Journal of Hazardous Materials 294 (2015) 99–108
Contents lists available at ScienceDirect
Journal of Hazardous Materials journal homepage: www.elsevier.com/locate/jhazmat
Copper-induced hydrogen peroxide upregulation of a metallothionein gene, OsMT2c, from Oryza sativa L. confers copper tolerance in Arabidopsis thaliana Jia Liu a , Xiaoting Shi a , Meng Qian a , Luqing Zheng a , Chunlan Lian b , Yan Xia a,∗ , Zhenguo Shen a,∗ a b
College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, People’s Republic of China Asian Natural Environmental Science Center, The University of Tokyo, Tokyo 188-0002, Japan
h i g h l i g h t s • OsMT2c expression is up-regulated by Cu and H2 O2 . • H2 O2 is required for the activation of OsMT2c in the rice response to Cu stress. • Transgenic Arabidopsis overexpressing OsMT2c accumulates less H2 O2 in leaves under abiotic stress.
a r t i c l e
i n f o
Article history: Received 19 November 2014 Received in revised form 20 March 2015 Accepted 27 March 2015 Available online 30 March 2015 Keywords: Copper stress Hydrogen peroxide ROS scavenging Transgenic Arabidopsis
a b s t r a c t Metallothioneins (MTs) are low-molecular-weight, cysteine-rich metal-binding proteins found in numerous genera and species, but their functions in abiotic stress tolerance remain unclear. Here, a MT gene from Oryza sativa, OsMT2c, was isolated and characterized, encoding a type 2 MT, and observed expression in the roots, leaf sheathes, and leaves, but only weak expression in seeds. OsMT2c was upregulated by copper (Cu) and hydrogen peroxide (H2 O2 ) treatments. Excessive Cu elicited a rapid and sustained production and release of H2 O2 in rice, and exogenous H2 O2 scavengers N,N -dimethylthiourea (DMTU) and ascorbic acid (Asc) decreased H2 O2 production and OsMT2c expression. Furthermore, the expression of OsMT2c increased in the osapx2 mutant in which the H2 O2 levels were higher than in wild-type (WT) plants. These results showed that Cu increased MT2c expression through the production and accumulation of Cu-induced H2 O2 in O. sativa. In addition, the transgenic OsMT2c-overexpressing Arabidopsis displayed improved tolerance to Cu stress and exhibited increased reactive oxygen species (ROS) scavenging ability compared to WT and empty-vector (Ev) seedlings. © 2015 Published by Elsevier B.V.
1. Introduction Copper as an essential micronutrient can be extremely toxic to plants when the accumulation is slightly higher than its optimal level. Cu becomes toxic to the cell due to interference with func-
Abbreviations: APX, ascorbate peroxidase; Asc, ascorbic acid; CaMV 35s, cauliflower mosaic virus 35S; Cu, copper; Cys, cysteine; DAB, 3,3 diamninobenzidine; DMTU, N,N -dimethylthiourea; Ev, empty-vector; GFP, green fluorescent protein; GUS, glucuronidase; H2 O2 , hydrogen peroxide; MTs, metallothioneins; 4-MUG, 4-methylumbelliferyl-ˇ-d-glucuronide; MV, methyl viologen; NADPH, nicotinamide adenine dinucleotide phosphate; RT-PCR, reverse transcription polymerase chain reaction; ROS, reactive oxygen species; WT, wild-type. ∗ Corresponding authors. Tel.: +86 25 84395423; fax: +86 25 84395423. E-mail addresses: [email protected] (Y. Xia), [email protected] (Z. Shen). http://dx.doi.org/10.1016/j.jhazmat.2015.03.060 0304-3894/© 2015 Published by Elsevier B.V.
tional sites in proteins, displacement of essential elements with enzymatic functions, or increased production of ROS [1]. Being a redox-active metal, Cu+ can mediate the formation of a superoxide anion (O2 •− ), which subsequently results in H2 O2 and hydroxyl radical (HO• ) production via Fenton and Haber–Weiss reactions [2–4]. To mediate oxidative stress, plants have evolved a complex antioxidant system that includes ROS-scavenging enzymes, as well as nonenzymatic compounds such as low-molecular-weightantioxidants [MTs, glutathione, Asc and carotenoids] [2,5–8]. MTs constitute a superfamily of evolutionally conserved, lowmolecular-mass, Cys-rich proteins that bind metals via the thiol groups of their Cys residues [8,9]. In animals, MTs are involved in maintaining homeostasis of essential metals and metal detoxification, and implicated in a range of other physiological processes, including ROS scavenging and regulating cell growth and prolifer-
100
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
ation [10]. Plant MTs are thought to be primarily involved in the response to metal toxicity and oxidative stress through their thiol groups of Cys residue [11–14]. The MT gene family in rice contains 15 members encoding all four plant MT types, several of which have been identified [15–17]. It is noteworthy that the most significant biological property of MTs is inducible by a variety of environmental stimuli including peroxide, drought, cold, salt, and heavy metal toxicity, and these stimuli more or less accompanied by production of ROS [7,14,15,17–19]. As such, the increased MT expression in stressed plants may be important for ROS scavenging or signaling [20,21]. MTs may improve plants stress tolerance via their ROSscavenging function. Although several reports have attempted to determine the functional action of MTs in plants (as observed in animals), additional information of linking MT to ROS signaling in responding to heavy metal stress in plants is still needed. In the present report, we made more subtle studies on the mechanisms of inducibility of MTs in rice. It was observed that OsMT2c is transcriptionally induced in response to both Cu and H2 O2 . Pharmacological scavengers of H2 O2 , such as DMTU and Asc blocked elevated expression of Cu-induced OsMT2c. We introduced a rice osapx2 mutant which accumulated more H2 O2 in tissues, and had found the mRNA level of OsMT2c in mutant was significantly higher than in WT. Furthermore, heterologous expression of OsMT2c in Arabidopsis provided stress tolerance against Cu and accumulated lower amount of ROS (H2 O2 ) under copper stress. These evidences are provided to show that H2 O2 may be required for the activation of OsMT2c in response to Cu stress. Cu-promoted upregulation of OsMT2c was mainly attributable to the modulation of Cu-induced H2 O2 generation, and OsMT2c may be the downstream target protein of H2 O2 signaling under Cu stress.
2. Materials and methods 2.1. Plant materials and treatments WT rice (Oryza sativa L. cv. Nipponbare and cv. Kitaake) and a TDNA insertion line osapx2 (PFG K-03237.R) were used in this study. Homozygous lines of the T-DNA insertion were screened by PCR using OsAPX2-specific primers (forward CTGGTAGAAGTCGGCGTAGG and reverse GCTGTGTTTAGTTCGTGTGCC) and a T-DNA right border primer (GTTTACCCGCCAATATATCCTGTCA). Rice seeds were surface sterilized with 5% (v/v) sodium hypochlorite for 15 min and then thoroughly washed, after which they were soaked in distilled water at 30 ◦ C in darkness for germination. After 3 days of incubation, uniformly germinated seeds were selected and transferred to a net floating in ½ Kimura B solution, which was renewed every 2 days under greenhouse conditions (14-h light/10-h dark photoperiod, average temperature 25–30 ◦ C, relative humidity 60–80%). Two-week-old rice seedlings (O. sativa cv. Nipponbare) were transferred to a nutrient solution containing different concentrations of Cu sulfate (CuSO4 ; 0, 5, 10, 25, 50, and 100 mol L−1 ) for 24 h, and others were treated with 10 mol L−1 CuSO4 or 10 mmol L−1 H2 O2 and harvested at the times indicated in Fig. 2C and D. To study the effects of H2 O2 scavengers, plants were pretreated with DMTU (5 mmol L−1 ; Sigma–Aldrich, St. Louis, MO, USA) or Asc (1 mmol L−1 ; Sigma–Aldrich) for 6 h, and then exposed to fresh nutrient solution containing 10 mol L−1 CuSO4 for 24 h. The knockout line osapx2 and its WT rice (O. sativa cv. Kitaake) were also grown for 2 weeks and then transferred to fresh nutrient solution containing 10 mol L−1 CuSO4 for 24 h. All samples were fractionated into roots and leaves, and then immediately frozen in liquid nitrogen and stored at −80 ◦ C until use. All treatments were repeated three times with three replicates each.
2.2. Total RNA isolation, cDNA synthesis and (semi-) quantitative RT-PCR Total RNA was extracted using the RNA simple Total RNA Kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s instructions and then converted to cDNA after DNase I treatment using a PrimeScriptTM RT Master Mix (TaKaRa, Dalian, China). The primers used for semi-quantitative RT-PCR of OsMT2c were forward ATAATGTCGTGCTGCGGTGG and reverse ATGCGCACTTGCAGGTGTTG, and the expression was normalized with the expression of internal control gene GADPH, using the primers (forward ACCACAAACTGCCTTGCTCC and reverse ATGCTCGACCTGCTGTCACC). Real-time quantitative RT-PCR was performed on a MyiQ Real-Time PCR Detection System (Bio-Rad Hercules, CA, USA) using SYBR Premix Ex Taq (TaKaRa). The primers for OsMT2c were forward GACCACCTTCCTTGCCGATGC and reverse CCGCACTTGCAGGTGTTGC, and the primers for the internal control gene OsActin were forward CTTCATAGGAATGGAAGCTGCGGGTA and reverse CGACCACCTTGATCTTCATGCTGCTA. The PCR protocol included an initial 7-min incubation at 95 ◦ C for complete denaturation followed by 40 cycles at 95 ◦ C for 30 s, 56 ◦ C for 30 s, and 72 ◦ C for 30 s. The specificity of the PCR amplification was examined based on a heat dissociation curve (65–95 ◦ C) following the final cycle. Normalized relative expression was calculated using the 2−Ct (cycle threshold) method. Data represent the means (±SE) of three independent experiments. 2.3. H2 O2 content determination and histochemical staining The content of H2 O2 was determined by measuring the absorbance at 390 nm of the mixtures referenced to Loreto and Velikova [22]. H2 O2 was quantified based on a calibration curve using solutions with known H2 O2 concentrations. Results were expressed as mol H2 O2 g−1 fresh weight. H2 O2 was visually detected in the leaves of Arabidopsis using DAB, as reported by Romero-Puertas et al. [23]. After staining, the leaves were bleached by immersion in 95% ethanol, and images were captured using an SMZ 1000 stereomicroscope (Nikon, Tokyo, Japan). 2.4. Determination of plant Cu concentration Rice roots and leaves were harvested and dried for 15 min at 105 ◦ C, and then for 24 h at 80 ◦ C. The dried samples were measured the dry weights and completely digested with extra pure grade HNO3 :HClO4 [87:13, v/v]. Cu concentrations were analyzed with a flame atomic absorption spectrometer (novAA® 400; Analytik Jena, Jena, Germany). Blanks were used for background correction and other sources of error. 2.5. Generation of transgenic Arabidopsis plants expressing OsMT2c The ORF encoding OsMT2c (without the stop codon) was amplified using the primers forward GACTAGTATCACCATGTCGTGCTG and reverse GACTAGTAAGCTTGTTGCAGTTGCAGCAG. The amplified cDNA fragment containing the restriction site SpeI (underlined region) was subcloned in frame in front of the GFP–GUS coding region in the plant binary vector pCAMBIA1304, generating pCAMBIA1304–OsMT2c under control of the CaMV35S promoter. This construct was introduced into Arabidopsis thaliana Col-0 (ecotype Columbia) through an Agrobacterium tumefaciens EHA105-mediated floral dip method [24]. T1 and T2 generation seeds were collected and selected on ½ MS medium containing 25 mg L−1 hygromycin and then tested using semi-quantitative
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
RT-PCR, and the primers used for the internal control gene 18s rRNA were forward CAGACTGTGAAACTGCGAATG and reverse TCGAAAGTTGATAGGGCAGA. T3 or T4 generation homozygous lines were used for further study. We also transformed vector pCAMBIA1304 into Arabidopsis and named the homozygous lines as Ev.
101
staining, the samples were bleached by immersion in 95% ethanol, and images were captured with a Nikon SMZ 1000 stereomicroscope. GUS activity was analyzed quantitatively in 7-day-old transgenic seedlings via fluorometric measurements with 4-MUG as the substrate, as described previously by Lü et al. [26].
2.6. Cu-tolerant phenotype 2.8. Statistical analysis T3 or T4 generation Arabidopsis seeds were sterilized by soaking in 75% ethanol for 1 min and in 10% sodium hypochlorite for 5 min, followed by four to six washes in sterilized water. Stratification was performed at 4 ◦ C for 3 days in the dark, after which seeds were germinated on ½ MS medium containing different concentrations of CuSO4 and transferred to a growth chamber at 22–24 ◦ C with 16 h of light. The 7-day-old seedlings were photographed to show the growth phenotype, and the root length and fresh weight were measured under Cu stress. Samples were stored at −80 ◦ C for further analysis. 2.7. GUS histochemical localization and fluorometric measurement of GUS activity GUS staining was performed with transgenic Arabidopsis at different development stages as described by Jefferson et al. [25]. After
Statistical analysis was performed using one-way analysis of variance with the Statistical Package for the Social Sciences for Windows (ver. 13.0; SPSS Inc., Chicago, IL, USA). Means denoted by the same letter did not differ significantly at P < 0.05 according to a least-significant differences test. Values correspond to means ± SE. 3. Results 3.1. Analysis of OsMT2c in the MT gene family of O. sativa To explore the genomic basis of rice MTs, we identified 15 MT protein products in Release 7 of the MSU Rice Genome Annotation Project (http://rice.plantbiology.msu.edu/). A phylogenetic analysis of putative protein sequences showed that rice MTs were distributed among all four subgroups of plant MTs (Fig. 1A). Type
Fig. 1. Phylogenetic tree of the rice metallothionein (MT) family (A) and alignment of the deduced amino acid sequence of OsMT2c with other type 2 MTs (B). The phylogenetic tree was drawn using MEGA version 6.0 on MT protein sequences using the neighbor-joining method. Rice MT protein names are followed by their locus ID from Release 7 of the MSU Rice Genome Annotation Project.
102
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
Fig. 2. Real-time quantitative RT-PCR analysis the expression of OsMT2c. The OsMT2c mRNA levels in roots (R), leaf sheathes (LS), and leaves (L) of 2-week-old seedlings and in seeds (S) of O. sativa cv. Nipponbare (A). The OsMT2c mRNA levels in roots and leaves of rice seedlings exposed to 0, 5, 10, 25, 50, and 100 mol L−1 CuSO4 for 24 h (B). OsMT2c mRNA levels in roots and leaves of rice seedlings exposed to 10 mol L−1 CuSO4 (C). OsMT2c mRNA levels in roots and leaves of rice seedlings exposed to 10 mmol L−1 H2 O2 (D). GAPDH was used as an internal control.
1-OsMT1 has eight members (a1, a2, b, c, d, e, f, and g), type 2 consists of four members (OsMT2a, 2b, 2c, and 2d), and type 3 comprises two members (OsMT3a and OsMT3b), whereas type 4 has only one member. A multiple sequence alignment was also performed between OsMT2c and other MT2 proteins, including
OsMT2b (U77294) from O. sativa, AtMT2b (NP195858) from A. thaliana, BdMTL (CCYO2587) from Brachypodium distachyon, EcMTL (AJ010162) from Eichhornia crassipes, HvMT2b2 (JN997432) from Hordeum vulgare, TaMT2 (AF470355) from Triticum aestivum, and ZmMTL (BT017417) from Zea mays (Fig. 1B). Multiple alignments
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
103
Fig. 3. Cu and pretreatment with DMTU or Asc induced changes in H2 O2 production and OsMT2c expression. Time course of changes in the contents of H2 O2 in roots and leaves of rice seedlings exposed to 10 mol L−1 CuSO4 (A), the contents of H2 O2 in roots and leaves of rice seedlings under different treatments (B), and the expression levels of OsMT2c in the roots and leaves of rice seedlings under different treatments (C). Two-week-old seedlings were pretreated with 5 mmol L−1 DMTU or 1 mmol L−1 Asc for 6 h, and then exposed to 0.32 (control) or 10 mol L−1 CuSO4 for 24 h.
showed that OsMT2c shared high homology with many MTs from other plant species. The N-terminal and C-terminal domains contained eight and six Cys residues, respectively, separated by a central Cys-free spacer. In agreement with other higher plant MTs, all Cys residues were located in the N- and C-terminal domains of OsMT2c. A cDNA clone, OsMT2c (AB002820), was isolated from O. sativa seedlings. The ORF of the OsMT2c cDNA consisted of 243 nucleotides and encoded 80 amino acids. The full genome sequence of OsMT2c spanned 4084 bp on chromosome 1, which contained three exons and two introns [27]. 3.2. OsMT2c expression is upregulated by Cu and H2 O2 The expression levels of OsMT2c were analyzed in rice organs and tissues using quantitative RT-PCR. The transcript level of OsMT2c was significantly higher in O. sativa leaves and leaf sheathes than in roots, but was extremely weak in seeds (Fig. 2A). To assess inducible expression of OsMT2c, we harvested rice seedlings treated with CuSO4 and H2 O2 and detected the transcriptional level of OsMT2c. Treatment with different concentrations of CuSO4 resulted in the activation of OsMT2c expression in a
dose-dependent manner in roots, the expression level increased after treatment from 5 to 50 mol L−1 and peaked at 50 mol L−1 . A substantially reduced expression at 100 mol L−1 is associated with high concentration of CuSO4 leading rice to wilt and die. The expression levels of OsMT2c in leaves of rice seedlings increased in the presence of CuSO4 at the optimal concentration (10 mol L−1 ) and decreased thereafter (Fig. 2B). Time-course analysis showed the expression of OsMT2c was sustainable increased in roots, and peaked at 48 h in leaves in the presence of 10 mol L−1 CuSO4 (Fig. 2C). The expression of OsMT2c was strongly induced in roots within 1 h after 10 mmol L−1 H2 O2 treatment, and in leaves it was gradually increased with prolonging H2 O2 treatment (Fig. 2D). 3.3. Inhibition of Cu-induced H2 O2 decreases the expression of OsMT2c A wide range of environmental stimuli can transiently increase H2 O2 levels [28]. In this report, Cu stress induced the rapid accumulation of H2 O2 within the first 12 h, and the contents of H2 O2 in roots maintained a higher level from 24 h to 72 h, after that to 96 h a rising trend appeared again (Fig. 3A). H2 O2 formation in leaves of
104
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
Fig. 4. Accumulation of H2 O2 and the relative expression levels of OsMT2c in osapx2 mutant and WT seedlings under normal conditions (control) or CuSO4 treatment. Semiquantitative RT-PCR analysis of OsAPX2 gene expression in roots and leaves of WT and osapx2 mutant seedlings (A), the contents of H2 O2 (B), and the relative expression levels of OsMT2c (C) in the roots and leaves of WT and osapx2 mutant seedlings under normal conditions or Cu stress.
Cu-treated plants gradually increased during 12–72 h of exposure to 10 mol L−1 CuSO4 and then decreased slightly but remained higher than the control. The contents of Cu in roots and leaves were also measured under CuSO4 treatment, and significant increased trends were observed in Fig. S1. Moreover, there was a significant correlation between endogenous H2 O2 and Cu accumulation under copper stress (Fig. S2). To investigate whether the expression of OsMT2c is regulated by Cu-induced H2 O2 (and not Cu alone), we applied two scavengers of H2 O2 to the Cu-treated rice plants. Pretreatment with the H2 O2 scavenger DMTU or Asc efficiently blocked the accumulation of Cuinduced H2 O2 in roots and leaves of rice seedlings (Fig. 3B), and repressed the increase in OsMT2c expression, especially in roots (Fig. 3C).
3.4. T-DNA insertion the OsAPX2 mutant displayed higher H2 O2 accumulation APXs, as enzymatic antioxidants, play an important role in reducing the accumulation of H2 O2 , thereby protecting cells against oxidative damage [6]. A T-DNA insertion was added to the promoter region of OsAPX2 to construct the osapx2 mutant line, which showed significantly lower expression compared to WT seedlings (Fig. 4A). To further investigate the relationship between OsMT2c expression and H2 O2 accumulation, the H2 O2 contents of the osapx2 mutant and WT seedlings were examined when exposed to excessive Cu. H2 O2 accumulation in roots and leaves of the osapx2
mutant was significantly higher than that of WT seedlings grown under normal conditions, and the expression level of OsMT2c in mutant was also higher than that in WT. CuSO4 (10 mol L−1 ) significantly enhanced H2 O2 generation and OsMT2c expression in roots and leaves of WT, but no markly increase was observed in the osapx2 line (Fig. 4B and C).
3.5. OsMT2c enhanced Cu tolerance of Arabidopsis by scavenging ROS To confirm the in vivo functions of the OsMT2c gene in response to heavy metal stress in plants, we generated transgenic Arabidopsis plants overexpressing OsMT2c with GFP–GUS fusions under control of the CaMV 35S promoter. After screening transformants by selecting for hygromycin resistance and PCR amplification with specific primers, expression of the OsMT2c gene was verified using semi-quantitative RT-PCR (Fig. 5A). Histochemical staining of GUS further confirmed the transformation of Arabidopsis with the OsMT2c gene. OsMT2c was expressed in young roots, stems, and leaves of transgenic Arabidopsis, especially in the growing tip, rosette new leaf, cauline leaf, mature flower, young silique, and matured silique, but relatively weak staining was observed in mature roots of transgenic plants (Fig. 5B). Treatment with different concentrations of CuSO4 increased the GUS activity in a dose-dependent manner in transgenic OsMT2c seedlings, while the GUS activity of Ev seedlings was gradually decreased with increasing CuSO4 concentrations (Fig. 6). Under the same Cu concentration
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
Fig. 5. Identification of transgenic Arabidopsis expressing OsMT2c and fluorometric GUS assays in response to Cu stress. RT-PCR analysis of OsMT2c gene expression in WT and T2 generation transgenic Arabidopsis (A). The 18s rRNA was used as an internal control. Histochemical staining of GUS in transgenic Arabidopsis (B): seedlings grown on ½ MS medium at day 3 [1] and day 5 [2]; different types of leaves (3, cotyledon; 4, rosette leaf; 5, cauline leaf), roots [6], and flowers from a 30-dayold transgenic plant grown on soil during floral development (7, mature flower; 8, young silique; 9, matured silique). GUS activity of transgenic MT2c Arabidopsis treated with different concentrations of CuSO4 for 7 days (C). Transgenic Arabidopsis with empty-vector seedlings were used as a control.
treatment, the GUS activity of transgenic OsMT2c rice seedlings was significantly higher than that of Ev seedlings. The increased GUS activity in transgenic seedlings exposed to Cu stress indicated that the heterologous expression OsMT2c protein played a positive role in tolerance to Cu stress in Arabidopsis. On normal MS medium, the two transgenic lines showed slightly better growth than WT seedlings (Fig. 6A). Exposure of the plants to 35 mol L−1 CuSO4 significantly decreased root elongation (Fig. 6B) and fresh weight (Fig. 6C) in WT seedlings compared to transgenic OsMT2c seedlings. In WT seedlings, the root elongation and fresh weight decreased to 88.1% and 90.0%, respectively, of the control, while no significant difference was observed in transgenic OsMT2c seedlings grown in the presence or absence of CuSO4 . H2 O2 was detected in leaves in situ using DAB histochemical staining methods. Treatment with 35 mol L−1 CuSO4 or 10 mol L−1 MV led to an obvious accumulation of H2 O2 in the leaves of WT and Ev Arabidopsis, whereas the production of H2 O2 was considerably lower in the two OsMT2c transgenic lines (Fig. 7). 4. Discussion Cu is an essential micronutrient for plants, but is also an environmental pollutant that severely affects plants growth and
105
agricultural productivity. Cu toxicity causes an oxidative burst with rapid H2 O2 production and release into the apoplast of plants [29–32]. In the present study, both Cu and H2 O2 activated the transcriptional level of OsMT2c (Fig. 2). However, whether a correlation exists between the expression of MTs and Cu-enhanced H2 O2 levels in plants remained unclear. In this study, using pharmacological H2 O2 scavengers DMTU and Asc before copper stress, the results showed they blocked the elevated accumulation of H2 O2 and expression of Cu-induced OsMT2c in roots and leaves (Fig. 3). Similarly, a rice osapx2 mutant, disruption of cytosolic OsAPX2 led to an intracellular ROS imbalance [33]. OsMT2c expression and the H2 O2 level were much higher than in WT under normal conditions (Fig. 4). This suggested that H2 O2 as a signal molecular modulated the expression of various genes, including those encoding antioxidants and modulators of H2 O2 production [34]. Meanwhile, the Cu-induced H2 O2 production might act upstream of MT2c activation in the induction of Cu stress. Unexpectedly, in contrast to the WT seedlings, the accumulation of H2 O2 in osapx2 mutant treated with Cu did not increase, suggesting that disruption of APX2 activated redundant H2 O2 -scavenging pathways, reducing H2 O2 accumulation or suppressing its production [35,36]. Even so, OsMT2c expression was associated with the H2 O2 level in osapx2 mutant under Cu stress. The above results suggested that H2 O2 was required for the activation of OsMT2c in rice response to Cu stress. In contrast, Cu alone (but not oxidative stress) was reported to induce CuMT gene expression in Neurospora crassa [37]. This contrary result may be due to the metal response elements (MREs) presented in upstream region of the MT gene in lower and higher forms of eukaryotes [37]. MRE-like motifs have been identified in the promoters of several MT genes, such as Cu- and Zn-inducible ricMT of rice [26], LeMTB of tomato [38] and PaMT3b of poplar [39]. No MRE motif was found in the promoter of MT3 (CitMT45) of Citrus unshiu, which is not responsive to metal treatments [40]. In the rice MT gene OsMT2c, several promoter regions responsible for organ-specific expression, wound induction, light, abscisic acid (ABA), Cu and Zn responses have been identified [26,41]. Evidence that MTs contribute to metal tolerance in plants is limited. Significant differences in tolerance to Cu were observed between MT-overexpressing and WT seedlings (Figs. 6 and 7) and similar results were obtained when comparing metal tolerance [42,43]. Murphy and Taiz [44,45] also reported a striking correlation between expression of MT2a RNA and Cu tolerance in a group of Arabidopsis ecotypes. The enhanced copper tolerance might due to the antioxidant function of MTs with a large number of Cys residues, which are capable of ROS scavenging [8]. Other mechanisms, including metal transport and compartmentation, are likely to be more important for Cu in most plants [46–49]. In addition, decreasing ROS accumulation in the transgenic lines suggested that ROS-scavenging systems in these plants more effectively than in WT. MTs may also enhance plant stress tolerance through the upregulation of anti-oxidative enzymes to maintain the redox balance and thereby reduce ROS-induced injury [14,17,43,50,51]. MT-overexpressing plants or yeast have a more efficient antioxidant system with increased enzyme activities [52–54]. In the present study, however, it is not clear whether MTs act as efficient scavengers of ROS or as regulators of genes encoding ROS-scavenging enzymes in plant responses to oxidative stress. In conclusion, this study proves the induced expression of OsMT2c under copper stress is regulated by H2 O2 , not directly by Cu alone. Moreover, overexpression of OsMT2c gene is associated with diminished ROS accumulation, and then significantly enhanced tolerance of Arabidopsis against abiotic stress. The mechanisms of the elevated Cu tolerance including binding of OsMT2c with Cu and improving the antioxidant system are still need to assess in further study.
106
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
Fig. 6. Tolerance to Cu stress of WT Arabidopsis and transgenic seedlings expressing OsMT2c. The growth phenotype on ½ MS with or without 35 mol L−1 CuSO4 for 7 days (A) and the effect of Cu stress on the root length (B) and fresh weight (C) in WT and transgenic lines. Bar = 5 mm. At least 30 seedlings of every line were measured.
Fig. 7. Histochemical localization of H2 O2 by DAB staining under Cu and MV treatment. Bar = 1 mm.
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
Acknowledgments This work was financially supported by the National Natural Science Foundation of China (31172021, 31201146, 31471938), the Doctoral Program Foundation of Institutions of Higher Education of China (20120097130004), the Fundamental Research Funds for the Central Universities (KYZ201316), and the Innovative Research Team Development Plan of the Ministry of Education of China (IRT1256). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jhazmat. 2015.03.060.
[21]
[22]
[23]
[24]
[25]
[26]
References [27] [1] S.S. Sharma, K.J. Dietz, The relationship between metal toxicity and cellular redox imbalance, Trends Plant Sci. 14 (2009) 43–50. [2] A. Schützendübel, A. Polle, Plant responses to abiotic stresses: heavy metal-induced oxidative stress and protection by mycorrhization, J. Exp. Bot. 53 (2002) 1351–1365. [3] B. Halliwell, Reactive species and antioxidants. Redox biology is a fundamental theme of aerobic life, Plant Physiol. 141 (2006) 312–322. [4] L. Contreras, D. Mella, A. Moenne, J.A. Correa, Differential responses to copper-induced oxidative stress in the marine macroalgae Lessonia nigrescens and Scytosiphon lomentaria (Phaeophyceae), Aquat. Toxicol. 94 (2009) 94–102. [5] V. Petrov, V. Vermeirssen, I. De Clercq, F. Van Breusegem, I. Minkov, K. Vandepoele, T.S. Gechev, Identification of cis-regulatory elements specific for different types of reactive oxygen species in Arabidopsis thaliana, Gene 499 (2012) 52–60. [6] R. Mittler, Oxidative stress, antioxidants and stress tolerance, Trends Plant Sci. 7 (2002) 405–410. [7] H.L. Wong, T. Sakamoto, T. Kawasaki, K. Umemura, K. Shimamoto, Down-regulation of metallothionein, a reactive oxygen scavenger, by the small GTPase OsRac1 in rice, Plant Physiol. 135 (2004) 1447–1456. [8] V.H. Hassinen, A.I. Tervahauta, H. Schat, S.O. Kärenlampi, Plant metallothioneins – metal chelators with ROS scavenging activity? Plant Biol. 13 (2011) 225–232. [9] C. Cobbett, P. Goldsbrough, Phytochelatins and metallothioneins: roles in heavy metal detoxification and homeostasis, Annu. Rev. Plant Biol. 53 (2002) 159–182. [10] N. Thirumoorthy, A. Shyam Sunder, K.T. Manisenthil Kumar, M. Senthil Kumar, G.N.K. Ganesh, M. Chatterjee, A review of metallothionein isoforms and their role in pathophysiology, World J. Surg. Oncol. 9 (2011) 54. [11] G. Mir, J. Domènech, G. Huguet, W.J. Guo, P. Goldsbrough, S. Atrian, M. Molinas, A plant type 2 metallothionein (MT) from cork tissue responds to oxidative stress, J. Exp. Bot. 55 (2004) 2483–2493. [12] W.J. Guo, M. Meetam, P.B. Goldsbrough, Examining the specific contributions of individual Arabidopsis metallothioneins to copper distribution and metal tolerance, Plant Physiol. 146 (2008) 1697–1706. [13] C.S. Gu, L.Q. Liu, Y.H. Zhao, Y.M. Deng, X.D. Zhu, S.Z. Huang, Overexpression of Iris lactea var. chinensis metallothionein llMT2a enhances cadmium tolerance in Arabidopsis thaliana, Ecotoxicol. Environ. Saf. 105 (2014) 22–28. [14] Y. Xia, Y. Qi, Y. Yuan, G. Wang, J. Cui, Y. Chen, H. Zhang, Z. Shen, Overexpression of Elsholtzia haichowensis metallothionein 1 (EhMT1) in tobacco plants enhances copper tolerance and accumulation in root cytoplasm and decreases hydrogen peroxide production, J. Hazard. Mater. 233–234 (2012) 65–71. [15] G. Kumar, H.R. Kushwaha, V. Panjabi-Sabharwal, S. Kumari, R. Joshi, R. Karan, S. Mittal, S.L.S. Pareek, A. Pareek, Clustered metallothionein genes are co-regulated in rice and ectopic expression of OsMT1e-P confers multiple abiotic stress tolerance in tobacco via ROS scavenging, BMC Plant Biol. 12 (2012) 107. [16] J. Yuan, D. Chen, Y. Ren, X. Zhang, J. Zhao, Characteristic and expression analysis of a metallothionein gene, OsMT2b, down-regulated by cytokinin suggests functions in root development and seed embryo germination of rice, Plant Physiol. 146 (2008) 1637–1650. [17] Z. Yang, Y. Wu, Y. Li, H.Q. Ling, C. Chu, OsMT1a a type 1 metallothionein, plays the pivotal role in zinc homeostasis and drought tolerance in rice, Plant Mol. Biol. 70 (2009) 219–229. [18] W. Zhu, D.X. Zhao, Q. Miao, T.T. Xue, X.Z. Li, C.C. Zheng, Arabidopsis thaliana metallothionein, AtMT2a, mediates ROS balance during oxidative stress Arabidopsis thaliana metallothionein, AtMT2a, mediates ROS balance during oxidative stress, J. Plant Biol. 52 (2009) 585–592. [19] S.H. Kim, H.S. Lee, W.Y. Song, K.S. Choi, Y. Hur, Chloroplast-targeted BrMT1 (Brassica rapa type-1 metallothionein) enhances resistance to cadmium and ROS in transgenic Arabidopsis plants, J. Plant Biol. 50 (2007) 1–7. ´ D.B. Nikolic, ´ G.S. Timotijevic, ´ S. Zˇ . Jovanovic, ´ M. Ð. Milisavljevic, ´ [20] J.T. Samardˇzic, ´ Tissue expression analysis of FeMT3, a drought and V.R. Maksimovic,
[28] [29]
[30] [31] [32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
[44]
[45]
[46]
[47]
107
oxidative stress related metallothionein gene from buckwheat (Fagopyrum esculentum), J. Plant Physiol. 167 (2010) 1407–1411. Y. Lv, X. Deng, L. Quan, Y. Xia, Z. Shen, Metallothioneins BcMT1 and BcMT2 from Brassica campestris enhance tolerance to cadmium and copper and decrease production of reactive oxygen species in Arabidopsis thaliana, Plant Soil 367 (2013) 507–519. F. Loreto, V. Velikova, Isoprene produced by leaves protects the photosynthetic apparatus against ozone damage, quenches ozone products, and reduces lipid peroxidation of cellular membranes, Plant Physiol. 127 (2001) 1781–1787. M.C. Romero-Puertas, M. Rodríguez-Serrano, F.J. Corpas, M. Gómez, L.A. del Río, L.M. Sandalio, Cadmium-induced subcellular accumulation of O2 − and H2 O2 in pea leaves, Plant Cell Environ. 27 (2004) 1122–1134. S.J. Clough, A.F. Bent, Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana, Plant J. 16 (1998) 735–743. R.A. Jefferson, T.A. Kavanagh, M.W. Bevan, GUS fusions: ˇ-glucuronidase as a sensitive and versatile gene fusion marker in higher plants, EMBO J. 6 (1987) 3901–3907. S. Lü, H. Gu, X. Yuan, X. Wang, A.M. Wu, L. Qu, J.Y. Liu, The GUS reporter-aided analysis of the promoter activities of a rice metallothionein gene reveals different regulatory regions responsible for tissue-specific and inducible expression in transgenic Arabidopsis, Transgenic Res. 16 (2007) 177–191. G. Zhou, Y. Xu, J. Li, L. Yang, J.Y. Liu, Molecular analyses of the metallothionein gene family in rice (Oryza sativa L.), J. Biochem. Mol. Biol. 39 (2006) 595–606. V.D. Petrov, F. Van Breusegem, Hydrogen peroxide – a central hub for information flow in plant cells, AoB Plants 177 (2012) pls014. C.M. André, Y. Larondelle, D. Evers, Dietary antioxidants and oxidative stress from a human and plant perspective: a review, Curr. Nutr. Food Sci. 6 (2010) 2–12. G.J. Brewer, Copper toxicity in the general population, Clin. Neurophysiol. 121 (2010) 459–460. S. Choudhury, P. Panda, L. Sahoo, S.K. Panda, Reactive oxygen species signaling in plants under abiotic stress, Plant Signaling Behav. 8 (2013) e23681. T.C. Thounaojam, P. Panda, S. Choudhury, H.K. Patra, S.K. Panda, Zinc ameliorates copper-induced oxidative stress in developing rice (Oryza sativa L.) seedlings, Protoplasma 251 (2014) 61–69. Z. Zhang, Q. Zhang, J. Wu, X. Zheng, S. Zheng, X. Sun, Q. Qiu, T. Lu, Gene knockout study reveals that cytosolic ascorbate peroxidase 2 (OsAPX2) plays a critical role in growth and reproduction in rice under drought, salt and cold stresses, PLoS One 8 (2013) e57472. R. Desikan, S. A-H-Mackerness, J.T. Hancock, S.J. Neill, Regulation of the Arabidopsis transcriptome by oxidative stress, Plant Physiol. 127 (2001) 159–172. S.B. Rosa, A. Caverzan, F.K. Teixeira, F. Lazzarotto, J.A.G. Silveira, S.L. Ferreira-Silva, J. Abreu-Neto, R. Margis, M. Margis-Pinheiro, Cytosolic APx knockdown indicates an ambiguous redox responses in rice, Phytochemistry 71 (2010) 548–558. N. Suzuki, G. Miller, H. Sejima, J. Harper, R. Mittler, Enhanced seed production under prolonged heat stress conditions in Arabidopsis thaliana plants deficient in cytosolic ascorbate peroxidase 2, J. Exp. Bot. 64 (2013) 253–263. K.S. Kumar, S. Dayananda, C. Subramanyam, Copper alone, but not oxidative stress, induces copper-metallothionein gene in Neurospora crassa, FEMS Microbiol. Lett. 242 (2005) 45–50. C.A. Whitelaw, J.A. Le Huquet, D.A. Thurman, A.B. Tomsett, The isolation and characterisation of type II metallothionein-like genes from tomato (Lycopersicon esculentum L.), Plant Mol. Biol. 33 (1997) 503–511. M. Berta, A. Giovannelli, E. Potenza, M.L. Traversi, M.L. Racchi, Type 3 metallothioneins respond to water deficit in leaf and in the cambial zone of white poplar (Populus alba), J. Plant Physiol. 166 (2009) 521–530. T. Endo, T. Shimada, H. Fujii, T. Moriguchi, M. Omura, Promoter analysis of a type 3 metallothionein-like gene abundant in Satsuma mandarin (Citrus unshiu Marc.) fruit, Sci. Hortic. 112 (2007) 207–214. Y. Ren, J. Zhao, Functional analysis of the rice metallothionein gene OsMT2b promoter in transgenic Arabidopsis plants and rice germinated embryos, Plant Sci. 176 (2009) 528–538. Y.O. Kim, S. Jung, K. Kim, H.J. Bae, Role of pCeMT a putative metallothionein from Colocasia esculenta, in response to metal stress, Plant Physiol. Biochem. 64 (2013) 25–32. J. Zhang, M. Zhang, S. Tian, L. Lu, M.J.I. Shohag, X. Yang, Metallothionein 2 (SaMT2) from Sedum alfredii hance confers increased Cd tolerance and accumulation in yeast and tobacco, PLoS One 9 (2014) e102750. A. Murphy, L. Taiz, A new vertical mesh transfer technique for metal-tolerance studies in Arabidopsis (ecotypic variation and copper-sensitive mutants), Plant Physiol. 108 (1995) 29–38. A. Murphy, L. Taiz, Comparison of metallothionein gene expression and nonprotein thiols in ten Arabidopsis ecotypes. Correlation with copper tolerance, Plant Physiol. 109 (1995) 945–954. M.R. Benatti, N. Yookongkaew, M. Meetam, W.J. Guo, N. Punyasuk, S. AbuQamar, P. Goldsbrough, Metallothionein deficiency impacts copper accumulation and redistribution in leaves and seeds of Arabidopsis, New Phytol. 202 (2014) 940–951. ˜ L. Penarrubia, N. Andrés-Colás, J. Moreno, S. Puig, Regulation of copper transport in Arabidopsis thaliana: a biochemical oscillator? J. Biol. Inorg. Chem. 15 (2010) 29–36.
108
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
[48] M. Pilon, C.M. Cohu, K. Ravet, S.E. Abdel-Ghany, F. Gaymard, Essential transition metal homeostasis in plants, Curr. Opin. Plant Biol. 12 (2009) 347–357. [49] J.L. Burkhead, K.A. Gogolin Reynolds, S.E. Abdel-Ghany, C.M. Cohu, M. Pilon, Copper homeostasis, New Phytol. 182 (2009) 799–816. [50] B. Zhou, W. Yao, S. Wang, X. Wang, T. Jiang, The metallothionein gene, TaMT3, from Tamarix androssowii confers Cd2+ tolerance in tobacco, Int. J. Mol. Sci. 15 (2014) 10398–10409. [51] Y. Zhou, P. Chu, H. Chen, Y. Li, J. Liu, Y. Ding, E.W.T. Tsang, L. Jiang, K. Wu, S. Huang, Overexpression of Nelumbo nucifera metallothioneins 2a and 3 enhances seed germination vigor in Arabidopsis, Planta 235 (2012) 523–537.
[52] R.M. Nezhad, A. Shahpiri, A. Mirlohi, Discrimination between two rice metallothionein isoforms belonging to type 1 and type 4 in metal-binding ability, Biotechnol. Appl. Biochem. 60 (2013) 275–282. [53] T. Xue, X. Li, W. Zhu, C. Wu, G. Yang, C. Zheng, Cotton metallothionein GhMT3a, a reactive oxygen species scavenger, increased tolerance against abiotic stress in transgenic tobacco and yeast, J. Exp. Bot. 60 (2009) 339–349. [54] J. Yang, Y. Wang, G. Liu, C. Yang, C. Li, Tamarix hispida metallothionein-like ThMT3, a reactive oxygen species scavenger, increases tolerance against Cd2+ , Zn2+ , Cu2+ , and NaCl in transgenic yeast, Mol. Biol. Rep. 38 (2011) 1567–1574.
Contents lists available at ScienceDirect
Journal of Hazardous Materials journal homepage: www.elsevier.com/locate/jhazmat
Copper-induced hydrogen peroxide upregulation of a metallothionein gene, OsMT2c, from Oryza sativa L. confers copper tolerance in Arabidopsis thaliana Jia Liu a , Xiaoting Shi a , Meng Qian a , Luqing Zheng a , Chunlan Lian b , Yan Xia a,∗ , Zhenguo Shen a,∗ a b
College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, People’s Republic of China Asian Natural Environmental Science Center, The University of Tokyo, Tokyo 188-0002, Japan
h i g h l i g h t s • OsMT2c expression is up-regulated by Cu and H2 O2 . • H2 O2 is required for the activation of OsMT2c in the rice response to Cu stress. • Transgenic Arabidopsis overexpressing OsMT2c accumulates less H2 O2 in leaves under abiotic stress.
a r t i c l e
i n f o
Article history: Received 19 November 2014 Received in revised form 20 March 2015 Accepted 27 March 2015 Available online 30 March 2015 Keywords: Copper stress Hydrogen peroxide ROS scavenging Transgenic Arabidopsis
a b s t r a c t Metallothioneins (MTs) are low-molecular-weight, cysteine-rich metal-binding proteins found in numerous genera and species, but their functions in abiotic stress tolerance remain unclear. Here, a MT gene from Oryza sativa, OsMT2c, was isolated and characterized, encoding a type 2 MT, and observed expression in the roots, leaf sheathes, and leaves, but only weak expression in seeds. OsMT2c was upregulated by copper (Cu) and hydrogen peroxide (H2 O2 ) treatments. Excessive Cu elicited a rapid and sustained production and release of H2 O2 in rice, and exogenous H2 O2 scavengers N,N -dimethylthiourea (DMTU) and ascorbic acid (Asc) decreased H2 O2 production and OsMT2c expression. Furthermore, the expression of OsMT2c increased in the osapx2 mutant in which the H2 O2 levels were higher than in wild-type (WT) plants. These results showed that Cu increased MT2c expression through the production and accumulation of Cu-induced H2 O2 in O. sativa. In addition, the transgenic OsMT2c-overexpressing Arabidopsis displayed improved tolerance to Cu stress and exhibited increased reactive oxygen species (ROS) scavenging ability compared to WT and empty-vector (Ev) seedlings. © 2015 Published by Elsevier B.V.
1. Introduction Copper as an essential micronutrient can be extremely toxic to plants when the accumulation is slightly higher than its optimal level. Cu becomes toxic to the cell due to interference with func-
Abbreviations: APX, ascorbate peroxidase; Asc, ascorbic acid; CaMV 35s, cauliflower mosaic virus 35S; Cu, copper; Cys, cysteine; DAB, 3,3 diamninobenzidine; DMTU, N,N -dimethylthiourea; Ev, empty-vector; GFP, green fluorescent protein; GUS, glucuronidase; H2 O2 , hydrogen peroxide; MTs, metallothioneins; 4-MUG, 4-methylumbelliferyl-ˇ-d-glucuronide; MV, methyl viologen; NADPH, nicotinamide adenine dinucleotide phosphate; RT-PCR, reverse transcription polymerase chain reaction; ROS, reactive oxygen species; WT, wild-type. ∗ Corresponding authors. Tel.: +86 25 84395423; fax: +86 25 84395423. E-mail addresses: [email protected] (Y. Xia), [email protected] (Z. Shen). http://dx.doi.org/10.1016/j.jhazmat.2015.03.060 0304-3894/© 2015 Published by Elsevier B.V.
tional sites in proteins, displacement of essential elements with enzymatic functions, or increased production of ROS [1]. Being a redox-active metal, Cu+ can mediate the formation of a superoxide anion (O2 •− ), which subsequently results in H2 O2 and hydroxyl radical (HO• ) production via Fenton and Haber–Weiss reactions [2–4]. To mediate oxidative stress, plants have evolved a complex antioxidant system that includes ROS-scavenging enzymes, as well as nonenzymatic compounds such as low-molecular-weightantioxidants [MTs, glutathione, Asc and carotenoids] [2,5–8]. MTs constitute a superfamily of evolutionally conserved, lowmolecular-mass, Cys-rich proteins that bind metals via the thiol groups of their Cys residues [8,9]. In animals, MTs are involved in maintaining homeostasis of essential metals and metal detoxification, and implicated in a range of other physiological processes, including ROS scavenging and regulating cell growth and prolifer-
100
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
ation [10]. Plant MTs are thought to be primarily involved in the response to metal toxicity and oxidative stress through their thiol groups of Cys residue [11–14]. The MT gene family in rice contains 15 members encoding all four plant MT types, several of which have been identified [15–17]. It is noteworthy that the most significant biological property of MTs is inducible by a variety of environmental stimuli including peroxide, drought, cold, salt, and heavy metal toxicity, and these stimuli more or less accompanied by production of ROS [7,14,15,17–19]. As such, the increased MT expression in stressed plants may be important for ROS scavenging or signaling [20,21]. MTs may improve plants stress tolerance via their ROSscavenging function. Although several reports have attempted to determine the functional action of MTs in plants (as observed in animals), additional information of linking MT to ROS signaling in responding to heavy metal stress in plants is still needed. In the present report, we made more subtle studies on the mechanisms of inducibility of MTs in rice. It was observed that OsMT2c is transcriptionally induced in response to both Cu and H2 O2 . Pharmacological scavengers of H2 O2 , such as DMTU and Asc blocked elevated expression of Cu-induced OsMT2c. We introduced a rice osapx2 mutant which accumulated more H2 O2 in tissues, and had found the mRNA level of OsMT2c in mutant was significantly higher than in WT. Furthermore, heterologous expression of OsMT2c in Arabidopsis provided stress tolerance against Cu and accumulated lower amount of ROS (H2 O2 ) under copper stress. These evidences are provided to show that H2 O2 may be required for the activation of OsMT2c in response to Cu stress. Cu-promoted upregulation of OsMT2c was mainly attributable to the modulation of Cu-induced H2 O2 generation, and OsMT2c may be the downstream target protein of H2 O2 signaling under Cu stress.
2. Materials and methods 2.1. Plant materials and treatments WT rice (Oryza sativa L. cv. Nipponbare and cv. Kitaake) and a TDNA insertion line osapx2 (PFG K-03237.R) were used in this study. Homozygous lines of the T-DNA insertion were screened by PCR using OsAPX2-specific primers (forward CTGGTAGAAGTCGGCGTAGG and reverse GCTGTGTTTAGTTCGTGTGCC) and a T-DNA right border primer (GTTTACCCGCCAATATATCCTGTCA). Rice seeds were surface sterilized with 5% (v/v) sodium hypochlorite for 15 min and then thoroughly washed, after which they were soaked in distilled water at 30 ◦ C in darkness for germination. After 3 days of incubation, uniformly germinated seeds were selected and transferred to a net floating in ½ Kimura B solution, which was renewed every 2 days under greenhouse conditions (14-h light/10-h dark photoperiod, average temperature 25–30 ◦ C, relative humidity 60–80%). Two-week-old rice seedlings (O. sativa cv. Nipponbare) were transferred to a nutrient solution containing different concentrations of Cu sulfate (CuSO4 ; 0, 5, 10, 25, 50, and 100 mol L−1 ) for 24 h, and others were treated with 10 mol L−1 CuSO4 or 10 mmol L−1 H2 O2 and harvested at the times indicated in Fig. 2C and D. To study the effects of H2 O2 scavengers, plants were pretreated with DMTU (5 mmol L−1 ; Sigma–Aldrich, St. Louis, MO, USA) or Asc (1 mmol L−1 ; Sigma–Aldrich) for 6 h, and then exposed to fresh nutrient solution containing 10 mol L−1 CuSO4 for 24 h. The knockout line osapx2 and its WT rice (O. sativa cv. Kitaake) were also grown for 2 weeks and then transferred to fresh nutrient solution containing 10 mol L−1 CuSO4 for 24 h. All samples were fractionated into roots and leaves, and then immediately frozen in liquid nitrogen and stored at −80 ◦ C until use. All treatments were repeated three times with three replicates each.
2.2. Total RNA isolation, cDNA synthesis and (semi-) quantitative RT-PCR Total RNA was extracted using the RNA simple Total RNA Kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s instructions and then converted to cDNA after DNase I treatment using a PrimeScriptTM RT Master Mix (TaKaRa, Dalian, China). The primers used for semi-quantitative RT-PCR of OsMT2c were forward ATAATGTCGTGCTGCGGTGG and reverse ATGCGCACTTGCAGGTGTTG, and the expression was normalized with the expression of internal control gene GADPH, using the primers (forward ACCACAAACTGCCTTGCTCC and reverse ATGCTCGACCTGCTGTCACC). Real-time quantitative RT-PCR was performed on a MyiQ Real-Time PCR Detection System (Bio-Rad Hercules, CA, USA) using SYBR Premix Ex Taq (TaKaRa). The primers for OsMT2c were forward GACCACCTTCCTTGCCGATGC and reverse CCGCACTTGCAGGTGTTGC, and the primers for the internal control gene OsActin were forward CTTCATAGGAATGGAAGCTGCGGGTA and reverse CGACCACCTTGATCTTCATGCTGCTA. The PCR protocol included an initial 7-min incubation at 95 ◦ C for complete denaturation followed by 40 cycles at 95 ◦ C for 30 s, 56 ◦ C for 30 s, and 72 ◦ C for 30 s. The specificity of the PCR amplification was examined based on a heat dissociation curve (65–95 ◦ C) following the final cycle. Normalized relative expression was calculated using the 2−Ct (cycle threshold) method. Data represent the means (±SE) of three independent experiments. 2.3. H2 O2 content determination and histochemical staining The content of H2 O2 was determined by measuring the absorbance at 390 nm of the mixtures referenced to Loreto and Velikova [22]. H2 O2 was quantified based on a calibration curve using solutions with known H2 O2 concentrations. Results were expressed as mol H2 O2 g−1 fresh weight. H2 O2 was visually detected in the leaves of Arabidopsis using DAB, as reported by Romero-Puertas et al. [23]. After staining, the leaves were bleached by immersion in 95% ethanol, and images were captured using an SMZ 1000 stereomicroscope (Nikon, Tokyo, Japan). 2.4. Determination of plant Cu concentration Rice roots and leaves were harvested and dried for 15 min at 105 ◦ C, and then for 24 h at 80 ◦ C. The dried samples were measured the dry weights and completely digested with extra pure grade HNO3 :HClO4 [87:13, v/v]. Cu concentrations were analyzed with a flame atomic absorption spectrometer (novAA® 400; Analytik Jena, Jena, Germany). Blanks were used for background correction and other sources of error. 2.5. Generation of transgenic Arabidopsis plants expressing OsMT2c The ORF encoding OsMT2c (without the stop codon) was amplified using the primers forward GACTAGTATCACCATGTCGTGCTG and reverse GACTAGTAAGCTTGTTGCAGTTGCAGCAG. The amplified cDNA fragment containing the restriction site SpeI (underlined region) was subcloned in frame in front of the GFP–GUS coding region in the plant binary vector pCAMBIA1304, generating pCAMBIA1304–OsMT2c under control of the CaMV35S promoter. This construct was introduced into Arabidopsis thaliana Col-0 (ecotype Columbia) through an Agrobacterium tumefaciens EHA105-mediated floral dip method [24]. T1 and T2 generation seeds were collected and selected on ½ MS medium containing 25 mg L−1 hygromycin and then tested using semi-quantitative
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
RT-PCR, and the primers used for the internal control gene 18s rRNA were forward CAGACTGTGAAACTGCGAATG and reverse TCGAAAGTTGATAGGGCAGA. T3 or T4 generation homozygous lines were used for further study. We also transformed vector pCAMBIA1304 into Arabidopsis and named the homozygous lines as Ev.
101
staining, the samples were bleached by immersion in 95% ethanol, and images were captured with a Nikon SMZ 1000 stereomicroscope. GUS activity was analyzed quantitatively in 7-day-old transgenic seedlings via fluorometric measurements with 4-MUG as the substrate, as described previously by Lü et al. [26].
2.6. Cu-tolerant phenotype 2.8. Statistical analysis T3 or T4 generation Arabidopsis seeds were sterilized by soaking in 75% ethanol for 1 min and in 10% sodium hypochlorite for 5 min, followed by four to six washes in sterilized water. Stratification was performed at 4 ◦ C for 3 days in the dark, after which seeds were germinated on ½ MS medium containing different concentrations of CuSO4 and transferred to a growth chamber at 22–24 ◦ C with 16 h of light. The 7-day-old seedlings were photographed to show the growth phenotype, and the root length and fresh weight were measured under Cu stress. Samples were stored at −80 ◦ C for further analysis. 2.7. GUS histochemical localization and fluorometric measurement of GUS activity GUS staining was performed with transgenic Arabidopsis at different development stages as described by Jefferson et al. [25]. After
Statistical analysis was performed using one-way analysis of variance with the Statistical Package for the Social Sciences for Windows (ver. 13.0; SPSS Inc., Chicago, IL, USA). Means denoted by the same letter did not differ significantly at P < 0.05 according to a least-significant differences test. Values correspond to means ± SE. 3. Results 3.1. Analysis of OsMT2c in the MT gene family of O. sativa To explore the genomic basis of rice MTs, we identified 15 MT protein products in Release 7 of the MSU Rice Genome Annotation Project (http://rice.plantbiology.msu.edu/). A phylogenetic analysis of putative protein sequences showed that rice MTs were distributed among all four subgroups of plant MTs (Fig. 1A). Type
Fig. 1. Phylogenetic tree of the rice metallothionein (MT) family (A) and alignment of the deduced amino acid sequence of OsMT2c with other type 2 MTs (B). The phylogenetic tree was drawn using MEGA version 6.0 on MT protein sequences using the neighbor-joining method. Rice MT protein names are followed by their locus ID from Release 7 of the MSU Rice Genome Annotation Project.
102
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
Fig. 2. Real-time quantitative RT-PCR analysis the expression of OsMT2c. The OsMT2c mRNA levels in roots (R), leaf sheathes (LS), and leaves (L) of 2-week-old seedlings and in seeds (S) of O. sativa cv. Nipponbare (A). The OsMT2c mRNA levels in roots and leaves of rice seedlings exposed to 0, 5, 10, 25, 50, and 100 mol L−1 CuSO4 for 24 h (B). OsMT2c mRNA levels in roots and leaves of rice seedlings exposed to 10 mol L−1 CuSO4 (C). OsMT2c mRNA levels in roots and leaves of rice seedlings exposed to 10 mmol L−1 H2 O2 (D). GAPDH was used as an internal control.
1-OsMT1 has eight members (a1, a2, b, c, d, e, f, and g), type 2 consists of four members (OsMT2a, 2b, 2c, and 2d), and type 3 comprises two members (OsMT3a and OsMT3b), whereas type 4 has only one member. A multiple sequence alignment was also performed between OsMT2c and other MT2 proteins, including
OsMT2b (U77294) from O. sativa, AtMT2b (NP195858) from A. thaliana, BdMTL (CCYO2587) from Brachypodium distachyon, EcMTL (AJ010162) from Eichhornia crassipes, HvMT2b2 (JN997432) from Hordeum vulgare, TaMT2 (AF470355) from Triticum aestivum, and ZmMTL (BT017417) from Zea mays (Fig. 1B). Multiple alignments
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
103
Fig. 3. Cu and pretreatment with DMTU or Asc induced changes in H2 O2 production and OsMT2c expression. Time course of changes in the contents of H2 O2 in roots and leaves of rice seedlings exposed to 10 mol L−1 CuSO4 (A), the contents of H2 O2 in roots and leaves of rice seedlings under different treatments (B), and the expression levels of OsMT2c in the roots and leaves of rice seedlings under different treatments (C). Two-week-old seedlings were pretreated with 5 mmol L−1 DMTU or 1 mmol L−1 Asc for 6 h, and then exposed to 0.32 (control) or 10 mol L−1 CuSO4 for 24 h.
showed that OsMT2c shared high homology with many MTs from other plant species. The N-terminal and C-terminal domains contained eight and six Cys residues, respectively, separated by a central Cys-free spacer. In agreement with other higher plant MTs, all Cys residues were located in the N- and C-terminal domains of OsMT2c. A cDNA clone, OsMT2c (AB002820), was isolated from O. sativa seedlings. The ORF of the OsMT2c cDNA consisted of 243 nucleotides and encoded 80 amino acids. The full genome sequence of OsMT2c spanned 4084 bp on chromosome 1, which contained three exons and two introns [27]. 3.2. OsMT2c expression is upregulated by Cu and H2 O2 The expression levels of OsMT2c were analyzed in rice organs and tissues using quantitative RT-PCR. The transcript level of OsMT2c was significantly higher in O. sativa leaves and leaf sheathes than in roots, but was extremely weak in seeds (Fig. 2A). To assess inducible expression of OsMT2c, we harvested rice seedlings treated with CuSO4 and H2 O2 and detected the transcriptional level of OsMT2c. Treatment with different concentrations of CuSO4 resulted in the activation of OsMT2c expression in a
dose-dependent manner in roots, the expression level increased after treatment from 5 to 50 mol L−1 and peaked at 50 mol L−1 . A substantially reduced expression at 100 mol L−1 is associated with high concentration of CuSO4 leading rice to wilt and die. The expression levels of OsMT2c in leaves of rice seedlings increased in the presence of CuSO4 at the optimal concentration (10 mol L−1 ) and decreased thereafter (Fig. 2B). Time-course analysis showed the expression of OsMT2c was sustainable increased in roots, and peaked at 48 h in leaves in the presence of 10 mol L−1 CuSO4 (Fig. 2C). The expression of OsMT2c was strongly induced in roots within 1 h after 10 mmol L−1 H2 O2 treatment, and in leaves it was gradually increased with prolonging H2 O2 treatment (Fig. 2D). 3.3. Inhibition of Cu-induced H2 O2 decreases the expression of OsMT2c A wide range of environmental stimuli can transiently increase H2 O2 levels [28]. In this report, Cu stress induced the rapid accumulation of H2 O2 within the first 12 h, and the contents of H2 O2 in roots maintained a higher level from 24 h to 72 h, after that to 96 h a rising trend appeared again (Fig. 3A). H2 O2 formation in leaves of
104
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
Fig. 4. Accumulation of H2 O2 and the relative expression levels of OsMT2c in osapx2 mutant and WT seedlings under normal conditions (control) or CuSO4 treatment. Semiquantitative RT-PCR analysis of OsAPX2 gene expression in roots and leaves of WT and osapx2 mutant seedlings (A), the contents of H2 O2 (B), and the relative expression levels of OsMT2c (C) in the roots and leaves of WT and osapx2 mutant seedlings under normal conditions or Cu stress.
Cu-treated plants gradually increased during 12–72 h of exposure to 10 mol L−1 CuSO4 and then decreased slightly but remained higher than the control. The contents of Cu in roots and leaves were also measured under CuSO4 treatment, and significant increased trends were observed in Fig. S1. Moreover, there was a significant correlation between endogenous H2 O2 and Cu accumulation under copper stress (Fig. S2). To investigate whether the expression of OsMT2c is regulated by Cu-induced H2 O2 (and not Cu alone), we applied two scavengers of H2 O2 to the Cu-treated rice plants. Pretreatment with the H2 O2 scavenger DMTU or Asc efficiently blocked the accumulation of Cuinduced H2 O2 in roots and leaves of rice seedlings (Fig. 3B), and repressed the increase in OsMT2c expression, especially in roots (Fig. 3C).
3.4. T-DNA insertion the OsAPX2 mutant displayed higher H2 O2 accumulation APXs, as enzymatic antioxidants, play an important role in reducing the accumulation of H2 O2 , thereby protecting cells against oxidative damage [6]. A T-DNA insertion was added to the promoter region of OsAPX2 to construct the osapx2 mutant line, which showed significantly lower expression compared to WT seedlings (Fig. 4A). To further investigate the relationship between OsMT2c expression and H2 O2 accumulation, the H2 O2 contents of the osapx2 mutant and WT seedlings were examined when exposed to excessive Cu. H2 O2 accumulation in roots and leaves of the osapx2
mutant was significantly higher than that of WT seedlings grown under normal conditions, and the expression level of OsMT2c in mutant was also higher than that in WT. CuSO4 (10 mol L−1 ) significantly enhanced H2 O2 generation and OsMT2c expression in roots and leaves of WT, but no markly increase was observed in the osapx2 line (Fig. 4B and C).
3.5. OsMT2c enhanced Cu tolerance of Arabidopsis by scavenging ROS To confirm the in vivo functions of the OsMT2c gene in response to heavy metal stress in plants, we generated transgenic Arabidopsis plants overexpressing OsMT2c with GFP–GUS fusions under control of the CaMV 35S promoter. After screening transformants by selecting for hygromycin resistance and PCR amplification with specific primers, expression of the OsMT2c gene was verified using semi-quantitative RT-PCR (Fig. 5A). Histochemical staining of GUS further confirmed the transformation of Arabidopsis with the OsMT2c gene. OsMT2c was expressed in young roots, stems, and leaves of transgenic Arabidopsis, especially in the growing tip, rosette new leaf, cauline leaf, mature flower, young silique, and matured silique, but relatively weak staining was observed in mature roots of transgenic plants (Fig. 5B). Treatment with different concentrations of CuSO4 increased the GUS activity in a dose-dependent manner in transgenic OsMT2c seedlings, while the GUS activity of Ev seedlings was gradually decreased with increasing CuSO4 concentrations (Fig. 6). Under the same Cu concentration
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
Fig. 5. Identification of transgenic Arabidopsis expressing OsMT2c and fluorometric GUS assays in response to Cu stress. RT-PCR analysis of OsMT2c gene expression in WT and T2 generation transgenic Arabidopsis (A). The 18s rRNA was used as an internal control. Histochemical staining of GUS in transgenic Arabidopsis (B): seedlings grown on ½ MS medium at day 3 [1] and day 5 [2]; different types of leaves (3, cotyledon; 4, rosette leaf; 5, cauline leaf), roots [6], and flowers from a 30-dayold transgenic plant grown on soil during floral development (7, mature flower; 8, young silique; 9, matured silique). GUS activity of transgenic MT2c Arabidopsis treated with different concentrations of CuSO4 for 7 days (C). Transgenic Arabidopsis with empty-vector seedlings were used as a control.
treatment, the GUS activity of transgenic OsMT2c rice seedlings was significantly higher than that of Ev seedlings. The increased GUS activity in transgenic seedlings exposed to Cu stress indicated that the heterologous expression OsMT2c protein played a positive role in tolerance to Cu stress in Arabidopsis. On normal MS medium, the two transgenic lines showed slightly better growth than WT seedlings (Fig. 6A). Exposure of the plants to 35 mol L−1 CuSO4 significantly decreased root elongation (Fig. 6B) and fresh weight (Fig. 6C) in WT seedlings compared to transgenic OsMT2c seedlings. In WT seedlings, the root elongation and fresh weight decreased to 88.1% and 90.0%, respectively, of the control, while no significant difference was observed in transgenic OsMT2c seedlings grown in the presence or absence of CuSO4 . H2 O2 was detected in leaves in situ using DAB histochemical staining methods. Treatment with 35 mol L−1 CuSO4 or 10 mol L−1 MV led to an obvious accumulation of H2 O2 in the leaves of WT and Ev Arabidopsis, whereas the production of H2 O2 was considerably lower in the two OsMT2c transgenic lines (Fig. 7). 4. Discussion Cu is an essential micronutrient for plants, but is also an environmental pollutant that severely affects plants growth and
105
agricultural productivity. Cu toxicity causes an oxidative burst with rapid H2 O2 production and release into the apoplast of plants [29–32]. In the present study, both Cu and H2 O2 activated the transcriptional level of OsMT2c (Fig. 2). However, whether a correlation exists between the expression of MTs and Cu-enhanced H2 O2 levels in plants remained unclear. In this study, using pharmacological H2 O2 scavengers DMTU and Asc before copper stress, the results showed they blocked the elevated accumulation of H2 O2 and expression of Cu-induced OsMT2c in roots and leaves (Fig. 3). Similarly, a rice osapx2 mutant, disruption of cytosolic OsAPX2 led to an intracellular ROS imbalance [33]. OsMT2c expression and the H2 O2 level were much higher than in WT under normal conditions (Fig. 4). This suggested that H2 O2 as a signal molecular modulated the expression of various genes, including those encoding antioxidants and modulators of H2 O2 production [34]. Meanwhile, the Cu-induced H2 O2 production might act upstream of MT2c activation in the induction of Cu stress. Unexpectedly, in contrast to the WT seedlings, the accumulation of H2 O2 in osapx2 mutant treated with Cu did not increase, suggesting that disruption of APX2 activated redundant H2 O2 -scavenging pathways, reducing H2 O2 accumulation or suppressing its production [35,36]. Even so, OsMT2c expression was associated with the H2 O2 level in osapx2 mutant under Cu stress. The above results suggested that H2 O2 was required for the activation of OsMT2c in rice response to Cu stress. In contrast, Cu alone (but not oxidative stress) was reported to induce CuMT gene expression in Neurospora crassa [37]. This contrary result may be due to the metal response elements (MREs) presented in upstream region of the MT gene in lower and higher forms of eukaryotes [37]. MRE-like motifs have been identified in the promoters of several MT genes, such as Cu- and Zn-inducible ricMT of rice [26], LeMTB of tomato [38] and PaMT3b of poplar [39]. No MRE motif was found in the promoter of MT3 (CitMT45) of Citrus unshiu, which is not responsive to metal treatments [40]. In the rice MT gene OsMT2c, several promoter regions responsible for organ-specific expression, wound induction, light, abscisic acid (ABA), Cu and Zn responses have been identified [26,41]. Evidence that MTs contribute to metal tolerance in plants is limited. Significant differences in tolerance to Cu were observed between MT-overexpressing and WT seedlings (Figs. 6 and 7) and similar results were obtained when comparing metal tolerance [42,43]. Murphy and Taiz [44,45] also reported a striking correlation between expression of MT2a RNA and Cu tolerance in a group of Arabidopsis ecotypes. The enhanced copper tolerance might due to the antioxidant function of MTs with a large number of Cys residues, which are capable of ROS scavenging [8]. Other mechanisms, including metal transport and compartmentation, are likely to be more important for Cu in most plants [46–49]. In addition, decreasing ROS accumulation in the transgenic lines suggested that ROS-scavenging systems in these plants more effectively than in WT. MTs may also enhance plant stress tolerance through the upregulation of anti-oxidative enzymes to maintain the redox balance and thereby reduce ROS-induced injury [14,17,43,50,51]. MT-overexpressing plants or yeast have a more efficient antioxidant system with increased enzyme activities [52–54]. In the present study, however, it is not clear whether MTs act as efficient scavengers of ROS or as regulators of genes encoding ROS-scavenging enzymes in plant responses to oxidative stress. In conclusion, this study proves the induced expression of OsMT2c under copper stress is regulated by H2 O2 , not directly by Cu alone. Moreover, overexpression of OsMT2c gene is associated with diminished ROS accumulation, and then significantly enhanced tolerance of Arabidopsis against abiotic stress. The mechanisms of the elevated Cu tolerance including binding of OsMT2c with Cu and improving the antioxidant system are still need to assess in further study.
106
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
Fig. 6. Tolerance to Cu stress of WT Arabidopsis and transgenic seedlings expressing OsMT2c. The growth phenotype on ½ MS with or without 35 mol L−1 CuSO4 for 7 days (A) and the effect of Cu stress on the root length (B) and fresh weight (C) in WT and transgenic lines. Bar = 5 mm. At least 30 seedlings of every line were measured.
Fig. 7. Histochemical localization of H2 O2 by DAB staining under Cu and MV treatment. Bar = 1 mm.
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
Acknowledgments This work was financially supported by the National Natural Science Foundation of China (31172021, 31201146, 31471938), the Doctoral Program Foundation of Institutions of Higher Education of China (20120097130004), the Fundamental Research Funds for the Central Universities (KYZ201316), and the Innovative Research Team Development Plan of the Ministry of Education of China (IRT1256). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jhazmat. 2015.03.060.
[21]
[22]
[23]
[24]
[25]
[26]
References [27] [1] S.S. Sharma, K.J. Dietz, The relationship between metal toxicity and cellular redox imbalance, Trends Plant Sci. 14 (2009) 43–50. [2] A. Schützendübel, A. Polle, Plant responses to abiotic stresses: heavy metal-induced oxidative stress and protection by mycorrhization, J. Exp. Bot. 53 (2002) 1351–1365. [3] B. Halliwell, Reactive species and antioxidants. Redox biology is a fundamental theme of aerobic life, Plant Physiol. 141 (2006) 312–322. [4] L. Contreras, D. Mella, A. Moenne, J.A. Correa, Differential responses to copper-induced oxidative stress in the marine macroalgae Lessonia nigrescens and Scytosiphon lomentaria (Phaeophyceae), Aquat. Toxicol. 94 (2009) 94–102. [5] V. Petrov, V. Vermeirssen, I. De Clercq, F. Van Breusegem, I. Minkov, K. Vandepoele, T.S. Gechev, Identification of cis-regulatory elements specific for different types of reactive oxygen species in Arabidopsis thaliana, Gene 499 (2012) 52–60. [6] R. Mittler, Oxidative stress, antioxidants and stress tolerance, Trends Plant Sci. 7 (2002) 405–410. [7] H.L. Wong, T. Sakamoto, T. Kawasaki, K. Umemura, K. Shimamoto, Down-regulation of metallothionein, a reactive oxygen scavenger, by the small GTPase OsRac1 in rice, Plant Physiol. 135 (2004) 1447–1456. [8] V.H. Hassinen, A.I. Tervahauta, H. Schat, S.O. Kärenlampi, Plant metallothioneins – metal chelators with ROS scavenging activity? Plant Biol. 13 (2011) 225–232. [9] C. Cobbett, P. Goldsbrough, Phytochelatins and metallothioneins: roles in heavy metal detoxification and homeostasis, Annu. Rev. Plant Biol. 53 (2002) 159–182. [10] N. Thirumoorthy, A. Shyam Sunder, K.T. Manisenthil Kumar, M. Senthil Kumar, G.N.K. Ganesh, M. Chatterjee, A review of metallothionein isoforms and their role in pathophysiology, World J. Surg. Oncol. 9 (2011) 54. [11] G. Mir, J. Domènech, G. Huguet, W.J. Guo, P. Goldsbrough, S. Atrian, M. Molinas, A plant type 2 metallothionein (MT) from cork tissue responds to oxidative stress, J. Exp. Bot. 55 (2004) 2483–2493. [12] W.J. Guo, M. Meetam, P.B. Goldsbrough, Examining the specific contributions of individual Arabidopsis metallothioneins to copper distribution and metal tolerance, Plant Physiol. 146 (2008) 1697–1706. [13] C.S. Gu, L.Q. Liu, Y.H. Zhao, Y.M. Deng, X.D. Zhu, S.Z. Huang, Overexpression of Iris lactea var. chinensis metallothionein llMT2a enhances cadmium tolerance in Arabidopsis thaliana, Ecotoxicol. Environ. Saf. 105 (2014) 22–28. [14] Y. Xia, Y. Qi, Y. Yuan, G. Wang, J. Cui, Y. Chen, H. Zhang, Z. Shen, Overexpression of Elsholtzia haichowensis metallothionein 1 (EhMT1) in tobacco plants enhances copper tolerance and accumulation in root cytoplasm and decreases hydrogen peroxide production, J. Hazard. Mater. 233–234 (2012) 65–71. [15] G. Kumar, H.R. Kushwaha, V. Panjabi-Sabharwal, S. Kumari, R. Joshi, R. Karan, S. Mittal, S.L.S. Pareek, A. Pareek, Clustered metallothionein genes are co-regulated in rice and ectopic expression of OsMT1e-P confers multiple abiotic stress tolerance in tobacco via ROS scavenging, BMC Plant Biol. 12 (2012) 107. [16] J. Yuan, D. Chen, Y. Ren, X. Zhang, J. Zhao, Characteristic and expression analysis of a metallothionein gene, OsMT2b, down-regulated by cytokinin suggests functions in root development and seed embryo germination of rice, Plant Physiol. 146 (2008) 1637–1650. [17] Z. Yang, Y. Wu, Y. Li, H.Q. Ling, C. Chu, OsMT1a a type 1 metallothionein, plays the pivotal role in zinc homeostasis and drought tolerance in rice, Plant Mol. Biol. 70 (2009) 219–229. [18] W. Zhu, D.X. Zhao, Q. Miao, T.T. Xue, X.Z. Li, C.C. Zheng, Arabidopsis thaliana metallothionein, AtMT2a, mediates ROS balance during oxidative stress Arabidopsis thaliana metallothionein, AtMT2a, mediates ROS balance during oxidative stress, J. Plant Biol. 52 (2009) 585–592. [19] S.H. Kim, H.S. Lee, W.Y. Song, K.S. Choi, Y. Hur, Chloroplast-targeted BrMT1 (Brassica rapa type-1 metallothionein) enhances resistance to cadmium and ROS in transgenic Arabidopsis plants, J. Plant Biol. 50 (2007) 1–7. ´ D.B. Nikolic, ´ G.S. Timotijevic, ´ S. Zˇ . Jovanovic, ´ M. Ð. Milisavljevic, ´ [20] J.T. Samardˇzic, ´ Tissue expression analysis of FeMT3, a drought and V.R. Maksimovic,
[28] [29]
[30] [31] [32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
[44]
[45]
[46]
[47]
107
oxidative stress related metallothionein gene from buckwheat (Fagopyrum esculentum), J. Plant Physiol. 167 (2010) 1407–1411. Y. Lv, X. Deng, L. Quan, Y. Xia, Z. Shen, Metallothioneins BcMT1 and BcMT2 from Brassica campestris enhance tolerance to cadmium and copper and decrease production of reactive oxygen species in Arabidopsis thaliana, Plant Soil 367 (2013) 507–519. F. Loreto, V. Velikova, Isoprene produced by leaves protects the photosynthetic apparatus against ozone damage, quenches ozone products, and reduces lipid peroxidation of cellular membranes, Plant Physiol. 127 (2001) 1781–1787. M.C. Romero-Puertas, M. Rodríguez-Serrano, F.J. Corpas, M. Gómez, L.A. del Río, L.M. Sandalio, Cadmium-induced subcellular accumulation of O2 − and H2 O2 in pea leaves, Plant Cell Environ. 27 (2004) 1122–1134. S.J. Clough, A.F. Bent, Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana, Plant J. 16 (1998) 735–743. R.A. Jefferson, T.A. Kavanagh, M.W. Bevan, GUS fusions: ˇ-glucuronidase as a sensitive and versatile gene fusion marker in higher plants, EMBO J. 6 (1987) 3901–3907. S. Lü, H. Gu, X. Yuan, X. Wang, A.M. Wu, L. Qu, J.Y. Liu, The GUS reporter-aided analysis of the promoter activities of a rice metallothionein gene reveals different regulatory regions responsible for tissue-specific and inducible expression in transgenic Arabidopsis, Transgenic Res. 16 (2007) 177–191. G. Zhou, Y. Xu, J. Li, L. Yang, J.Y. Liu, Molecular analyses of the metallothionein gene family in rice (Oryza sativa L.), J. Biochem. Mol. Biol. 39 (2006) 595–606. V.D. Petrov, F. Van Breusegem, Hydrogen peroxide – a central hub for information flow in plant cells, AoB Plants 177 (2012) pls014. C.M. André, Y. Larondelle, D. Evers, Dietary antioxidants and oxidative stress from a human and plant perspective: a review, Curr. Nutr. Food Sci. 6 (2010) 2–12. G.J. Brewer, Copper toxicity in the general population, Clin. Neurophysiol. 121 (2010) 459–460. S. Choudhury, P. Panda, L. Sahoo, S.K. Panda, Reactive oxygen species signaling in plants under abiotic stress, Plant Signaling Behav. 8 (2013) e23681. T.C. Thounaojam, P. Panda, S. Choudhury, H.K. Patra, S.K. Panda, Zinc ameliorates copper-induced oxidative stress in developing rice (Oryza sativa L.) seedlings, Protoplasma 251 (2014) 61–69. Z. Zhang, Q. Zhang, J. Wu, X. Zheng, S. Zheng, X. Sun, Q. Qiu, T. Lu, Gene knockout study reveals that cytosolic ascorbate peroxidase 2 (OsAPX2) plays a critical role in growth and reproduction in rice under drought, salt and cold stresses, PLoS One 8 (2013) e57472. R. Desikan, S. A-H-Mackerness, J.T. Hancock, S.J. Neill, Regulation of the Arabidopsis transcriptome by oxidative stress, Plant Physiol. 127 (2001) 159–172. S.B. Rosa, A. Caverzan, F.K. Teixeira, F. Lazzarotto, J.A.G. Silveira, S.L. Ferreira-Silva, J. Abreu-Neto, R. Margis, M. Margis-Pinheiro, Cytosolic APx knockdown indicates an ambiguous redox responses in rice, Phytochemistry 71 (2010) 548–558. N. Suzuki, G. Miller, H. Sejima, J. Harper, R. Mittler, Enhanced seed production under prolonged heat stress conditions in Arabidopsis thaliana plants deficient in cytosolic ascorbate peroxidase 2, J. Exp. Bot. 64 (2013) 253–263. K.S. Kumar, S. Dayananda, C. Subramanyam, Copper alone, but not oxidative stress, induces copper-metallothionein gene in Neurospora crassa, FEMS Microbiol. Lett. 242 (2005) 45–50. C.A. Whitelaw, J.A. Le Huquet, D.A. Thurman, A.B. Tomsett, The isolation and characterisation of type II metallothionein-like genes from tomato (Lycopersicon esculentum L.), Plant Mol. Biol. 33 (1997) 503–511. M. Berta, A. Giovannelli, E. Potenza, M.L. Traversi, M.L. Racchi, Type 3 metallothioneins respond to water deficit in leaf and in the cambial zone of white poplar (Populus alba), J. Plant Physiol. 166 (2009) 521–530. T. Endo, T. Shimada, H. Fujii, T. Moriguchi, M. Omura, Promoter analysis of a type 3 metallothionein-like gene abundant in Satsuma mandarin (Citrus unshiu Marc.) fruit, Sci. Hortic. 112 (2007) 207–214. Y. Ren, J. Zhao, Functional analysis of the rice metallothionein gene OsMT2b promoter in transgenic Arabidopsis plants and rice germinated embryos, Plant Sci. 176 (2009) 528–538. Y.O. Kim, S. Jung, K. Kim, H.J. Bae, Role of pCeMT a putative metallothionein from Colocasia esculenta, in response to metal stress, Plant Physiol. Biochem. 64 (2013) 25–32. J. Zhang, M. Zhang, S. Tian, L. Lu, M.J.I. Shohag, X. Yang, Metallothionein 2 (SaMT2) from Sedum alfredii hance confers increased Cd tolerance and accumulation in yeast and tobacco, PLoS One 9 (2014) e102750. A. Murphy, L. Taiz, A new vertical mesh transfer technique for metal-tolerance studies in Arabidopsis (ecotypic variation and copper-sensitive mutants), Plant Physiol. 108 (1995) 29–38. A. Murphy, L. Taiz, Comparison of metallothionein gene expression and nonprotein thiols in ten Arabidopsis ecotypes. Correlation with copper tolerance, Plant Physiol. 109 (1995) 945–954. M.R. Benatti, N. Yookongkaew, M. Meetam, W.J. Guo, N. Punyasuk, S. AbuQamar, P. Goldsbrough, Metallothionein deficiency impacts copper accumulation and redistribution in leaves and seeds of Arabidopsis, New Phytol. 202 (2014) 940–951. ˜ L. Penarrubia, N. Andrés-Colás, J. Moreno, S. Puig, Regulation of copper transport in Arabidopsis thaliana: a biochemical oscillator? J. Biol. Inorg. Chem. 15 (2010) 29–36.
108
J. Liu et al. / Journal of Hazardous Materials 294 (2015) 99–108
[48] M. Pilon, C.M. Cohu, K. Ravet, S.E. Abdel-Ghany, F. Gaymard, Essential transition metal homeostasis in plants, Curr. Opin. Plant Biol. 12 (2009) 347–357. [49] J.L. Burkhead, K.A. Gogolin Reynolds, S.E. Abdel-Ghany, C.M. Cohu, M. Pilon, Copper homeostasis, New Phytol. 182 (2009) 799–816. [50] B. Zhou, W. Yao, S. Wang, X. Wang, T. Jiang, The metallothionein gene, TaMT3, from Tamarix androssowii confers Cd2+ tolerance in tobacco, Int. J. Mol. Sci. 15 (2014) 10398–10409. [51] Y. Zhou, P. Chu, H. Chen, Y. Li, J. Liu, Y. Ding, E.W.T. Tsang, L. Jiang, K. Wu, S. Huang, Overexpression of Nelumbo nucifera metallothioneins 2a and 3 enhances seed germination vigor in Arabidopsis, Planta 235 (2012) 523–537.
[52] R.M. Nezhad, A. Shahpiri, A. Mirlohi, Discrimination between two rice metallothionein isoforms belonging to type 1 and type 4 in metal-binding ability, Biotechnol. Appl. Biochem. 60 (2013) 275–282. [53] T. Xue, X. Li, W. Zhu, C. Wu, G. Yang, C. Zheng, Cotton metallothionein GhMT3a, a reactive oxygen species scavenger, increased tolerance against abiotic stress in transgenic tobacco and yeast, J. Exp. Bot. 60 (2009) 339–349. [54] J. Yang, Y. Wang, G. Liu, C. Yang, C. Li, Tamarix hispida metallothionein-like ThMT3, a reactive oxygen species scavenger, increases tolerance against Cd2+ , Zn2+ , Cu2+ , and NaCl in transgenic yeast, Mol. Biol. Rep. 38 (2011) 1567–1574.
