 •
a j. S. Huston, D. Levinson, M. Mudgett-Hunter, M.-S. Tai, J. Novotny, M. N. Margolies, R. J. Ridge, R. E. Bruccoled, E. Haber, R. Crea, and H. Opperman, Proc. Natl. Acad. Sci. U.S.A. 85, 423 (1988). b V. K. Chaudhary, C. Queen, R. P. Junghans, T. A. Waldman, D. J. FitzGerald, and I. Pastan, Nature (London) 339, 394 (1989). c j. K. Batra, D. FitzGerald, M. Gately, V. K. Chaudhary, and I. Pastan, J. Biol. Chem. 265, 15198 (1990). d BGH, bovine growth hormone. R. E. Bird, K. D. Hardman, J. W. Jacobson, S. Johnson, B. M. Kaufman, S.-M. Lee, T. Lee, S. H. Pope, G. S. Riordan, and M. Whitlow. Science 242, 423 (1988). e D. Colcher, R. Bird, M. Roselli, K. D. Hardman, S. Johnson, S. Pope, S. W. Dodd, M. W. Pantoliano, D. E. Milenic, and J. Schlom, J. Natl. Cancer Inst. 82, 1191 (1990).
variable domain contains three CDRs; thus an Fv or scFv has six. The amino terminus of the heavy or light chain is in relatively close proximity to CDRI, while the respective carboxyl terminus is at the other end of the structure. When the first scFvs were designed, the three-dimensional structure of the myeloma protein MCPC603 was used to model potential linkers. 1a,14 ~3D. M. Segal, E. A. Padlan, G. H. Cohen, S. Rudikoff, M. Potter, and D. R. Davies, Proc. Natl. Acad. Sci. U.S.A. 71, 4298 (1974). 14y. Satow, G. H. Cohen, E. A. Padlan, and D. R. Davies, J. Mol. Biol. 190, 593 (1986).
[4]
SINGLE-CHAINFv
91
This structure was chosen with the assumption that the framework regions of most other antibodies would be as similar to this protein in structure as are those in the protein structure database. At a minimum, a structural model is required to determine the spatial distance that must be spanned be the peptide linker, usually 20-40 A. Peptides of 12-25 amino acids have been used for this purpose (Table I). Linkers were first chosen from the structures of proteins contained in the Brookhaven Protein Structure database and examined by computer graphics to determine whether they would link the carboxyl terminus of the VL to the amino terminus of the Vn without interfering with the structure of the Fv.i Subsequently, linkers were designed to span the distance between the carboxyl terminus of one domain to the amino terminus of the other. 1,4 It appears that linkers must be (1) sufficiently long to span the distance between the VL and V H in the Fv structure, (2) sufficiently flexible to allow the association of the VL and V n, and (3) relatively hydrophilic, being on the water-accessible surface of the molecule. Both the V L and V n have been used successfully as the amino-terminal domain in an scFv molecule.l.2 This reflects the approximate symmetry of the variable region structure. Several carefully designed linkers have been designed to join the VL to the VH of an anti-fluorescein scFv, resulting in a molecule with an affinity constant within a factor of two of Fab fragments of the parent antibody.15 A simple (G4S)3 linker has been used successfully both to join the V n to the VL2 and the V L to the VH.6 Linker sequences that have been successfully used in an scFv for one antibody are good starting points for the design of scFv molecules based on other antibodies. For example, we have successfully used the same linkers to construct both anti-fluorescein 1,15 and anti-tumor antigen scFvs,4 and the (G4S)3 linker developed by Huston et al. 2 has been used in other scFvs) ,6
Cloning of V H and VL Segments of R e a r r a n g e d Immunoglobulin Genes In order to construct an scFv gene it is necessary to clone the two variable regions that will be used to construct the gene. The variable region cDNAs can be cloned by conventional methodology using specific primers for the first-strand synthesis ~6,17 (Fig. 1A) or they can be amplified from first-strand cDNA by polymerase chain reaction (PCR) to facilitate the t5 M. W. Pantoliano,unpublished(1989). ~6S. Levy,E. Mendel,and S. Kon, Gene 54, 167 (1987). 17W. D. Bedzyk,L. S. Johnson, G. S. Riordan, andE. W. Voss,Jr.,,/. Biol. Chem. 264, 1565 (1989).
92
[4]
ANTIBODIES A N D A N T I G E N S
A Signal
5'
J
I
I
1st strand cDNA
C
mRNA
2nd strand cDNA
B Signal
s'
I
V
J
C
mRNA
I 1st strand cDNA
PCR
,_& 3'
V
J
I
C
1st strand cDNA
FIO. 1. Methods for obtaining eDNA copies ofimmunoglobulin variable region segments: (A) eDNA cloning using specific primers; (B) use of the polymerase chain reaction (PCR) with at least one degenerate, mixed, or consensus primer.
cloning (Fig. IB). Is,19Polymerase chain reaction can also be used to assemble an scFv gene from the variable eDNAs.
Direct eDNA Cloning eDNA copies of the "Ca and VL of the target antibody are generated as follows. The first-strand eDNA reaction is carried out using a phosphorylated oligonueleotide complementary to a segment of the mRNA coding for the constant region of the particular heavy- or light-chain isotype?6,17The primer thus anneals to a segment of the mRNA adjacent to the variable region. Second-strand eDNA synthesis is carried out using RNase H and E. 18R. Orlandi, D. H. Gussow, P. T. Jones, and G. Winter, Proc. Natl. Acad. Sci. U.S.A. 86, 3833 (1989). 19L. Sastry, M. Alting-Mees, W. D. Huse, J. M. Short, J. A. Sorge, B. N. Hay, K. D. Janda, S. J. Benkovie, and R. A. Lerner, Proc. Natl. Acad. Sci. U.S.A. 86, 5728 (1989).
[4]
SINGLI~.-CHAINFV
93
coli DNA polymerase I, as described by Gubler and Hoffman,2° followed by T4 DNA polymerase to assure that blunt ends are produced. The ds-cDNA is ligated into pUC18 (or M13mpl8) that has been digested with Smal and treated with alkaline phosphatase. The ligation is used to transform E. coli DH5t~ by the method of Hanahan. 2~ Colony hybridization is used to identify transformants carrying the desired eDNA segment. The probe for the hybridization is a second segment of the C-region sequence lying between the first-strand cDNA primer and the V region. Probes and primers corresponding to the J segments of the variable regions can also be used. Because the 5' end of the first-strand eDNA is fixed, a nested set of sequences can be chosen for sequencing by picking positive clones of approximately 450 bp (full length), 300 bp, and 150bp, subcloning into M13mp 18 and mpl9 and sequencing. After the sequence is determined in this way, full-length clones are sequenced entirely on both strands to assure that this agrees with the composite sequence. Amplification of First-Strand cDNA by Polymerase Chain Reaction By taking advantage of the fact that immunoglobulin variable region genes are flanked by conserved sequences at the 3' end and by semiconserved sequences at the 5' end, it is possible to design consensus primers to selectively amplify the variable regions of rearranged immunoglobulin genes by the use of the polymerase chain reaction (PCR)) s'19 This approach has been used effectively to clone the cDNAs for many MAbs and is the basis of the generation of combinatorial libraries in order to generate new specifieities.22 It should be noted that such consensus primers may not allow for somatic changes at the 3' end of the primer sequences and may not correspond to the entire germline repertoire of variable region genes. Thus, it is desirable to obtain N-terminal sequence of the heavy and light chains. With that caveat, the technique is incredibly powerful and the vast majority of rearranged variable region segments should be able to be cloned in this manner. Additionally, one should be aware of the possible presence of extraneous light- and/or heavy-chain mRNAs expressed by various versions of common fusion partners. 23 If several cDNAs have been cloned that agree in sequence, it may not be necessary to sequence the amino termini of the two protein chains of the monoclonal. However, if it is necessary to sequence these termini to confirm eDNA sequence, a good 20U. Gubler,and B. J. Hotfman,Gene25, 263 (1983). 21D. Hanahan,J. Mol. Biol. 166, 557 (1983). 22W. D. Huse, L. Sastry, S. A. Iverson,A. S. Kang, M. Alting-Mees,D. R. Burton, S. J. Benkovic,and R. A. Lerner,Science246, 1275(1989). 23S. Cabillyand A. D. Riggs,Gene40, 157 (1985).
94
ANTIBODIES AND
ANTIGENS
[4]
method for chain separation has been provided. 16 We have found that the purification of poly(A)+ RNA, using oligo(dT) cellulose in a format sold as the "Fast Track" kit (Invitrogen, San Diego, CA), is rapid and efficient. First-strand eDNA is made from l/zg (less can certainly be used) with random primers by using a kit from Boehringer Mannheim (Indianapolis, IN) in a reaction volume of 10/,1 at 37 ° for 1 hr. One microliter of the eDNA reaction is used directly in a PCR using 2.5 units Taq DNA polymerase with 0.5 a M each of the two primers in a reaction buffer consisting of 10 m M Tris-HC1 (pH 8.3), 50 m M KCI, 1.5 m M MgC12, 0.1 mg/ml gelatin, 0.2 m M dNTPs. We generally use 30 cycles of 1 min at 94°, 1 min at 55 °, and 1 min at 72 °. The annealing temperature may need to be adjusted according to the product(s) observed.
Assembly and Expression of scFv Proteins scFv genes can be efficientlyassembled in either of two ways: (I) site-directedmutagcncsis of the ends of the variableregion scgrncntsand assembly with a linker segment generated from oligonucleotides,or (2) direct assembly of the scFv gcne using PCR. 24 To assemble the gene by PCR, the linkersegment isgeneratedby overlapin two of the primers used to amplify the two variableregions. This overlap is illustratedin Fig. 2. Hence, when the firsttwo P C R fractionsarc mixed, one of the two possible cross-annealingproducts willprovide 3 O H groups thatwillbe extended by the polymcrasc to give a full-lengthscFv gcnc with the linker sequence joining the VL and VH. This strategy,and the P C R products produced using the primers describedbelow to generatean scFv gcnc from a human MAb, arc shown in Fig. 2. In this example the primer sequences arc as follow: 1. 5' V t AACCGTCGACGGATATCGTGATCACCCAGTCTCCGTCC 2. 3' V L + 5' end of the linker CGGAAGAI T'fACCAGAACCAGAGGTCK}ACCCTITrATTTCAAGCTTGGTCCCCC 3. 5' V H + 3' end of the linker GGTTCrGGTAAATCTTC'CGAAGGTAAAC_K}TCTCCTGCAGCTGCAGGAGT~ 4. 3' V a + stop codons CGCAGATCI-I-IATGAGC~CACAGAGACCAGCK}TGCC
There is a 19-base overlap generated in the linker region by the primers at the 3' end of the VL and 5' end of the V H. This set of oligonucleotides could be used with first-strand eDNA or with isolated eDNA clones. In this case we had sequence data on cDNAs of the VL and V n regions. One could 24 R. Higuchi, in " P C R Protocols" (M. A. Innis, D. H. Gelfand, J. J. Sninskey, a n d T. J. Whitepp, eds.), p. 177. Academic Press, San Diego, California, 1990.
[4]
SINGLE-CHAIN Fv
,,elii
A
95 A
,r
B
C
VL
VH
(
- ........ )
1016
bp
506/517 396 344 298
C
Linker -~7
-
-VL
VH
FIG. 2. Assembly of scFv genes using "overlapping" PCR. scFv genes can be assembled from cDNA clones (or directly from first strand cDNA) using the polymerase chain reaction. The individual VH (lane A) and VL (lane B) segments are amplified using primers that introduce overlapping segments of the linker region at the 3' end of the VL segment and the 5' end of the VH. These PCR fragments are then purified, annealed, and amplified using only primers at the 5' end of the VL and the 3' end of the VH(lane C).
design consensus primers with the linker and terminator segments for a rapid technique, given the cautions described above with regard to the possible presence of extraneous immunoglobulin mRNA in the hybridoma cells. The segment coding for the linker can be designed to accommodate the majority of variable region segments. The VL of human and mouse sequences can be modified to generate a HindIII site at the Y end and the VN to generate a PstI or PvuII site at the 5' end. For efficient expression in E. coli, we have fused scFv genes to the E. coli ompA signal sequence? This has resulted in consistent levels of expression after induction of expression using a strong inducible promoter, such as 2 pL or pR, or the T7 promoter/polymerase system, and the signal sequence is efficiently removed. The structure of the resulting gene and expression plasmid is shown in Fig. 3. In the case in which the gene is placed under the control of the hybrid OL/PR promoter, expression is induced by temperature shift from 30 to 42 °. scFvs are expressed at 5 to 15% of total cell protein after 15 to 30 min and levels do not increase much thereafter. Unprocessed material may accumulate after this point, however. The scFv protein expressed in this manner is insoluble, but does not generally appear as inclusion bodies. Soluble scFvs have been secreted onto the E. coli periplasm using the lac promoter and ompA signal.6
96
ANTIBODIESAND ANTIGENS
O/P Amp R
[4]
ompA signal VL Linker
VH
Ori ~ FIG. 3. Structure of generic plasmid for the expression of an scFv gene as a fusion to the E.
coli ompA signal sequence. Any inducible promoter may be used.
Insoluble protein is recovered after expression and cell lysis. The cell pellet is resuspended in 10 ml/g of 50 mMTris-HCl, pH 8.0, 1 mMEDTA, 0.1 m M phenylmethylsulfonyl fluoride (PMSF) and the cells are disrupted mechanically using either a Manton Gaulin (Gaulin Corp., Everett, MA) apparatus or a French pressure cell. The insoluble protein is recovered by differential centrifugation. After two washes in the lysis buffer, the protein is dissolved in 6 M guanidine-HC1, 50 m M Tds-HC1, pH 8.0, 50 m M KC1, 0.1 m M PMSF at a concentration of about 10 mg/ml. Renaturation is achieved by a 10- to 200-fold dilution into the same buffer without guanidine. The denatured protein should be added with gentle mixing and then left undisturbed for the renatumtion to occur. After 12 hr the protein is concentrated and the buffer is exchanged by tangential flow ultrafiltration using a Pellicon (Millipore, Bedford, MA) apparatus with an M r 10,000 cutoff membrane. This process can be accelerated by first filtering the solution to remove any components that became insoluble during the renaturation process. Purification of Active scFv Protein The renatured scFv can be purified to near homogeneity by cationexchange chromatography. We have utilized a high-performance liquid
[4]
SINGLE-CHAINFv
97
chromatography (HPLC) system using either aspartic acid or carboxymethyl functional groups. Most of the improperly folded scFv remains insoluble and that which remains in solution after refolding differs in its charge from active scFv protein and either does not bind to the column or elutes earlier than the latter species in a salt gradient. This may vary from antibody to antibody. It is therefore advisable to have a reliable and rapid assay for the binding activity of the scFv to antigen. Antigen affinity chromatography can also be used to purify scFv proteins where the antigen is known and can be obtained in sufficient quantity to prepare an affinity resin for chromatography. This methodology has been used to purify scFvs that bind bovine growth hormone (BGH), ~ fluorescein,~digoxin,2 and phosphorylcholine.6 In the case of the anti-BGH scFv, affinity chromatography on BGH bound to Sepharose yielded protein that was pure and had 90% bioactivity.l For the antigens that can be obtained and immobilized, this methodology offers a fast way to purify active scFv proteins. In designing assays to monitor the purification or to determine the affinity of an scFv molecule, keep in mind that reagents that are generally used to detect antibodies do so by binding to the constant domains and should not be expected to cross-react with the variable domains and thus with the scFv. This includes not only bacterial antibody-binding proteins but also polyclonal sera to general classes of or species-specific immunoglobulin. Only antisera to the starting Mab, Fab, or scFv itself will contain enough variable region-specific antibody to be used to detect the scFv in direct binding formats. The lack of binding of these reagents to the scFv relative to its parent MAb and Fab fragments allows for simple competitive assays to be designed. In such experiments it is advisable to use Fab fragments as the competitor and thus avoid any effects related to the bivalent nature of the MAb (i.e., avidity vs affinity). In general, antibodies in which there is a significant difference between avidity and affinity (more than 10-fold) may not be good choices for scFvs unless their uniqueness or some other overriding factor precludes the selection of another antibody. The absence of constant region segments is also an important consideration in modifying the protein by iodination or conjugation to reporter molecules such as biotin or enzymes. Since the scFv molecule contains only the binding domain, it is quite likely that any modification that either perturbs the structure of the domain or modifies residues within the binding pocket will decrease or abolish the binding activity of the molecule. Thus, if one is going to use such methods to modify the scFv for subsequent detection after it has bound antigen, a second method should be used to not only measure general immunoreactivity, but also to estimate retention of affinity in the immunoreactive fraction. This could be either a
98
ANTIBODIES AND ANTIGENS
[4]
comparison to metabolically labeled scFv as a "gold standard" or competition assay using the Fab. For monoclonal antibodies specific for small ligands is may be possible to use a change in the fluorescence of the ligand or the antibody as a measure of binding. We and others have used such assays to measure the binding of scFvs to fluorescein) digoxin, 2 and phosphorylcholine,6 respectively. Conclusion Genetic and protein engineering applied to immunoglobulin molecules has produced novel new ways of generating and preserving speciticities. This area was the subject of a review.25 The ability to amplify the rearranged variable region segments from single lymphocytes and methods for the stimulation of B cells in vitro make more realistic the generation or preservation of specificities from species other than mouse. The scFv molecule preserves the specificity of an antibody in a much smaller form that is simple to generate and manipulate. The combination of these new methods with each other, such combinatorial libraries of Fabs secreted from E. coli, 19 and combinatorial or mutagenized libraries of scFvs expressed on the surface of bacteriophage, 26 are extremely powerful methods of screening or selecting and preserving specificities. Finally, the incorporation of an scFv into a genetic fusion with other functional polypeptides, such as metal-binding domains, modified toxin domains, catalytic domains, or other scFvs, has the potential to generate novel and useful functional combinations. 27-29
25 G. Winter and C. Milstein, Nature (London) 349, 293 (1991). 26 C. A. K. Borrebaeck, L. Danielsson, and S. A. Moiler, Proc. Natl. Acad. Sci. U.S.A. 85, 3995 (1988). 27j. Larriek, L. Danielsson, C. A. Brenner, E. WaUaee, M. Abrhamson, K. Fry, and C. Borrebaeek, Bio/Technology 7, 934 (1989). 2s j. MeCafferty, A. D. Gritfiths, G. Winter, and D. J. Chisweil, Nature (London) 348, 552 (1990). 29 V. A. Roberts, B. L. Iverson, S. A. Iverson, S. J. Bankovie, R. A. Lerner, E. D. Getzoff, and J. A. Tainer, Proc. Natl. Acad. Sci. U.S.A. 87, 6654 (1990).
ANTIBODIES AND ANTIGENS
[4]
immunotoxins, ~4-1s and for other biomedical applications still to be explored. Acknowledgments We thank Clare Corbett, Peter Keek, Walter F. StaffordI11,and Brenda Giust for their assistance in the conduct of this research and in the preparation of this chapter. Supportedin part by the National Institutes of Health, Grants CA 39870, CA 51880, and HL 19259.
[4] Construction of Single-Chain Fv Derivatives of Monoclonal Antibodies and Their Production in Escherichia coli By SYD JOHNSON a n d
ROBERT E. BIRD
A single-chain Fv (scFv) molecule consists of the variable domains of an antibody tethered together by a designed protein linker such that the antigen combining site is regenerated in a single protein. 1~ Either the VL or VH can be used as amino-terminal domain of an seFv. Because of several unique properties such as small size, ease of engineering, and stability even at low concentrations, scFvs may eventually be useful in the diagnosis and/or therapy of diseases such as cancer, where target antigens are often expressed preferentially on the surface of cells. Applications under development include the use of genetic fusions of scFvs to potent toxins 3 and the use of radiolabeled scFv molecules to image tumors that express antigens recognized by the scFv. 4 The generality of the scFv technology is based on the observation that the basic structure of the individual immunoglobulin domains is conserved in all antibodies. 5 It is then assumed that this framework structure is sufficiently stable that, so long as a linker or other i R. E. Bird, IC D. Hardman, J. W. Jacobson, S. Johnson, B. M. Kaufman, S.-M. Lee, T. Lee, S. H. Pope, G. S. Riordan, and M. Whitlow, Science 242, 423 (1988). 2 j. S. Huston, D. Levinson, M. Mudgett-Hunter, M.-S. Tai, J. Novotny, M. N. Margolies, R. J. Ridge, R. E. Brueeoleri, E. Haber, R. Crea, and H. Oppermann, Proc. Natl. Acad. Sci. U.S.A. 85, 5879 (1988). 3 V. K. Chaudhary, C. Queen, R. P. Junghans, T. A. Waldmann, D. J. FitzGerald, and I. Pastan, Nature (London) 339, 394 (1989). 4 D. Colcher, R. Bird, M. Roselli, K. D. Hardman, S. Johnson, S. Pope, S. W. Dodd, M. W. Pantoliano, D. E. Milenie, and J. Sehlom, J. Natl. Cancer Inst. 82, 1191 (1990). 5 E. A. Padlan, Q Rev. Biophys. 10, 35 (1977).
METHODS
IN E N Z Y M O L O G Y ,
VOL. 203
Copyri~t © 1991 by ~ P m ~ Inc. All dghm of mlmxluction in any form reserved.
[4]
SINGLE-CHAINFv
89
adjoining region does not interfere with the domain structure and the ability of the VL and Vn to associate, the individual domains will fold and associate to form a molecule that mimicks the antigen combining region of an antibody heterodimer. In addition to the applications described above, since the scFv is a stable replica of an Fv, it provides a useful research tool for testing modifications to the Fv, including complementarity-determining region (CDR) grafting and the study of antibody-antigen interactions. One important reason for this is the simplicity of the system; once the scFv gene is constructed, the gene can be modified and the resulting mutant scFv protein is easy to produce and subsequently test. Several different expression/production systems for scFv molecules have been developed, including secretion of active scFvs using Escherichia coli, 6 Bacillus subtilis, 7 yeast, s and mammalian cells, 9 and the refolding of insoluble, E. coli-produced protein.l,2 We believe that the refolding procedures that have been used offer the most reproducible system for producing large quantities of any scFv protein and are adaptable to almost any laboratory for the production of active protein. The secretion of active scFv protein will be extremely useful as a tool to develop genetic screens and selections for mutagenized or combinatorial libraries of scFvs. For example, active scFvs have been displayed on the surface of filamentous bacteriophage using the fusion phage technology developed by Smith. 1° Eventually secretion of active scFvs will replace refolding as the method of choice for production. However, we will restrict the content of this chapter to the development of scFvs by refolding the protein that has been produced in E. coli. X-Ray crystallographic determination of the three-dimensional structures of antibody variable domains has demonstrated that they fold into a nine-strand fl sheet with the residues that contact the antigen being in general confined to loops generated at the turns between strands of the ,0 structure. These residues were initially referred to as hypervariable regions, based on comparative sequence data," and are now referred to as complementarity-determining regions (CDRs) based on their function? 2 Each 6 R. Glockshuber, M. Malia, I. Pfitzinger, and A. Plfickthun, Biochemistry 29, 1362 (1990). 7 M. Pantoliano, P. Alexander, S. Dodd, P. Bryan, M. Rollence, J. Wood, and S. Fahnestock, J. Cell. Biochem. 13A, 91 (1989). 8 G. T. Davis, W. D. Bedzyk, E. W. Voss, and T. W. Jacobs, Bio/Technolgy9, 165 (1990). 9 S. Johnson, unpublished results (1990). 10G. Smith, Science 228, 1315 (1985). 11E. A. Kabat, T. T. Wu, M. Reid-Miller, H. M. Perry, and K. S. Gottesman, "Sequences of Proteins of Immunological Interest," 4th Ed., U.S. Department of Health and Human Services, Washington, D.C., 1987. 12T. T. Wu and E. A. Kabat, J. Exp. Med. 132, 211 (1970).
90
[4]
ANTIBODIES AND ANTIGENS
TABLE I LINKERS USED TO CONNECT V L AND V u SEQUENCES
Position
H 113
Antibody
VH-finker-VL Linker
...S -GGGGSGGGGSGGGGS ...S -GGGG SGGGGSGGGGS ... S-SGGGGSGGGGSGGGGSQ-...
L1 26-10~ Anti-tacb Anti-tac~
-.D... -Q...
VL-linker-V n
L105
Linker
HI
...L-KESGSVSSEQLAQFRSLD ...K-EGKSSGSGSESKST L 107 Linker
-Q... H1
...K-GSTSGSGKSSEGKG
-Q...
H2 -V...
Anti-BGHd 4-4-20d
B6.2 •
a j. S. Huston, D. Levinson, M. Mudgett-Hunter, M.-S. Tai, J. Novotny, M. N. Margolies, R. J. Ridge, R. E. Bruccoled, E. Haber, R. Crea, and H. Opperman, Proc. Natl. Acad. Sci. U.S.A. 85, 423 (1988). b V. K. Chaudhary, C. Queen, R. P. Junghans, T. A. Waldman, D. J. FitzGerald, and I. Pastan, Nature (London) 339, 394 (1989). c j. K. Batra, D. FitzGerald, M. Gately, V. K. Chaudhary, and I. Pastan, J. Biol. Chem. 265, 15198 (1990). d BGH, bovine growth hormone. R. E. Bird, K. D. Hardman, J. W. Jacobson, S. Johnson, B. M. Kaufman, S.-M. Lee, T. Lee, S. H. Pope, G. S. Riordan, and M. Whitlow. Science 242, 423 (1988). e D. Colcher, R. Bird, M. Roselli, K. D. Hardman, S. Johnson, S. Pope, S. W. Dodd, M. W. Pantoliano, D. E. Milenic, and J. Schlom, J. Natl. Cancer Inst. 82, 1191 (1990).
variable domain contains three CDRs; thus an Fv or scFv has six. The amino terminus of the heavy or light chain is in relatively close proximity to CDRI, while the respective carboxyl terminus is at the other end of the structure. When the first scFvs were designed, the three-dimensional structure of the myeloma protein MCPC603 was used to model potential linkers. 1a,14 ~3D. M. Segal, E. A. Padlan, G. H. Cohen, S. Rudikoff, M. Potter, and D. R. Davies, Proc. Natl. Acad. Sci. U.S.A. 71, 4298 (1974). 14y. Satow, G. H. Cohen, E. A. Padlan, and D. R. Davies, J. Mol. Biol. 190, 593 (1986).
[4]
SINGLE-CHAINFv
91
This structure was chosen with the assumption that the framework regions of most other antibodies would be as similar to this protein in structure as are those in the protein structure database. At a minimum, a structural model is required to determine the spatial distance that must be spanned be the peptide linker, usually 20-40 A. Peptides of 12-25 amino acids have been used for this purpose (Table I). Linkers were first chosen from the structures of proteins contained in the Brookhaven Protein Structure database and examined by computer graphics to determine whether they would link the carboxyl terminus of the VL to the amino terminus of the Vn without interfering with the structure of the Fv.i Subsequently, linkers were designed to span the distance between the carboxyl terminus of one domain to the amino terminus of the other. 1,4 It appears that linkers must be (1) sufficiently long to span the distance between the VL and V H in the Fv structure, (2) sufficiently flexible to allow the association of the VL and V n, and (3) relatively hydrophilic, being on the water-accessible surface of the molecule. Both the V L and V n have been used successfully as the amino-terminal domain in an scFv molecule.l.2 This reflects the approximate symmetry of the variable region structure. Several carefully designed linkers have been designed to join the VL to the VH of an anti-fluorescein scFv, resulting in a molecule with an affinity constant within a factor of two of Fab fragments of the parent antibody.15 A simple (G4S)3 linker has been used successfully both to join the V n to the VL2 and the V L to the VH.6 Linker sequences that have been successfully used in an scFv for one antibody are good starting points for the design of scFv molecules based on other antibodies. For example, we have successfully used the same linkers to construct both anti-fluorescein 1,15 and anti-tumor antigen scFvs,4 and the (G4S)3 linker developed by Huston et al. 2 has been used in other scFvs) ,6
Cloning of V H and VL Segments of R e a r r a n g e d Immunoglobulin Genes In order to construct an scFv gene it is necessary to clone the two variable regions that will be used to construct the gene. The variable region cDNAs can be cloned by conventional methodology using specific primers for the first-strand synthesis ~6,17 (Fig. 1A) or they can be amplified from first-strand cDNA by polymerase chain reaction (PCR) to facilitate the t5 M. W. Pantoliano,unpublished(1989). ~6S. Levy,E. Mendel,and S. Kon, Gene 54, 167 (1987). 17W. D. Bedzyk,L. S. Johnson, G. S. Riordan, andE. W. Voss,Jr.,,/. Biol. Chem. 264, 1565 (1989).
92
[4]
ANTIBODIES A N D A N T I G E N S
A Signal
5'
J
I
I
1st strand cDNA
C
mRNA
2nd strand cDNA
B Signal
s'
I
V
J
C
mRNA
I 1st strand cDNA
PCR
,_& 3'
V
J
I
C
1st strand cDNA
FIO. 1. Methods for obtaining eDNA copies ofimmunoglobulin variable region segments: (A) eDNA cloning using specific primers; (B) use of the polymerase chain reaction (PCR) with at least one degenerate, mixed, or consensus primer.
cloning (Fig. IB). Is,19Polymerase chain reaction can also be used to assemble an scFv gene from the variable eDNAs.
Direct eDNA Cloning eDNA copies of the "Ca and VL of the target antibody are generated as follows. The first-strand eDNA reaction is carried out using a phosphorylated oligonueleotide complementary to a segment of the mRNA coding for the constant region of the particular heavy- or light-chain isotype?6,17The primer thus anneals to a segment of the mRNA adjacent to the variable region. Second-strand eDNA synthesis is carried out using RNase H and E. 18R. Orlandi, D. H. Gussow, P. T. Jones, and G. Winter, Proc. Natl. Acad. Sci. U.S.A. 86, 3833 (1989). 19L. Sastry, M. Alting-Mees, W. D. Huse, J. M. Short, J. A. Sorge, B. N. Hay, K. D. Janda, S. J. Benkovie, and R. A. Lerner, Proc. Natl. Acad. Sci. U.S.A. 86, 5728 (1989).
[4]
SINGLI~.-CHAINFV
93
coli DNA polymerase I, as described by Gubler and Hoffman,2° followed by T4 DNA polymerase to assure that blunt ends are produced. The ds-cDNA is ligated into pUC18 (or M13mpl8) that has been digested with Smal and treated with alkaline phosphatase. The ligation is used to transform E. coli DH5t~ by the method of Hanahan. 2~ Colony hybridization is used to identify transformants carrying the desired eDNA segment. The probe for the hybridization is a second segment of the C-region sequence lying between the first-strand cDNA primer and the V region. Probes and primers corresponding to the J segments of the variable regions can also be used. Because the 5' end of the first-strand eDNA is fixed, a nested set of sequences can be chosen for sequencing by picking positive clones of approximately 450 bp (full length), 300 bp, and 150bp, subcloning into M13mp 18 and mpl9 and sequencing. After the sequence is determined in this way, full-length clones are sequenced entirely on both strands to assure that this agrees with the composite sequence. Amplification of First-Strand cDNA by Polymerase Chain Reaction By taking advantage of the fact that immunoglobulin variable region genes are flanked by conserved sequences at the 3' end and by semiconserved sequences at the 5' end, it is possible to design consensus primers to selectively amplify the variable regions of rearranged immunoglobulin genes by the use of the polymerase chain reaction (PCR)) s'19 This approach has been used effectively to clone the cDNAs for many MAbs and is the basis of the generation of combinatorial libraries in order to generate new specifieities.22 It should be noted that such consensus primers may not allow for somatic changes at the 3' end of the primer sequences and may not correspond to the entire germline repertoire of variable region genes. Thus, it is desirable to obtain N-terminal sequence of the heavy and light chains. With that caveat, the technique is incredibly powerful and the vast majority of rearranged variable region segments should be able to be cloned in this manner. Additionally, one should be aware of the possible presence of extraneous light- and/or heavy-chain mRNAs expressed by various versions of common fusion partners. 23 If several cDNAs have been cloned that agree in sequence, it may not be necessary to sequence the amino termini of the two protein chains of the monoclonal. However, if it is necessary to sequence these termini to confirm eDNA sequence, a good 20U. Gubler,and B. J. Hotfman,Gene25, 263 (1983). 21D. Hanahan,J. Mol. Biol. 166, 557 (1983). 22W. D. Huse, L. Sastry, S. A. Iverson,A. S. Kang, M. Alting-Mees,D. R. Burton, S. J. Benkovic,and R. A. Lerner,Science246, 1275(1989). 23S. Cabillyand A. D. Riggs,Gene40, 157 (1985).
94
ANTIBODIES AND
ANTIGENS
[4]
method for chain separation has been provided. 16 We have found that the purification of poly(A)+ RNA, using oligo(dT) cellulose in a format sold as the "Fast Track" kit (Invitrogen, San Diego, CA), is rapid and efficient. First-strand eDNA is made from l/zg (less can certainly be used) with random primers by using a kit from Boehringer Mannheim (Indianapolis, IN) in a reaction volume of 10/,1 at 37 ° for 1 hr. One microliter of the eDNA reaction is used directly in a PCR using 2.5 units Taq DNA polymerase with 0.5 a M each of the two primers in a reaction buffer consisting of 10 m M Tris-HC1 (pH 8.3), 50 m M KCI, 1.5 m M MgC12, 0.1 mg/ml gelatin, 0.2 m M dNTPs. We generally use 30 cycles of 1 min at 94°, 1 min at 55 °, and 1 min at 72 °. The annealing temperature may need to be adjusted according to the product(s) observed.
Assembly and Expression of scFv Proteins scFv genes can be efficientlyassembled in either of two ways: (I) site-directedmutagcncsis of the ends of the variableregion scgrncntsand assembly with a linker segment generated from oligonucleotides,or (2) direct assembly of the scFv gcne using PCR. 24 To assemble the gene by PCR, the linkersegment isgeneratedby overlapin two of the primers used to amplify the two variableregions. This overlap is illustratedin Fig. 2. Hence, when the firsttwo P C R fractionsarc mixed, one of the two possible cross-annealingproducts willprovide 3 O H groups thatwillbe extended by the polymcrasc to give a full-lengthscFv gcnc with the linker sequence joining the VL and VH. This strategy,and the P C R products produced using the primers describedbelow to generatean scFv gcnc from a human MAb, arc shown in Fig. 2. In this example the primer sequences arc as follow: 1. 5' V t AACCGTCGACGGATATCGTGATCACCCAGTCTCCGTCC 2. 3' V L + 5' end of the linker CGGAAGAI T'fACCAGAACCAGAGGTCK}ACCCTITrATTTCAAGCTTGGTCCCCC 3. 5' V H + 3' end of the linker GGTTCrGGTAAATCTTC'CGAAGGTAAAC_K}TCTCCTGCAGCTGCAGGAGT~ 4. 3' V a + stop codons CGCAGATCI-I-IATGAGC~CACAGAGACCAGCK}TGCC
There is a 19-base overlap generated in the linker region by the primers at the 3' end of the VL and 5' end of the V H. This set of oligonucleotides could be used with first-strand eDNA or with isolated eDNA clones. In this case we had sequence data on cDNAs of the VL and V n regions. One could 24 R. Higuchi, in " P C R Protocols" (M. A. Innis, D. H. Gelfand, J. J. Sninskey, a n d T. J. Whitepp, eds.), p. 177. Academic Press, San Diego, California, 1990.
[4]
SINGLE-CHAIN Fv
,,elii
A
95 A
,r
B
C
VL
VH
(
- ........ )
1016
bp
506/517 396 344 298
C
Linker -~7
-
-VL
VH
FIG. 2. Assembly of scFv genes using "overlapping" PCR. scFv genes can be assembled from cDNA clones (or directly from first strand cDNA) using the polymerase chain reaction. The individual VH (lane A) and VL (lane B) segments are amplified using primers that introduce overlapping segments of the linker region at the 3' end of the VL segment and the 5' end of the VH. These PCR fragments are then purified, annealed, and amplified using only primers at the 5' end of the VL and the 3' end of the VH(lane C).
design consensus primers with the linker and terminator segments for a rapid technique, given the cautions described above with regard to the possible presence of extraneous immunoglobulin mRNA in the hybridoma cells. The segment coding for the linker can be designed to accommodate the majority of variable region segments. The VL of human and mouse sequences can be modified to generate a HindIII site at the Y end and the VN to generate a PstI or PvuII site at the 5' end. For efficient expression in E. coli, we have fused scFv genes to the E. coli ompA signal sequence? This has resulted in consistent levels of expression after induction of expression using a strong inducible promoter, such as 2 pL or pR, or the T7 promoter/polymerase system, and the signal sequence is efficiently removed. The structure of the resulting gene and expression plasmid is shown in Fig. 3. In the case in which the gene is placed under the control of the hybrid OL/PR promoter, expression is induced by temperature shift from 30 to 42 °. scFvs are expressed at 5 to 15% of total cell protein after 15 to 30 min and levels do not increase much thereafter. Unprocessed material may accumulate after this point, however. The scFv protein expressed in this manner is insoluble, but does not generally appear as inclusion bodies. Soluble scFvs have been secreted onto the E. coli periplasm using the lac promoter and ompA signal.6
96
ANTIBODIESAND ANTIGENS
O/P Amp R
[4]
ompA signal VL Linker
VH
Ori ~ FIG. 3. Structure of generic plasmid for the expression of an scFv gene as a fusion to the E.
coli ompA signal sequence. Any inducible promoter may be used.
Insoluble protein is recovered after expression and cell lysis. The cell pellet is resuspended in 10 ml/g of 50 mMTris-HCl, pH 8.0, 1 mMEDTA, 0.1 m M phenylmethylsulfonyl fluoride (PMSF) and the cells are disrupted mechanically using either a Manton Gaulin (Gaulin Corp., Everett, MA) apparatus or a French pressure cell. The insoluble protein is recovered by differential centrifugation. After two washes in the lysis buffer, the protein is dissolved in 6 M guanidine-HC1, 50 m M Tds-HC1, pH 8.0, 50 m M KC1, 0.1 m M PMSF at a concentration of about 10 mg/ml. Renaturation is achieved by a 10- to 200-fold dilution into the same buffer without guanidine. The denatured protein should be added with gentle mixing and then left undisturbed for the renatumtion to occur. After 12 hr the protein is concentrated and the buffer is exchanged by tangential flow ultrafiltration using a Pellicon (Millipore, Bedford, MA) apparatus with an M r 10,000 cutoff membrane. This process can be accelerated by first filtering the solution to remove any components that became insoluble during the renaturation process. Purification of Active scFv Protein The renatured scFv can be purified to near homogeneity by cationexchange chromatography. We have utilized a high-performance liquid
[4]
SINGLE-CHAINFv
97
chromatography (HPLC) system using either aspartic acid or carboxymethyl functional groups. Most of the improperly folded scFv remains insoluble and that which remains in solution after refolding differs in its charge from active scFv protein and either does not bind to the column or elutes earlier than the latter species in a salt gradient. This may vary from antibody to antibody. It is therefore advisable to have a reliable and rapid assay for the binding activity of the scFv to antigen. Antigen affinity chromatography can also be used to purify scFv proteins where the antigen is known and can be obtained in sufficient quantity to prepare an affinity resin for chromatography. This methodology has been used to purify scFvs that bind bovine growth hormone (BGH), ~ fluorescein,~digoxin,2 and phosphorylcholine.6 In the case of the anti-BGH scFv, affinity chromatography on BGH bound to Sepharose yielded protein that was pure and had 90% bioactivity.l For the antigens that can be obtained and immobilized, this methodology offers a fast way to purify active scFv proteins. In designing assays to monitor the purification or to determine the affinity of an scFv molecule, keep in mind that reagents that are generally used to detect antibodies do so by binding to the constant domains and should not be expected to cross-react with the variable domains and thus with the scFv. This includes not only bacterial antibody-binding proteins but also polyclonal sera to general classes of or species-specific immunoglobulin. Only antisera to the starting Mab, Fab, or scFv itself will contain enough variable region-specific antibody to be used to detect the scFv in direct binding formats. The lack of binding of these reagents to the scFv relative to its parent MAb and Fab fragments allows for simple competitive assays to be designed. In such experiments it is advisable to use Fab fragments as the competitor and thus avoid any effects related to the bivalent nature of the MAb (i.e., avidity vs affinity). In general, antibodies in which there is a significant difference between avidity and affinity (more than 10-fold) may not be good choices for scFvs unless their uniqueness or some other overriding factor precludes the selection of another antibody. The absence of constant region segments is also an important consideration in modifying the protein by iodination or conjugation to reporter molecules such as biotin or enzymes. Since the scFv molecule contains only the binding domain, it is quite likely that any modification that either perturbs the structure of the domain or modifies residues within the binding pocket will decrease or abolish the binding activity of the molecule. Thus, if one is going to use such methods to modify the scFv for subsequent detection after it has bound antigen, a second method should be used to not only measure general immunoreactivity, but also to estimate retention of affinity in the immunoreactive fraction. This could be either a
98
ANTIBODIES AND ANTIGENS
[4]
comparison to metabolically labeled scFv as a "gold standard" or competition assay using the Fab. For monoclonal antibodies specific for small ligands is may be possible to use a change in the fluorescence of the ligand or the antibody as a measure of binding. We and others have used such assays to measure the binding of scFvs to fluorescein) digoxin, 2 and phosphorylcholine,6 respectively. Conclusion Genetic and protein engineering applied to immunoglobulin molecules has produced novel new ways of generating and preserving speciticities. This area was the subject of a review.25 The ability to amplify the rearranged variable region segments from single lymphocytes and methods for the stimulation of B cells in vitro make more realistic the generation or preservation of specificities from species other than mouse. The scFv molecule preserves the specificity of an antibody in a much smaller form that is simple to generate and manipulate. The combination of these new methods with each other, such combinatorial libraries of Fabs secreted from E. coli, 19 and combinatorial or mutagenized libraries of scFvs expressed on the surface of bacteriophage, 26 are extremely powerful methods of screening or selecting and preserving specificities. Finally, the incorporation of an scFv into a genetic fusion with other functional polypeptides, such as metal-binding domains, modified toxin domains, catalytic domains, or other scFvs, has the potential to generate novel and useful functional combinations. 27-29
25 G. Winter and C. Milstein, Nature (London) 349, 293 (1991). 26 C. A. K. Borrebaeck, L. Danielsson, and S. A. Moiler, Proc. Natl. Acad. Sci. U.S.A. 85, 3995 (1988). 27j. Larriek, L. Danielsson, C. A. Brenner, E. WaUaee, M. Abrhamson, K. Fry, and C. Borrebaeek, Bio/Technology 7, 934 (1989). 2s j. MeCafferty, A. D. Gritfiths, G. Winter, and D. J. Chisweil, Nature (London) 348, 552 (1990). 29 V. A. Roberts, B. L. Iverson, S. A. Iverson, S. J. Bankovie, R. A. Lerner, E. D. Getzoff, and J. A. Tainer, Proc. Natl. Acad. Sci. U.S.A. 87, 6654 (1990).
