Plant Physiology and Biochemistry 82 (2014) 161e171

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy

Research article

Contribution of polyamines and other related metabolites to the maintenance of zucchini fruit quality during cold storage
tima Carvajal a, Manuel Jamilena b, Dolores Garrido a Francisco Palma a, *, Fa a b

Department of Plant Physiology, Facultad de Ciencias, University of Granada, Fuentenueva s/n, 18071 Granada, Spain ~ ada de San Urbano s/n, 04120 Almería, Spain Department of Biology and Geology, Escuela Superior de Ingeniería, University of Almería, La Can

a r t i c l e i n f o

a b s t r a c t

Article history: Received 5 March 2014 Accepted 3 June 2014 Available online 13 June 2014

In order to investigate the contribution of polyamines and related amino acids in the maintenance of zucchini fruit quality during cold storage, two varieties of Cucurbita pepo with different degrees of chilling tolerance were used, Natura (more tolerant) and Sinatra (moresensitive). After harvest, free putrescine levels decreased during storage at 20
C, whereas in fruit kept at 4
C this polyamine accumulated in both varieties, but with higher levels in the sensitive variety (Sinatra). This behavior suggests that putrescine is accumulated as a response to low temperature in zucchini fruit by stress-induced chilling injury, and not due to the postharvest storage itself. ADC activity responds quickly to chilling but sharply decreases after 14 days, whereas its expression remains high in both varieties. ODC activity takes over when the cold stress is relatively severe, as this activity was found to be much higher in Sinatra. ODCexpression also correlated with ODC activity. DAO activity increased in Natura fruit, and conversely decreased in Sinatra fruit during storage at 4
C, whereas the proline content was higher in Natura and lower in Sinatra. Therefore, we suggest that putrescine degradation and proline accumulation contribute to the acquisition of chilling tolerance in zucchini fruit. GABA content decreased in both varieties, with a greater reduction in Natura fruit and less in Sinatra fruit. In addition, GABA transaminase showed a higher activity in Natura fruit than in Sinatra fruit during cold storage, suggesting that GABA catabolism could be involved in the tolerance to postharvest cold storage in zucchini fruit. © 2014 Elsevier Masson SAS. All rights reserved.

Keywords: Polyamines Zucchini Chilling Putrescine GABA Proline

1. Introduction Polyamines are low molecular weight, aliphatic polycations found in the cells of all living organisms. Due to their positive charges, polyamines bind to macromolecules such as DNA, RNA, and proteins (Kusano et al., 2008). Putrescine can be formed either directly from ornithine in a single reaction catalyzed by ornithine decarboxylase (ODC) or by decarboxylation of arginine via the arginine decarboxylase (ADC), with agmatine and Ncarbamoylputrescine as intermediates. Spermidine and spermine are formed by sequential addition of aminopropyl groups to putrescine and spermidine, respectively, by spermidine synthase and spermine synthase. The aminopropyl donor is generated from S-adenosylmethionine (SAM) by the action of SAM decarboxylase (Tiburcio

Abbreviations: (ACC), 1-aminocyclopropane-l-carboxylic acid; (ADC), arginine decarboxylase; (DAO), diamine oxidase; (GABA), 4-aminobutyrate; (GABA-T), GABA transaminase; (ODC), ornithine decarboxylase; (PAO), polyamine oxidase; (SAM), Sadenosylmethionine. * Corresponding author. Tel.: þ34 958 243159; fax: þ34 958 248995. E-mail address: [email protected] (F. Palma). http://dx.doi.org/10.1016/j.plaphy.2014.06.001 0981-9428/© 2014 Elsevier Masson SAS. All rights reserved.

et al., 1997). SAM is a common intermediate of polyamines and ethylene (Cantoni, 1975), being a substrate for the enzymes 1aminocyclopropane-l-carboxylic acid (ACC) synthase during ethylene synthesis, and SAM decarboxylase in the formation of the polyamines spermidine and spermine. Diamine oxidase (DAO) catalyzes the degradation of putrescine and 1,3-diaminopropane generating 4-aminobutyraldehyde/D1-Pyrroline and 3aminopropionaldehyde, respectively, which are converted to 4aminobutyrate (GABA) and b-alanine. O2 dependent polyamine oxidases (PAO) are responsible for catalysing the oxidation or backconversion of spermine and spermidine, resulting in the formation of spermidine, putrescine, 3-aminopropionaldehyde, and their degradation to 1-(3-aminopropyl)-pyrroline, 1,3-diaminopropane and 4-aminobutyraldehyde (Shelp et al., 2012a). The pathway for polyamine synthesis is tightly connected to the metabolism of several amino acids. Ornithine and arginine are substrates for the synthesis of putrescine, but they are also intermediates in the synthesis of proline and GABA, being glutamate also a precursor of ornithine and GABA (Shelp et al., 2012a). In stressed tissues, putrescine and proline are connected by a precursoreproduct relationship via the activity of DAO and GABA metabolism (Bouchereau

162

F. Palma et al. / Plant Physiology and Biochemistry 82 (2014) 161e171

fruit was calculated. The chilling-injury index (CI) of surface fruit was evaluated using a subjective scale of visual symptoms previ
llez, Ramos-Clamont, Gardea and ously described Martínez-Te
llez et al., 2002): 0 ¼ no pitting, Vargas-Arispuro (Martínez-Te 1 ¼ slight (10% or less), 2 ¼ medium (10e20%), and 3 ¼ severe pitting (>20%). CI index was determined using the following formula: S (pitting scale (0e3)  number of corresponding fruit within each class)/total number of fruit estimated.

et al., 1999). In plants, GABA is directly derived from glutamate via calcium/calmodulin- or low pH-mediated glutamate decarboxylase activity, or indirectly from putrescine via a combination of diamine oxidase and g-aminobutyraldehyde dehydrogenase activities (Shelp et al., 2012a, 2012b, 2012c). Therefore, a high number of compounds, most of which are present in conditions of stress, are imbricated and share common metabolic pathways, making difficult to elucidate the role and importance of each compound in the stress response. Low-temperature storage is used to prolong shelf life of fruits and vegetables, although in tropical and subtropical fruit storage ~ oz below critical temperatures can often cause severe losses (Mun et al., 2001; Wang, 2010). Zucchini (Cucurbita pepo L. morphotype Zucchini), bears fruits that are marketed at an immature stage. Its subtropical origin makes zucchini fruit susceptible to chilling disorders when stored at low non-freezing temperatures. Chilling injury symptoms in zucchini fruit are weight loss, softening, and
llez et al., the appearance of pits on the fruit surface (Martínez-Te 2002; Serrano et al., 1998). In addition to the ultra structural changes, chilling also results in a series of physiological, biochemical and molecular modification, such as an accumulation of hydrogen peroxide (H2O2) and malondialdehyde (MDA), changes in the levels of endogenous abscisic acid (Anderson et al., 1994), sugars (Palma et al., 2014) and polyamines (Groppa and Benavides, 2008; Moschou et al., 2008a; Zhang et al., 2009). The polyamine anabolic/catabolic regulation has recently been suggested to be the crucial factor in polyamine mediated stress tolerance (Moschou et al., 2008b). In a previous work analysing the chilling resistance in fruit of different commercial varieties of Cucurbita pepo grown in the south-eastern Spain, we detected differences in chilling damage among varieties after 14 days of cold storage (Carvajal et al., 2011), and these results offer the possibility of comparing physiological changes that take place during fruit storage at different temperatures as well as changes among varieties with different chilling sensitivities. The aim of this work has been the study of the changes in polyamines and other related nitrogen metabolites in the zucchini fruit during cold storage, and to unveil the contributions of these compounds to the maintenance of zucchini fruit quality during cold storage. For this, we have selected two varieties of zucchini fruit with different chilling sensitivities, and after storage at 4
C we have measured and compared several nitrogen metabolites as well as enzymes involved in polyamine anabolism and catabolism.

0.5 g of exocarp was used for polyamine analysis. Extracts were prepared grinding the exocarp with 1.5 mL of 5% cold perchloric acid and 1,7-Diaminoheptane (60 nmol mL1) as internal standard, and incubated 24 h at 4
C. The homogenate was centrifuged (3000 g, 5 min at 4
C) and 0.2 mL from the supernatant was used to determine free polyamines. For soluble conjugated polyamines, 0.2 mL from supernatant was hydrolysed with 12 N HCl (1:1, v/v) at 110
C for 24 h in flame-sealed glass ampoules. The hydrolysates were filtered, dried, and resuspended in 0.2 mL of 5% cold perchloric acid. Both samples (free and conjugated polyamines) were mixed with 0.4 mL of dansyl chloride (fresh prepared in acetone, 10 mg/mL) and 0.2 mL of saturated sodium carbonate. After brief vortexing, the mixture was incubated in darkness overnight at room temperature. Excess of dansyl reagent was removed with 0.1 mL of proline (100 mg/mL) for 30 min at room temperature. Dansylpolyamines were extracted in 0.4 mL toluene. The organic phase was collected and evaporated to dryness under a stream of air, and dissolved in 0.1 mL acetonitrile. Polyamines were analyzed by HPLC using a HewlettePackard system equipped with a 4.6  250 mm C18 column. Solvent flow was 1.5 mL min1 and the elution gradient was prepared with eluent A (water) and eluent B (acetonitrile). The gradient profile was applied as follow (t (min); %A): (0; 30%), (4.5; 30%), (9; 0%), (14; 0%), (15; 30%). The final step was held for 2 min before regenerating the column. Detection was with a fluorometer using excitation and emission wavelengths of 415 and 510 nm, respectively, according to Flores and Galston (1982). A relative calibration procedure was used to determine the polyamines in the samples, using 1,7-Diaminoheptane (60 nmol mL1) as internal standard and polyamine concentrations ranging from 0 to 150 nmol mL1. Results were expressed as nmol g1 fresh weight.

2. Materials and methods

2.4. Glutamic acid and GABA content

2.1. Plant material and storage conditions

Exocarp tissue (0.25 g) was homogenized in 2.4 mL of cold ethanol/chloroform/water (12/5/1) and the homogenate was centrifuged at 4
C and 8000 g for 10 min. The supernatant was separated into aqueous and chloroform phases by the addition of chloroform (1.5 mL), 0.1 N HCl (0.15 mL) and water (0.3 mL) and incubated 24 h at 4
C. The aqueous phase was evaporated under a flow of nitrogen until dry, in order to measure the glutamic acid and GABA. Finally, dry residues were solubilized in 0.3 mL methanol and 1.2 mL of acetonitrile, and filtered through nylon filter (0.22 mm). An Acquity UPLC class system was used for solvent delivery and sample introduction. Samples were injected into a column (Acquity UPLC BEH C18 1.7 mm, 2.1  50 mm) and the column was eluted at a flow rate of 0.4 mL/min and developed with isocratic chromatographic conditions as follows: 25% A (water containing 0.01% formic acid and 0.05% ammonium) and 75% B (acetonitrile) with a run time of 2 min. Eluates were detected using a Xevo TQ-S triple quadrupole mass spectrometer (Waters) in the positive electrospray ionisation (ESI)

Zucchini fruit (Cucurbita pepo L. morphotype Zucchini) of the commercial varieties Natura (Enza Zaden), variety more tolerant to cold storage, and Sinatra (Clause-Tezier), variety more sensitive, were provided by E.H. FEMAGO S.A. After harvest, fruit were stored in chambers at 4
C and 20
C. Three replicates were prepared per variety (Natura and Sinatra), storage period (0, 7 and 14 days) and storage temperature (4
C and 20
C), each consisting in 18 fruit of similar size. After the storage period, weight loss and the chillinginjury index were determined in the whole fruit. For each replicate, the exocarp was separated, mixed and grinded in liquid nitrogen, and stored it at 80
C. RNA, metabolites and enzyme activities were performed in the exocarp. 2.2. Weight loss and chilling-injury index Loss of fresh weight was determined after 7 and 14 days of storage at 4
C and 20
C and the percentage of weight loss of each

2.3. Polyamine content

F. Palma et al. / Plant Physiology and Biochemistry 82 (2014) 161e171

mode. The ion spray voltage was set at 2500 V and the source temperature at 400
C. The glutamic acid and GABA were detected in the multiplereaction monitoring mode of the tandem mass spectrometer with the following transitions: glutamic acid, m/z 147.96 / 83.85 and 147.96 / 129.90; GABA, m/z 103.97 / 68.80 and 103.97 / 86.71. 2.5. Determination of ATP content Exocarp was ground in liquid nitrogen and homogenized with 5% (v/v) cold perchloric acid (1:2.4, w/v). The homogenate was centrifuged at 6000 g and 4
C during 10 min. The supernatant was neutralized to pH 6.5e6.8 with KOH and incubated 15 min at 4
C, and centrifuged at 6000 g during 10 min at 4
C. After centrifugation, the supernatant was filtered through 0.22 mm nylon filter. ATP was analyzed by HPLC using a HewlettePackard system equipped with a 4.6  150 mm C18 column. Column flow was 1.3 mL min1 and the elution gradient was prepared with eluent A (60 mM K2HPO4 and 40 mM KH2PO4 dissolved in Milli-Q water pH 7) and eluent B (acetonitrile). The linear gradient profile was applied as follow (t (min); %A): (0; 100%), (2; 95%), (4; 85%), (5; 75%), (7; 70%), (8; 100%). The final step was held for 2 min before regenerating the column. Detection was with a diode array at 260 nm. A relative calibration procedure was used to determine the ATP in the samples (0e10 mg mL1). 2.6. Proline content Proline was extracted using 0.5 g of sample (exocarp) and 4 mL of extraction medium (Ethanol:Chloroform:Water) and the homogenate was centrifuged at 4
C and 3500 g for 10 min (Irigoyen et al., 1992). The supernatant was separated into aqueous and chloroform phases by the addition of chloroform (5 mL) and water (3 mL). Proline was determined from the aqueous phase and quantified by means of a colorimetric reaction with ninhydrin reagent (Irigoyen et al., 1992). Standard curve was prepared with Lproline and results were expressed as mmol g1 fresh weight. 2.7. Free 1-aminocyclopropane-l-carboxylic acid (ACC) content Free ACC content of exocarp was assayed following the method of Lizada and Yang (1979). 0.5 g of exocarp was homogenized and extracted twice for 15 min at 65
C with 5 mL ethanol 80%. After centrifugation (3500 g, 30 min at 4
C), the supernatants were combined and evaporated to dryness. The resulting pellet was resuspended in 0.9 mL of water and then 0.9 mL of chloroform was added. 0.1 mL of 10 mM HgCl2 was added to 0.4 mL of the aqueous solution into reaction vials (12 mL). The vials were sealed and 0.1 mL of a cold mixture of 5% NaOCl-saturated NaOH (2:1) (v/v) was injected into the reaction vials. After incubation for 2.5 min on ice, 0.5 mL of a gas sample was analyzed for ethylene production in a gas chromatograph (Perkin Elmer 8600). Results were expressed as nmol (C2H4) g1 fresh weight. 2.8. Assays of ADC and ODC activities ADC and ODC activities were determined according to Birecka et al. (1985) with modifications. Extracts were prepared with 3 g of exocarp with 50 mM potassium phosphate buffer (pH 6.3) containing 5 mM EDTA, 0.1 mM phenylmethylsulfonyl fluoride (PMSF), 5 mM dithiothreitol (DTT), 20 mM ascorbic acid, 40 mM pyridoxal phosphate (PLP) and 0.1% polyvinylpyrrolidone (PVPP). The homogenate was centrifuged at 15,000 g for 20 min at 4
C and the supernatant was precipitated with ammonium sulphate at 100% saturation. The precipitated protein was then removed by

163

centrifugation (15,000 g for 15 min at 4
C) and the pellet was resuspended in 5 mL of 0.1 M Trizma-HCl buffer (pH 7.5) containing 5 mM EDTA, 5 -mM DTT and 40 mM PLP and dialyzed at 4
C. The dialyzed extract was used for both enzyme assays. The ADC and ODC reactions were performed with L-arginine (40 mM) and L-ornithine (40 mM), respectively. The reaction mixtures were incubated at 37
C for 2 h and stopped at 90
C for 5 min. Blanks consisted in the same reaction mixtures but directly stopped at 90
C at the start of the reaction. Finally, the mixtures were centrifuged at 14,000 g for 5 min and the supernatant was evaporated to dryness under a stream of air, and re-dissolved in 0.2 mL of 5% cold perchloric acid. Both activities were determined by analyzing the putrescine production by HPLC. HPLC conditions were the same as described in 2.3. Results were expressed as nmol putrescine g1 fresh weight h1. 2.9. Assays of DAO and PAO activities DAO and PAO activities were determined according to Su et al. (2005) with modifications. Extracts were prepared with 1.5 g of exocarp with 0.1 M sodium phosphate buffer (pH 6.5). The homogenate was centrifuged at 20,000 g for 20 min at 4
C and the supernatant was precipitated with ammonium sulphate at 100% saturation. The protein was then removed by centrifugation (15,000 g for 15 min at 4
C) and the pellet was resuspended in 3 mL of 0.1 M sodium phosphate buffer (pH 6.5) and dialyzed at 4
C. The dialyzed extract was used for both enzyme assays. The reaction mixture contained 4-aminoantipyrine/N,N-dimethylaniline solution, horseradish peroxidase and dialyzed extract. The reaction was initiated by addition of putrescine (20 mM) for DAO and spermidine/spermine (20 mM) for PAO determination, and this mixture was incubated at 40
C for 2 h. Change of 0.01 absorbance units in optical density at 555 nm was considered one unit of enzyme activity. Blanks contained reaction mixtures without polyamines. 2.10. Assays of GABA transaminase activity GABA-T activity was determined according to Ansari et al. (2005) with modifications. Extracts were prepared with 1 g of exocarp with 2 mL of 0.1 M Trizma-HCl buffer (pH 9.1) containing 5 mM EDTA, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM dithiothreitol (DTT), 10% (v/v) glycerol, 0.5 mM pyridoxal phosphate (PLP) and 0.1% polyvinylpyrrolidone (w/v) (PVPP). The homogenate was centrifuged at 10,000 g for 15 min at 4
C and the supernatant was filtered with Amicon Ultra centrifugal filters 10,000 MWCO (Millipore®). Finally it was resuspended in 1.5 mL of 50 mM Trizma-HCl buffer (pH 8.2) containing 0.75 mM EDTA, 1.5 mM dithiothreitol (DTT), 10% (v/v) glycerol, 0.2 mM pyridoxal phosphate (PLP) and used for enzyme assay. The GABA-T reaction was performed with 0.1 mL GABA (3 mM), 0.1 mL pyruvate (1 mM) and 0.3 mL extract. The reaction mixtures were incubated at 30
C for 2 h, and stopped with 0.1 mL HCl 1M. Blanks consisted in the whole extracts with 0.1 mL HCl 1M previous to incubation. The activity was determined analyzing the production of alanine by HPLC. For internal standard, norvaline (50 nmol mL1) was added. Derivatization reaction was performed according to Jia et al. (2011) with some modifications. Derivatization was done by adding 0.4 mL of dansyl chloride (fresh prepared in acetone, 10 mg/ mL) and 0.2 mL of saturated sodium carbonate. After brief vortexing, the mixture was incubated in darkness overnight at room temperature. Excess of dansyl reagent was removed with 0.1 mL of proline (100 mg/mL) during 30 min at room temperature. The solution was centrifuged at 10000 rpm for 3 min and filtered, and 20 mL was injected into. Dansyl-alanine was analyzed by HPLC using a

164

F. Palma et al. / Plant Physiology and Biochemistry 82 (2014) 161e171

HewlettePackard system equipped with a 4.6  250 mm C18 column. Solvent flow was 1 mL min1 and the elution gradient was prepared with eluent A (25 mM sodium acetate buffer pH 5.94 containing 3% (v/v) 1-propanol and 10% (v/v) acetonitrile) and eluent B (acetonitrile) (Minocha and Long, 2004). The linear gradient profile was applied as follow (t (min); %A): (0; 75%), (12; 0%), (17; 0%), (18; 75%). The final step was held for 2 min before regenerating the column. Detection was done with a fluorometer using excitation and emission wavelengths of 415 and 510 nm. A calibration procedure with a range of alanine from 0 to 120 nmol mL1 was used to determine the content of alanine in the samples. 2.11. Quantitative real-time PCR analysis RNA extraction and cDNA synthesis: Total RNA was extracted as reported in Verwoerd et al. (1989). Total RNA was treated with DNAse (Stratagene) to remove genomic DNA. First-strand cDNA was synthesised from 1 mg of RNA (DNA free) using Maxima Reverse Transcriptase (Thermo Scientific). Isolation and sequence analysis of CpADC1 (accession number KF880789): A partial sequence was obtained and sequenced from exocarp of Cucurbita fruit cDNA using the degenerated primers Fw: (GAYGGNTGGGGNGCNCCNTAYTTC) and Rev: (AACATNARYTCNGGYTCRTGYTGCAT), designed by homology with other ADC when analyzed with Nucleotide Blast (http://blast.ncbi.nlm.nih. gov/Blast.cgi). Isolation and synthesis of CpODC1 (accession number KF880790): A partial sequence was obtained and sequenced from exocarp of Cucurbita fruit cDNA using the primers FW: GTCTCACCTGACCGAATCGT Rev: TGACCCATAAATCCCATCGT designed based on the ODC sequence from Cucumis sativus (accession number XP_004143074). Quantitative RT-PCR: Quantitative real-time PCR was performed on an iCycler iQ5 (Bio-Rad, Hercules, CA, USA), using iQ SyBrGreen Supermix (BioRad). We used cDNA synthetised as described above. A pair of CpADC1 specific primers (Fw:ACTCCTGGCAATGAGCTGTT; Rv:ATCACAGGGCGAACAAAGAG) and of CpODC1 (Fw:TCATATTGGAAGTGGGGATG; Rv:TTCATAGGCGGAAGGGCAAG) were designed with the software Primer3 (http://bioinfo.ebc.ee/ mprimer3). Samples were initially denatured by heating at 95
C for 3 min followed by a 35-cycle amplification and quantification program (95
C for 30 s, 58
C for 45 s, and 72
C for 45 s). A melting curve was conducted to ensure amplification of a single product. The efficiency for each primer pair was determined by running 10fold serial dilutions (4 dilution series) and generating a standard curve by plotting the log of the dilution factor against the CT value during amplification of each dilution. The gene that codifies for the elongation factor-1a (EF-1A) (Obrero et al., 2011) was used as a constituently expressed gene to compensate for differences in the concentration of template that may have occurred in each replicate. The transcription profiles were normalized to the reference gene elongation factor-1a (EF-1A) using the 2DDCT method Livak and Schmittgen (2001).

2.12. Statistical analysis Data were subjected to an analysis of variance (ANOVA) using the Statgraphics®Plus 5.1 software (Statistical Graphics Corp., Rockville, MD, USA). Means were compared by Fisher's least significant difference test (LSD) and differences at p < 0.05 were considered significant. 3. Results 3.1. Changes in weight loss and chilling-injury index in zucchini fruit during postharvest storage When fruit of Natura and Sinatra were kept at 4
C, after 7 and 14 days, a significantly greater weight loss was recorded in Sinatra than in Natura (Table 1). A similar result was found for the chillinginjury index (Table 1), where Natura registered lower values even after 14 days of storage, a mean of 0.67 and 1.72 at days 7 and 14, respectively, while Sinatra reached an index of almost 3, the maximum, after 7 days of storage at 4
C. Both varieties showed a greater weight loss when they were stored at 20
C, reaching levels of around 10%. 3.2. Changes in polyamines content in zucchini fruit during postharvest storage Free putrescine levels increased in the exocarp of both varieties during storage at 4
C (Fig. 1), about 45% and 2-fold after of 7 and 14 days, respectively, in Natura fruit, whereas the fruit of Sinatra showed a more dramatic increase, about 4- and 5-fold after 7 and 14 days, respectively. Conjugated-soluble putrescine also increased in both varieties when fruit was kept at 4
C (Fig. 2), although the content was lower than that of free putrescine. On the contrary, during storage at 20
C, free putrescine levels diminished with storage time in both varieties (Fig. 1), and conjugated-soluble putrescine did not significantly change (Fig. 2). In general, during storage at 4
C and 20
C, free spermidine and spermine levels decreased in the exocarp of Natura and Sinatra fruit (Fig. 1), whereas when these polyamines were in conjugated-soluble form the levels rose or did not significantly change during postharvest storage (4 or 20
C) in both varieties (Fig. 2). 3.3. Changes in synthesis and catabolism of polyamines in zucchini fruit during cold storage Arginine decarboxylase (ADC) and ornithine decarboxylase (ODC) are enzymes that synthesize putrescine. ADC activity increased in the exocarp of Natura and Sinatra fruit at 7 days of cold storage, whereas after 14 days of storage this activity decreased in both varieties below the levels found at harvest (Fig. 3). ODC activity rose dramatically in the sensitive variety (about 20-fold) during storage at 4
C, whereas in the more tolerant variety the

Table 1 Changes in percentage of weight loss and chilling injury index in zucchini fruit stored at 4
C and 20
C. Weight loss (%) Temperature

Variety

After 7 days

4
C

Natura Sinatra Natura Sinatra

3.46 5.62 3.66 7.97

20
C

± ± ± ±

0.28bB 0.41bA 0.30bB 0.58bA

Chilling injury index After 14 days 6.50 9.38 9.81 10.61

± ± ± ±

0.45aB 0.38aA 0.68aA 0.43aA

After 7 days

After 14 days

0.67 ± 0.18bB 2.81 ± 0.09aA e e

1.72 ± 0.27aB 2.82 ± 0.10aA e e

Values are means of 18 fruits ± SE. Different capital letters indicate significant differences among varieties (p < 0.05). Different lower case letters indicate significant differences among storage time (p < 0.05).

F. Palma et al. / Plant Physiology and Biochemistry 82 (2014) 161e171

165

Fig. 1. Content of free polyamines in the exocarp of zucchini fruit stored at 4
C and 20
C. Values are means ± SE of three replicates biological. Different capital letters indicate significant differences among varieties (p < 0.05). Different lower case letters indicate significant differences among storage time (p < 0.05).

values did not significantly change after 7 days and only slightly increased after 14 days (45%) of storage at 4
C (Fig. 3). ADC and ODC expression was induced in both varieties during low-temperature storage at (Fig. 4). ADC expression increased about 3- and 5-fold in Natura fruit during storage at 4
C after of 7 and 14 days, respectively, and in Sinatra fruit was about 3- and 4fold. In the exocarp of Natura fruit ODC expression was induced around 35% during cold storage. When the Sinatra fruit was stored at low temperatures, the expression of this gene increased remarkably, reaching levels of 10-fold higher than at harvest. Diamine oxidase (DAO) and polyamine oxidase (PAO) are enzymes that catalyze the degradation of polyamines. The exocarp of Natura fruit exhibited a significant increase in DAO activity after of 14 days at 4
C, whereas in Sinatra this activity diminished about 30% during storage at 4
C (Fig. 3). In both varieties, PAO activity

was not detected at harvest, but increased when the zucchini fruit were kept at 4
C. It is noteworthy that this enzyme activity increased dramatically in the Sinatra fruit, i.e. by 3- and 12-fold after of 7 and 14 days respectively. 3.4. Changes in glutamic acid, GABA content, and GABA transaminase activity in zucchini fruit during cold storage In general, when Natura and Sinatra fruit were kept at 4
C, the content in glutamic acid increased in both varieties (Fig. 5). In fact, after 14 days of cold storage a rise of about 25% and 60% was registered in the exocarp of Natura and Sinatra fruit, respectively. By contrast, GABA levels decreased in both varieties, i.e. about 70% in Natura fruit and 35% in Sinatra fruit at 7 and 14 days (Fig. 5). GABA-T activity increased in the exocarp of both varieties after of 14

166

F. Palma et al. / Plant Physiology and Biochemistry 82 (2014) 161e171

Fig. 2. Content of conjugated-soluble polyamines in the exocarp of zucchini fruit stored at 4
C and 20
C. Values are means ± SE of three replicates biological. Different capital letters indicate significant differences among varieties (p < 0.05). Different lower case letters indicate significant differences among storage time (p < 0.05).

days of storage at 4
C (Fig. 5), about 2.1-fold in Natura fruit, whereas Sinatra fruit showed a lower increase (about 30%).

fruit by about 2-fold during storage at 4
C after 7 and 14 days, whereas in Natura, the content in free ACC did not significantly change.

3.5. Changes in ATP, proline and ACC content in zucchini fruit during cold storage

4. Discussion

In general, the amount of ATP decreased during cold storage in zucchini fruit (Fig. 6), except for Natura fruit after 14 days of storage at 4
C, in which no significant changes were detected respect to fruit at harvest time. Our results showed an increase of proline content in both varieties during storage at 4
C (Fig. 7). The proline concentration increased in the exocarp of Natura and Sinatra fruit by about 15% at 4
C after of 7 days, and after 14 days values reached 2.2-fold and 50% in Natura and Sinatra fruit, respectively. Fig. 7 shows that the free ACC content raised in the exocarp of Sinatra

In this work we have analyzed fruit of two zucchini varieties with different responses to cold storage: Natura, more tolerant to cold storage; and Sinatra, more sensitive (Carvajal et al., 2011). During storage at 4
C, Sinatra fruit showed more weight loss and a higher chilling-injury index than Natura (Table 1), thus confirming previous results of our laboratory (Carvajal et al., 2011). In both varieties and at two storage temperatures (20
C and 4
C), the zucchini fruit lost weight through time, the greatest losses measured in fruit stored at 20
C, probably because at this

F. Palma et al. / Plant Physiology and Biochemistry 82 (2014) 161e171

167

Fig. 3. Effect of chilling on the activities arginine decarboxylase (ADC), ornithine decarboxylase (ODC), diamine oxidase (DAO) and polyamine oxidase (PAO) in the exocarp of zucchini fruit stored at 4
C. Values are means ± SE of three replicates biological. Different capital letters indicate significant differences among varieties (p < 0.05). Different lower case letters indicate significant differences among storage time (p < 0.05).

temperature all the metabolic pathways were still active and there was a higher respiration rate, as happens in citrus fruit at 12
C (Holland et al., 2002). Free putrescine levels increased in the exocarp of both varieties during storage at 4
C, although in Sinatra fruit this rise was more pronounced. By contrast, during storage at 20
C the free putrescine diminished with storage time in both varieties (Fig. 1). This behavior suggests that putrescine is accumulated after harvest only in response to cold stress in zucchini fruit, and not due to the postharvest storage itself. Furthermore, during storage at 4
C the

fruit of the chilling-sensitive variety Sinatra showed higher levels of free putrescine than the chilling-tolerant variety. According to these results, we conclude that the increase in putrescine observed during cold storage is due to the stress condition triggered by cold storage and not a mechanism of protection. Alternatively, in Natura fruit the lower levels of putrescine could be due to the use of putrescine as a substrate for the synthesis of other metabolites associated with cold tolerance. These results are consistent with those observed in grapefruit, pepper, and lemon, in which fruit stored at chilling temperatures registered higher levels of putrescine

Fig. 4. Real-time PCR analysis of the expression (in terms of fold change) of arginine decarboxylase (ADC) and ornithine decarboxylase (ODC) as compared to at harvest in the exocarp of zucchini fruit stored at 4
C. The ADC and ODC transcript levels were normalized to the expression of EF-1a measured in the same samples. Values are means ± SE of three replicates biological. Different capital letters indicate significant differences among varieties (p < 0.05). Different lower case letters indicate significant differences among storage time (p < 0.05).

168

F. Palma et al. / Plant Physiology and Biochemistry 82 (2014) 161e171

Fig. 5. Effect of chilling on the glutamic acid and GABA content, and GABA transaminase activity (GABA-T) in the exocarp of zucchini fruit stored at 4
C. Values are means ± SE of three replicates biological. Different capital letters indicate significant differences among varieties (p < 0.05). Different lower case letters indicate significant differences among storage time (p < 0.05).

(McDonald and Kushad, 1986). Moreover, McDonald and Kushad (1986) reported a significant correlation between the rise in putrescine concentration and the severity of chilling injures in lemons, grapefruits and peppers, and proposed that the accumulation of putrescine in the chilled tissues could be a consequence of

Fig. 6. Effect of chilling on the ATP content in the exocarp of zucchini fruit stored at 4
C. Values are means ± SE of three replicates biological. Different capital letters indicate significant differences among varieties (p < 0.05). Different lower case letters indicate significant differences among storage time (p < 0.05).

stress-induced injury. Also in the literature, the importance of putrescine in relation to the chilling response is proposed for its role in modulating the levels of other compounds such as abscisic acid or GABA (Shelp et al., 2012a; Alcazar et al., 2010; Cuevas et al., 2008), since putrescine is a precursor of GABA synthesis. In zucchini fruit pretreated with CO2 and chilled, less chilling injury was observed concomitantly with lower levels of putrescine, which were higher without the CO2 pretreatment (Serrano et al., 1998). All these results suggest that the increase in putrescine is more a result of a cold-induced stress rather than a protection mechanism itself. In our experiments, we have detected an increment in PAO activity after cold storage in both varieties (Fig. 3) that could indicate synthesis of putrescine from spermidine and spermine by PAO back conversion, supported by the lower levels of these polyamines and the increase in putrescine measured (Fig. 1). There is no previous information regarding polyamine oxidation pathways in zucchini plants. Besides, the increase in PAO activity and the decrease in free spermidine and spermine could also be due to conjugation; in fact, Fig. 2 shows an increase in soluble conjugated spermidine and spermine in both varieties and at both storage temperatures. In Natura and Sinatra fruit, the soluble conjugated putrescine only increased during storage at 4
C and did not significantly change at 20
C (Fig. 2). Because putrescine is the only polyamine whose levels increase in response to low temperature, we have studied the enzymes related to its synthesis and degradation, and the regulation of ADC and ODC gene expression. The role played by the two enzymes (ADC and ODC) depends on the plant species and on the type of stress. Generally, ADC is considered to be the enzyme regulated by stress in most of the cases studied, and only in a few reports ODC is

F. Palma et al. / Plant Physiology and Biochemistry 82 (2014) 161e171

169

Fig. 7. Effect of chilling on the content of free proline and free 1-aminocyclopropane-1-carboxylic acid (ACC) in the exocarp of zucchini fruit stored at 4
C. Values are means ± SE of three replicates biological. Different capital letters indicate significant differences among varieties (p < 0.05). Different lower case letters indicate significant differences among storage time (p < 0.05).

considered to be the regulating enzyme (Alcazar et al., 2006; Galston, 1983; Lee et al., 1997). However, Kramer and Wang (Kramer and Wang, 1990) showed a higher ODC but not ADC activity during chill-induced putrescine accumulation in zucchini fruit. In our experiment, ADC activity increased when zucchini fruit was kept at 4
C during 7 days, whereas after 14 days this activity decreased in the exocarp of both varieties (Fig. 3). On the other hand, during postharvest at 4
C, ODC activity remarkably increased in the sensitive variety Sinatra, whereas in the tolerant variety Natura the activity did not significantly change after 7 days, with only a slight increase after 14 days (Fig. 3). According to these results ADC activity responds quickly to chilling and its increase is temporary, whereas ODC activity operates when the stress is relatively severe, as is the case for Sinatra fruit. This regulation of ODC activity was confirmed by the results of its expression level (Fig. 4), which was extremely high in fruit of Sinatra kept at 4
C. Exocarp tissues of both varieties showed a very similar induction of ADC transcription after 7 and 14 days at 4
C. Cuevas et al. (2008) reported that the expression of ADC genes increased in Arabidopsis plants under cold treatment, resulting in an increase of putrescine content during the intermediate phase of cold response, but ODC is not present in Arabidopsis. In response to chilling stress, transcripts for ADC and ODC were found to be both up-regulated in tomato fruit (Zhang et al., 2013). However, we found that ADC activity after 14 days of storage at 4
C was lower than newly harvested control fruit. This decrease indicates that in zucchini fruit ADC appears to undergo post-transcriptional inhibition after 14 days of storage at 4
C, and at this point ODC activity would take over during severe stress. With respect to polyamine degradation, DAO and PAO play important roles in a wide spectrum of physiological processes such as germination, root development, flowering, and senescence, and in defense responses against abiotic and biotic stress conditions (Wimalasekera et al., 2011). The activity of DAO, an enzyme that catalyzes putrescine degradation, showed an antagonistic response in the two varieties during storage at 4
C. In Natura fruit, DAO activity significantly increased after 14 days of storage at 4
C, whereas in Sinatra fruit this activity declined (Fig. 3). This enzyme catabolizes putrescine, and the products deriving from their action have been demonstrated to be involved in responses to abiotic stresses (Shelp et al., 2012a; Bouchereau et al., 1999). We suggest that in Natura, putrescine degradation may contribute to the cold stress adaptation of the fruit. On the other hand, PAO activity was not detected at harvest in any of the varieties, but increased after storage at 4
C in Natura and Sinatra fruit, with a sharp peak of

activity at 14 days in Sinatra fruit (Fig. 3). Under salt stress, several PAO genes of Arabidopsis are induced (Cona et al., 2006). In tomato leaf discs a stimulation of DAO and PAO activities was reported concomitant with an accumulation of proline (Aziz et al., 1998), and in soybean leaves under salinity, higher proline levels and DAO activity correlated with the putrescine degradation (Su and Bai, 2008). In addition, in these studies inhibitors of DAO were shown to inhibit the accumulation of proline (Aziz et al., 1998). Our results showed a higher proline content in both varieties during storage at 4
C (Fig. 7). A relation between the increase of proline in fruit and the improvement of tolerance to cold stress has been reported (Cao et al., 2012; Shang et al., 2011), and our results are in concordance with those reported, since a higher accumulation of proline in the chilling-tolerant variety is detected after 14 days at 4
C (Fig. 7). As described above, polyamines and ethylene have a common intermediary, Sadenosylmethionine, a substrate for the ACC synthase. In cucumber seedlings exposed to chilling temperatures, the levels of ACC and ethylene production showed sharp increases in fruit after exposure to chilling (Wang, 1987). In the exocarp of Sinatra fruit, the free ACC content increased during storage at 4
C, whereas in Natura did not significantly change. In relation to this, in cucumber the ACC content increased during storage at 20, 10 and 1
C, but only at 1
C a sharp accumulation of ACC found (MartínezRomero et al., 2003). In our case, ACC increases in fruit after severe cold stress, so we suggest that this compound could be used as an indicator of stress in zucchini during cold storage. Plants accumulate high levels of GABA in response to different types of environmental stresses. GABA metabolism is involved in different regulatory processes, including osmotic or pH regulation, bypass of the tricarboxylic acid cycle, and maintenance of C:N balance (Akcay et al., 2012). GABA is directly derived from glutamate, or indirectly from putrescine via a combination of DAO and aminobutyraldehyde dehydrogenase activities (Shelp et al., 2012c). Finally, GABA is metabolized mainly via a short pathway called the GABA shunt in which the activities of three enzymes produce succinic acid (Bouche and Fromm, 2004; Fait et al., 2008; Trobacher et al., 2013), although it bypasses two steps of the Krebs cycle, it ensures the recycling of C and N, and the production of reducing agents and energy. Our results show that glutamic acid accumulated in Natura and Sinatra during storage at 4
C. By contrast, GABA content decreased in both varieties (Fig. 5). In cherimoya fruit during lowtemperature storage, GABA levels rose in CO2-treated fruit, which were more tolerant to chilling than untreated fruit, and sharply decreased after transferring the fruit to air (Merodio et al.,

170

F. Palma et al. / Plant Physiology and Biochemistry 82 (2014) 161e171

1998). According to our results, we suggest that in both varieties the GABA shunt pathway was induced during cold storage, probably for the porpoise of using GABA as C and N sources. Moreover, this short pathway produces reducing agents, which could help to alleviate the oxidative stress generated during low-temperature storage and energy. Some works report the induction of the GABA shunt associated with biotic and abiotic stress responses, and other cellular processes (Fait et al., 2008; Allan et al., 2009; Simpson et al., 2010). Several types of stresses, such as salinity, drought and cold, have been reported to elevate the levels of GABA (Allan et al., 2008). It is noteworthy that the reduction of GABA content was more drastic in Natura than in Sinatra fruit, leading us to hypothesize that the GABA catabolism (GABA shunt pathway) could contribute to chilling adaptation in zucchini fruit by producing reducing agents and energy, that could be used to alleviate the oxidative damage induced by chilling. This hypothesis is supported by the results presented in Figs. 5 and 6, where it is shown that the activity of GABA transaminase, the main enzyme of the GABA shunt pathway, increased during cold storage in both varieties; however, it was higher in the tolerant variety Natura. Also during cold storage, ATP content is drastically reduced in the sensitive variety, whereas in the tolerant variety, after 14 days of storage at 4
C, no significant changes were observed respect to the fruit at harvest. In conclusion, putrescine is accumulated in response to low temperature and its increase correlates with chilling damage in zucchini fruit, since the major accumulation takes place in the more sensitive variety Sinatra, due mainly to ODC activity. We suggest that putrescine degradation by diamine oxidase, proline accumulation, and GABA catabolism could be involved in the alleviation of chilling injury, and in the maintenance of zucchini fruit quality during cold storage. Acknowledgments
n y This research has been funded by the Ministerio de Educacio Ciencia (Project AGL2011-30568-C02-01). We are grateful to E.H.
tima Carvajal Moreno FEMAGO S.A. for the supply of the fruits. Fa
n, was supported with a grant FPU, from Ministerio de Educacio ~ oz Dorado and Pe
rez Torres for the supSpain. We thank Drs Mun port with the RT-PCR analysis. Author contribution The work presented here was carried out in collaboration between all authors. DG defined the research theme. FP and FC performed the experiments. FP carried out the research work. DG and MJ revised the document. All authors contributed to improving the paper and approved the final manuscript. References Akcay, N., Bor, M., Karabudak, T., Ozdemir, F., Turkan, I., 2012. Contribution of gamma amino butyric acid (GABA) to salt stress responses of Nicotiana sylvestris CMSII mutant and wild type plants. J. Plant Physiol. 169, 452e458. Alcazar, R., Marco, F., Cuevas, J.C., Patron, M., Ferrando, A., Carrasco, P., Tiburcio, A.F., Altabella, T., 2006. Involvement of polyamines in plant response to abiotic stress. Biotechnol. Lett. 28, 1867e1876. Alcazar, R., Altabella, T., Marco, F., Bortolotti, C., Reymond, M., Koncz, C., Carrasco, P., Tiburcio, A.F., 2010. Polyamines: molecules with regulatory functions in plant abiotic stress tolerance. Planta 231, 1237e1249. Allan, W.L., Simpson, J.P., Clark, S.M., Shelp, B.J., 2008. gamma-hydroxybutyrate accumulation in Arabidopsis and tobacco plants is a general response to abiotic stress: putative regulation by redox balance and glyoxylate reductase isoforms. J. Exp. Bot. 59, 2555e2564. Allan, W.L., Clark, S.M., Hoover, G.J., Shelp, B.J., 2009. Role of plant glyoxylate reductases during stress: a hypothesis. Biochem. J. 423, 15e22. Anderson, M.D., Prasad, T.K., Martin, B.A., Stewart, C.R., 1994. Differential gene expression in chilling-acclimated maize seedlings and evidence for the involvement of abscisic acid in chilling tolerance. Plant Physiol. 105, 331e339.

Ansari, M.I., Lee, R.H., Chen, S.C.G., 2005. A novel senescence-associated gene encoding gamma-aminobutyric acid (GABA): pyruvate transaminase is upregulated during rice leaf senescence, Physiol. Plantarum 123, 1e8. Aziz, A., Martin-Tanguy, J., Larher, F., 1998. Stress-induced changes in polyamine and tyramine levels can regulate proline accumulation in tomato leaf discs treated with sodium chloride. Physiol. Plant. 104, 195e202. Birecka, H., Bitonti, A.J., McCann, P.P., 1985. Assaying ornithine and arginine decarboxylases in some plant-species. Plant Physiol. 79, 509e514. Bouche, N., Fromm, H., 2004. GABA in plants: just a metabolite? Trends Plant Sci. 9, 110e115. Bouchereau, A., Aziz, A., Larher, F., Martin-Tanguy, J., 1999. Polyamines and environmental challenges: recent development. Plant Sci. 140, 103e125. Cantoni, G.L., 1975. Biological methylation: selected aspects. Ann. Rev. Biochem. 44, 435e451. Cao, S., Cai, Y., Yang, Z., Zheng, Y., 2012. MeJA induces chilling tolerance in loquat fruit by regulating proline and gamma-aminobutyric acid contents. Food Chem. 133, 1466e1470. Carvajal, F., Martínez, C., Jamilena, M., Garrido, D., 2011. Differential response of zucchini varieties to low storage temperature. Sci. Hortic. 130, 90e96. Cona, A., Rea, G., Angelini, R., Federico, R., Tavladoraki, P., 2006. Functions of amine oxidases in plant development and defence. Trends Plant Sci. 11, 80e88. Cuevas, J.C., Lopez-Cobollo, R., Alcazar, R., Zarza, X., Koncz, C., Altabella, T., Salinas, J., Tiburcio, A.F., Ferrando, A., 2008. Putrescine is involved in Arabidopsis freezing tolerance and cold acclimation by regulating abscisic acid levels in response to low temperature. Plant Physiol. 148, 1094e1105. Fait, A., Fromm, H., Walter, D., Galili, G., Fernie, A.R., 2008. Highway or byway: the metabolic role of the GABA shunt in plants. Trends Plant Sci. 13, 14e19. Flores, H.E., Galston, A.W., 1982. Analysis of polyamines in higher plants by high performance liquid chromatography. Plant Physiol. 69, 701e706. Galston, A.W., 1983. Polyamines as modulators of plant development. Bioscience 33, 382e388. Groppa, M.D., Benavides, M.P., 2008. Polyamines and abiotic stress: recent advances. Amino Acids 34, 35e45. Holland, N., Menezes, H.C., Lafuente, M.T., 2002. Carbohydrates as related to the heat-induced chilling tolerance and respiratory rate of 'Fortune' mandarin fruit harvested at different maturity stages. Postharvest Biol. Tec. 25, 181e191.
nchez-Díaz, M., 1992. Water stress induced changes Irigoyen, J.J., Emerich, D.W., Sa in concentrations of proline and total soluble sugars in nodulated alfalfa (Medicago sativa) plants. Physiol. Plant. 84, 55e60. Jia, S., Kang, Y.P., Park, J.H., Lee, J., Kwon, S.W., 2011. Simultaneous determination of 23 amino acids and 7 biogenic amines in fermented food samples by liquid chromatography/quadrupole time-of-flight mass spectrometry. J. Chromatogr. A 1218, 9174e9182. Kramer, G.F., Wang, C.Y., 1990. Effects of chilling and temperature preconditioning on the activity of polyamine biosynthetic-enzymes in zucchini squash. J. Plant Physiol. 136, 115e119. Kusano, T., Berberich, T., Tateda, C., Takahashi, Y., 2008. Polyamines: essential factors for growth and survival. Planta 228, 367e381. Lee, T.M., Lur, H.S., Chu, C., 1997. Role of abscisic acid in chilling tolerance of rice (Oryza sativa L) seedlings .2. Modulation of free polyamine levels. Plant Sci. 126, 1e10. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 -DDCT method. Methods 25, 402e408. Lizada, M.C.C., Yang, S.F., 1979. Simple and sensitive assay for 1-aminocyclopropane1-carboxylic acid. Anal. Biochem. 100, 140e145. Martínez-Romero, D., Serrano, M., Valero, D., 2003. Physiological changes in pepino (Solanum muricatum Ait.) fruit stored at chilling and non-chilling temperatures. Postharvest Biol. Tec. 30, 177e186.
llez, M.A., Ramos-Clamont, M.G., Gardea, A.A., Vargas-Arispuro, I., 2002. Martínez-Te Effect of infiltrated polyamines on polygalacturonase activity and chilling injury responses in zucchini squash (Cucurbita pepo L.). Biochem. Bioph. Res. Co. 295, 98e101. McDonald, R.E., Kushad, M.M., 1986. Accumulation of putrescine during chilling injury of fruits. Plant Physiol. 82, 324e326. Merodio, C., Munoz, M.T., Del Cura, B., Buitrago, D., Escribano, M.I., 1998. Effect of high CO2 level on the titres of gamma-aminobutyric acid, total polyamines and some pathogenesis-related proteins in cherimoya fruit stored at low temperature. J. Exp. Bot. 49, 1339e1347. Minocha, R., Long, S., 2004. Simultaneous separation and quantitation of amino acids and polyamines of forest tree tissues and cell cultures within a single high-performance liquid chromatography run using dansyl derivatization. J. Chromatogr. A 1035, 63e73. Moschou, P.N., Delis, I.D., Paschalidis, K.A., Roubelakis-Angelakis, K.A., 2008. Transgenic tobacco plants overexpressing polyamine oxidase are not able to cope with oxidative burst generated by abiotic factors. Physiol. Plant. 133, 140e156. Moschou, P.N., Paschalidis, K.A., Roubelakis-Angelakis, K.A., 2008. Plant polyamine catabolism: the state of the art. Plant Signal. Behav. 3, 1061e1066. ~ oz, T., Ruiz-Cabello, J., Molina-Garcia, A.D., Escribano, M.I., Merodio, C., 2001. Mun Chilling temperature storage changes the inorganic phosphate pool distribution in cherimoya (Annona cherimola) fruit. J. Am. Soc. Hortic. Sci. 126, 122e127.
Die, J.V., Roma
n, B., Go
mez, P., Nadal, S., Gonza
lez-Verdejo, C.I., 2011. Obrero, A., Selection of reference genes for gene expression studies in zucchini (Cucurbita pepo) using qPCR. J. Agr. Food Chem. 59, 5402e5411.

F. Palma et al. / Plant Physiology and Biochemistry 82 (2014) 161e171 Palma, F., Carvajal, F., Lluch, C., Jamilena, M., Garrido, D., 2014. Changes in carbohydrate content in zucchini fruit (Cucurbita pepo L.) under low temperature stress. Plant Sci. 217e218, 78e86. Serrano, M., Pretel, M.T., Martinez-Madrid, M.C., Romojaro, F., Riquelme, F., 1998. CO2 treatment of zucchini squash reduces chilling-induced physiological changes. J. Agr. Food Chem. 46, 2465e2468. Shang, H., Cao, S., Yang, Z., Cai, Y., Zheng, Y., 2011. Effect of exogenous gamma-aminobutyric acid treatment on proline accumulation and chilling injury in peach fruit after long-term cold storage. J. Agr. Food Chem. 59, 1264e1268. Shelp, B.J., Bozzo, G.G., Trobacher, C.P., Zarei, A., Deyman, K.L., Brikis, C.J., 2012. Hypothesis/review: contribution of putrescine to 4-aminobutyrate (GABA) production in response to abiotic stress. Plant Sci. 193, 130e135. Shelp, B.J., Bozzo, G.G., Trobacher, C.P., Chiu, G., Bajwa, V.S., 2012. Strategies and tools for studying the metabolism and function of Y-aminobutyrate in plants. I. Pathway structure. Botany 90, 651e668. Shelp, B.J., Bozzo, G.G., Zarei, A., Simpson, J.P., Trobacher, C.P., Allan, W.L., 2012. Strategies and tools for studying the metabolism and function of gammaaminobutyrate in plants. II. Integrated analysis. Botany 90, 781e793. Simpson, J.P., Clark, S.M., Portt, A., Allan, W.L., Makhmoudova, A., Rochon, A., Shelp, B.J., 2010. gamma-Aminobutyrate transaminase limits the catabolism of gamma-aminobutyrate in cold-stressed Arabidopsis plants: insights from an overexpression mutant. Botany-Botanique 88, 522e527. Su, G.X., Bai, X., 2008. Contribution of putrescine degradation to proline accumulation in soybean leaves under salinity. Biol. Plant. 52, 796e799.

171

Su, G.X., An, Z.F., Zhang, W.H., Liu, Y.L., 2005. Light promotes the synthesis of lignin through the production of H2O2 mediated by diamine oxidases in soybean hypocotyls. J. Plant Physiol. 162, 1297e1303. Tiburcio, A.F., Altabella, T., Borrell, A., Masgrau, C., 1997. Polyamine metabolism and its regulation. Physiol. Plant. 100, 664e674. Trobacher, C.P., Clark, S.M., Bozzo, G.G., Mullen, R.T., DeEll, J.R., Shelp, B.J., 2013. Catabolism of GABA in apple fruit: subcellular localization and biochemical characterization of two gamma-aminobutyrate transarninases. Postharvest Biol. Tec. 75, 106e113. Verwoerd, T.C., Dekker, B.M.M., Hoekema, A., 1989. A small-scale procedure for the rapid isolation of plant RNAs. Nucleic Acids Res. 17, 2362. Wang, C.Y., 1987. Changes of polyamines and ethylene in cucumber seedlings in response to chilling stress. Physiol. Plant. 69, 253e257. Wang, C.Y., 2010. Alleviation of chilling injury in tropical and subtropical fruits. Acta Hortic. 864, 267e274. Wimalasekera, R., Tebartz, F., Scherer, G.F.E., 2011. Polyamines, polyamine oxidases and nitric oxide in development, abiotic and biotic stresses. Plant Sci. 181, 593e603. Zhang, W., Jiang, B., Li, W., Song, H., Yu, Y., Chen, J., 2009. Polyamines enhance chilling tolerance of cucumber (Cucumis sativus L.) through modulating antioxidative system. Sci. Hortic. 122, 200e208. Zhang, X., Shen, L., Li, F., Meng, D., Sheng, J., 2013. Hot air treatment-induced arginine catabolism is associated with elevated polyamines and proline levels and alleviates chilling injury in postharvest tomato fruit. J. Sci. Food Agr. 93, 3245e3251.