Research article
Copper induces – and copper chelation by tetrathiomolybdate inhibits – endothelial activation in vitro Hao Wei 1,2, Wei-Jian Zhang 1, Renee LeBoeuf 2, Balz Frei 1 1
Linus Pauling Institute, Oregon State University, Corvallis, OR 97331, USA, 2Department of Medicine, University of Washington, Seattle, WA 98109, USA Endothelial activation with increased expression of cellular adhesion molecules and chemokines critically contributes to vascular inflammation and atherogenesis. Redox-active transition metal ions play an important role in vascular oxidative stress and inflammation. Therefore, the goal of the present study was to investigate the role of copper in endothelial activation and the potential anti-inflammatory effects of copper chelation by tetrathiomolybdate (TTM) in human aortic endothelial cells (HAECs). Incubating HAECs with cupric sulfate dose- and time-dependently increased mRNA and protein expression of vascular cell adhesion molecule-1 (VCAM-1), intercellular adhesion molecule-1 (ICAM-1), and monocyte chemotactic protein-1 (MCP-1). Copper also activated the redox-sensitive transcription factors, nuclear factor kappa B (NF-κB) and activator protein-1 (AP-1), which was inhibited by pretreatment of the cells with TTM. Furthermore, TTM dose-dependently inhibited tumor necrosis factor α (TNFα)-induced activation of NF-κB and AP-1, as well as mRNA and protein expression of VCAM-1, ICAM-1, and MCP-1, which was abolished by preincubating the cells with 5 μM TTM and 15 μM cupric sulfate. The inhibitory effect of TTM on TNFα-induced NF-κB activation was associated with decreased phosphorylation and degradation of IκBα. These data suggest that intracellular copper causes activation of redox-sensitive transcription factors and upregulation of inflammatory mediators in endothelial cells. Copper chelation by TTM may attenuate TNFα-induced endothelial activation and, hence, inhibit vascular inflammation and atherosclerosis. Keywords: Endothelial activation, Metal chelation, NF-κB, AP-1, Vascular inflammation
Introduction As the leading cause of morbidity and mortality in developed countries, atherosclerosis is increasingly recognized as a chronic inflammatory disease of the vasculature.1–4 The single layer of endothelial cells lining vascular walls serves not only as a physical barrier but also exerts numerous physiological functions,5 of which modulation of innate immunity plays a critical role in atherosclerosis. Exposure of vascular endothelial cells to inflammatory stimuli, such as pro-inflammatory cytokines, bacterial endotoxin, or oxidized lipoproteins, causes increased expression of cellular adhesion molecules (CAMs) and interactions with circulating leukocytes.6–8 The main CAMs facilitating attraction and attachment of leukocytes to the endothelium are E-selectin, vascular cell adhesion molecule-1 (VCAM-1), and intercellular
Correspondence to: Wei-Jian Zhang or Balz Frei, Linus Pauling Institute, Oregon State University, Corvallis, OR 97331, USA. Email: weijian. [email protected]; [email protected]
40
© W. S. Maney & Son Ltd 2014 DOI 10.1179/1351000213Y.0000000070
adhesion molecule-1 (ICAM-1). Endothelial cells also synthesize and secrete chemokines that promote recruitment and transendothelial migration of leukocytes, in particular monocyte chemotactic protein-1 (MCP-1).9 The subsequent activation of local leukocytes triggers the release of additional cytokines, chemokines, and growth factors, thereby promoting atherogenesis.10,11 Endothelial expression of CAMs and chemokines induced by pro-inflammatory cytokines, such as tumor necrosis factor α (TNFα), is mediated by activation of the transcription factors, such as nuclear factor kappa B (NF-κB), activator protein-1 (AP-1), and specificity protein-1 (SP-1).12–17 Endothelial activation can be elicited not only by pro-inflammatory cytokines but also reactive oxygen species (ROS) that affect redox-sensitive cell signaling pathways and transcription factors.18,19 Copper is an essential trace element required for various cellular functions, e.g., cellular energy production, ROS scavenging, and angiogenesis.20,21
Redox Report
2014
VOL.
19
NO.
1
Wei et al.
As a redox-active transition metal, copper can act as an electron carrier to catalyze the generation of ROS, potentiating oxidative stress and inducing inflammation.22,23 Copper has been implicated either directly or indirectly in atherosclerosis24 and has been shown to stimulate atherosclerotic lesion formation in rats by inducing vascular inflammation.25 Moreover, copper deficiency downregulates inflammatory cytokine expression in mice.26 Therefore, it is reasonable to hypothesize that copper plays a role in redox-sensitive cell signaling pathways leading to endothelial activation. In the present study, we employed tetrathiomolybdate (TTM), an intracellular copper chelator, to examine the role of copper in endothelial activation. TTM is a small hydrophilic compound that chelates copper with high affinity in a 1 to 3 molar ratio.27 It can form a stable complex with copper and its chaperon, Atx1, thereby disrupting intracellular copper trafficking and downstream copper delivery to cuproproteins.28 In addition to its high specificity for binding copper, TTM also has a good safety index.29,30 TTM has been utilized to chelate copper in animal models of various diseases, including Wilson’s disease, acute inflammation, atherosclerosis, and pulmonary fibrosis.31–35 The goal of the present study was to investigate the role of copper in endothelial inflammation and the potential anti-inflammatory effects of TTM in vascular endothelial cells.
Materials and methods Materials Ammonium tetrathiomolybdate, cupric sulfate, and bovine catalase were purchased from Sigma (St Louis, MO, USA). Human recombinant TNFα was purchased from Roche Applied Science (Indianapolis, IN, USA). Solutions of copper and TTM were prepared by dissolving cupric sulfate and ammonium tetrathiomolybdate, respectively, in Hank’s balanced salt solution (HBSS) (Sigma).
Culture of human aortic endothelial cells Primary human aortic endothelial cells (HAECs) were purchased from Clonetics (San Diego, CA, USA) in passage 3 and cultured in endothelial cell growth medium (Clonetics) at 37°C in a humidified 95% air 5% CO2 cell culture incubator. For experiments, cells were grown to confluence using endothelial culture medium consisting of M199 medium supplemented with 20% fetal bovine serum (Invitrogen, Carlsbad, CA, USA), 100 ng/ml streptomycin, 100 IU/ml penicillin, 1 mM glutamine (Invitrogen), and 1 ng/ml human recombinant basic fibroblast growth factor (Roche Applied Science). HAECs in passage 7 were used in all experiments.
Effects of copper and tetrathiomolybdate on inflammatory gene expression
Treatment of HAECs with copper HAECs were incubated with cupric sulfate (with or without co-incubation of TTM or catalase) for various time periods, viz.: 0, 4, 8, 12, and 16 hours for measurement of mRNA levels of CAMs and MCP-1; 6 hours for measurement of cell surface protein levels of CAMs; and 1 hour for measurement of nuclear transcription factors by enzyme-linked immunosorbent assay (ELISA). Control cells were incubated for the same periods of time with media containing the vehicle HBSS.
Stimulation of TTM-pretreated HAECs with TNFα HAECs were pretreated with the indicated concentrations of TTM (with or without copper) for 24 hours. Subsequently, cells were washed twice with M199 medium and incubated with 50 U/ml TNFα and the same concentration of TTM (and copper) was used during pretreatment for various time periods. Cells were harvested at various time points, viz.: 3 hours for measurement of mRNA levels of CAMs and MCP-1; 6 hours for cell surface protein levels of CAMs and MCP-1 secreted into the medium; and 1 hour for measurements of nuclear transcription factors by ELISA and phosphorylation and degradation of IκBα by Western blot.
Measurement of cell surface CAMs by ELISA Cell surface expression of CAMs (VCAM-1, ICAM-1, and E-selectin) was quantified by cell ELISA as described.36 Briefly, ELISA was performed on HAEC monolayers in flat-bottom 96-well plates. After treatment, cells were fixed before incubation with a primary mouse monoclonal anti-human antibody to either VCAM-1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), ICAM-1 (R&D Systems, Minneapolis, MN, USA), or E-selection (R&D Systems). Cells were then incubated with a horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG secondary antibody (Cell Signaling Technology, Danvers, MA, USA) at 37°C for 1 hour. Protein levels of VCAM-1, ICAM-1, and E-selectin were measured by the absorbance at 492 nm using a microplate spectrophotometer after addition of the peroxidase substrate, o-phenylendiaminehydrochloride (Sigma).
Measurement of mRNA levels of CAMs and MCP-1 Total cellular RNA was isolated from HAECs using TRIzol Reagent from Invitrogen. Messenger RNA levels of VCAM-1, ICAM-1, MCP-1, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were quantitated using real-time quantitative polymerase chain reaction (qPCR). First-strand cDNA was synthesized using the High Capacity cDNA
Redox Report
2014
VOL.
19
NO.
1
41
Wei et al.
Effects of copper and tetrathiomolybdate on inflammatory gene expression
Table 1
SYBR green PCR primers (5′ →3′ )
VCAM-1 ICAM-1 MCP-1 GAPDH
Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse:
GGGAAGATGGTCGTGATCCTT TCTGGGGTGGTCTCGATTTTA TTGGGCATAGAGACCCCGTT GCACATTGCTCAGTTCATACACC CAGCCAGATGCAATCAATGCC TGGAATCCTGAACCCACTTCT ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC
Archive Kit from Applied Biosystems (Foster City, CA, USA). All primers were obtained from Invitrogen (Table 1) and SYBR Green reagents were purchased from Applied Biosystems. Real-time qPCR was performed in 25-μl reaction, with a standard curve constructed for each gene in every PCR run, using DNA Engine Opticon 2 Real-Time PCR Detection System from Bio-Rad Laboratories (Waltham, MA, USA). After normalization to the internal control gene, GAPDH, for each sample, the result for each target gene was expressed as fold change of control.
Measurement of secreted MCP-1 in the culture medium After treatment, cell culture medium was collected and cell debris was removed by centrifugation. Levels of MCP-1 were measured using an ELISA kit from R&D Systems according to the manufacturer’s instructions. The sensitivity of the ELISA kit is 2 pg/ml of MCP-1.
Western blot analysis Cell lysate was prepared from HAECs after treatment. Protein samples of 20 μg were separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) on 4–12% bis-tris gel (Invitrogen) and transferred onto nitrocellulose membrane (Invitrogen). Membranes were incubated with rabbit anti-human IκBα or phospho-IκBα antibody (Cell Signaling Technology), and then probed with an HRP conjugated donkey anti-rabbit secondary antibody (Cell Signaling Technology). Immunoreactive bands were detected by the enhanced chemiluminescence detection system (GE Healthcare Life Sciences, Piscataway, NJ, USA). Bands were visualized and quantified on the Alpha Innotech photodocumentation system (Alpha Innotech Corp., San Leandro, CA, USA). To ensure equal loading, all blots were probed for β-actin (Santa Cruz Biotechnology).
Measurement of nuclear transcription factors Nuclear proteins were extracted from HAECs immediately after harvesting, using a nuclear protein extraction kit from Active Motif (Carlsbad, CA, USA) according to the manufacturer’s instructions. Nuclear
42
Redox Report
2014
VOL.
19
NO.
1
protein levels of the NF-κB subunit, p65, and the AP-1 subunit, c-fos, were measured using Trans-AM ELISA kits from Active Motif according to the manufacturer’s instructions.
Statistical analysis All results are reported as mean ± SEM and analyzed using non-parametric analysis of variance (ANOVA) followed by multiple comparisons (Bonferroni correction) as appropriate. Dose- and time-dependency were analyzed by linear regression. Differences are considered statistically significant at the P < 0.05 level.
Results Copper time- and dose-dependently upregulates gene transcription of CAMs and MCP-1 Treating HAECs with 100 μM copper time-dependently increased mRNA levels of VCAM-1, ICAM-1, and MCP-1, with maximum induction of 4.2-, 3.0-, and 5.8-fold, respectively, after 4 hours of incubation (Fig. 1A–C). After 12 hours of incubation, mRNA levels returned to baseline. To investigate whether induction of inflammatory gene expression by copper was dose-dependent, HAECs were incubated with 10–100 μM copper for 4 hours and mRNA levels of CAMs and MCP-1 were assessed. As shown in Fig. 1D, ≥25 μM copper significantly increased mRNA levels of VCAM-1 and MCP-1, while ICAM-1 gene expression was significantly increased by ≥50 μM copper. Maximum induction was effected by 100 μM copper, which increased mRNA levels of VCAM-1, ICAM-1, and MCP-1 by 3.6-, 3.1-, and 4.6-fold, respectively. Free, non-protein bound copper can participate in free radical reactions generating ROS. Addition of copper to the cell culture medium may produce extracellular superoxide and hydrogen peroxide. To determine whether exogenous hydrogen peroxide was involved in copper-induced activation of HAECs, cells were co-incubated with copper and catalase, which catalyzes the decomposition of hydrogen peroxide to water and oxygen. As shown in Fig. 1D, addition of catalase (50 U/ml) did not inhibit gene expression of CAMs and MCP-1 induced by 100 μM copper. In contrast, co-incubation of HAECs with 100 μM copper and 25 μM TTM abolished the copper-induced increase in inflammatory gene expression (Fig. 1D). Finally, up to 200 μM copper, or 50 μM TTM, or their mixture did not cause any adverse effects on cell viability, as assessed by the MTT assay (data not shown).
Wei et al.
Effects of copper and tetrathiomolybdate on inflammatory gene expression
Figure 1 Copper time- and dose-dependently upregulates gene transcription of CAMs and MCP-1. HAECs were incubated for up to 16 hours in ECM without (control) or with 100 μM cupric sulfate (A–C), or for 4 hours in ECM without (control) or with 10 to 100 μM cupric sulfate, 50 U/ml catalase, or 25 μM TTM (D). Total RNA was extracted and mRNA levels of VCAM-1 (A and D), MCP1 (B and D), and ICAM-1 (C and D) were measured by real-time qPCR as described in Materials and methods. Data are presented as fold of control at the 0-hour time-point and represent the mean ± SEM of three independent experiments. Asterisks denote statistically significant differences in mRNA levels compared to control (ANOVA, P < 0.05). ‘#’ denotes statistically significant differences compared to cells treated with 100 μM cupric sulfate (ANOVA, P < 0.05).
Copper dose-dependently increases cell surface protein levels of CAMs and stimulates NF-κB and AP-1 activation In concert with upregulation of gene transcription, 10–100 μM copper dose-dependently increased protein levels of CAMs on HAECs (P < 0.05, linear regression) (Fig. 2A). Maximum induction was reached with 50–100 μM copper. Treatment of the cells with 100 μM copper increased protein levels of VCAM-1, ICAM-1, and E-selectin by 4.2-, 3.6-, and 8.9-fold, respectively. However, co-treatment of HAECs with 100 μM copper and 25 μM TTM suppressed the copper-induced increase of VCAM-1, ICAM-1, and E-selectin by 66, 76, and 87%, respectively (P < 0.05, ANOVA), whereas treatment of HAECs with 25 μM TTM alone did not have any effect (Fig. 2A). To investigate whether activation of the redox-sensitive transcription factors, NF-κB and AP-1, mediates the effect of copper on inflammatory gene expression, HAECs were incubated with 100 μM copper for 1 hour and nuclear extracts were prepared and analyzed by ELISA for the NF-κB subunit, p65, and the AP-1 subunit, c-fos. In the presence of 100 μM copper NF-κB and AP-1 were significantly activated by 2.4and 1.5-fold, respectively (P < 0.05, ANOVA). Copper-induced NF-κB and AP-1 activation was
abolished by co-treatment of HAECs with 100 μM copper and 25 μM TTM, whereas 25 μM TTM alone had no effect (Fig. 2B).
TTM dose-dependently inhibits TNFα-induced upregulation of mRNA and protein levels of CAMs and MCP-1 The above observation that incubation of HAECs with copper induces NF-κB and AP-1 activation and inflammatory gene expression suggests that copper may also play a critical role in endothelial activation induced by other inflammatory stimuli, such as TNFα. To address this question, HAECs were pretreated with TTM for 24 hours to chelate intracellular copper and then stimulated with TNFα (50 U/ml). As shown in Fig. 3A, TTM in concentrations of 5 to 25 μM dose-dependently inhibited TNFα-induced gene expression of CAMs and MCP-1. The TNFαinduced increase of VCAM-1, ICAM-1, and MCP-1 mRNA levels was significantly inhibited by 77, 52, and 70%, respectively, by 25 μM TTM (P < 0.05, ANOVA) (Fig. 3A). However, preincubating the cells with 5 μM TTM plus 15 μM cupric sulfate completely abolished the TTM’s inhibitory effect (Fig. 3B). These data suggest that the inhibitory effect of TTM on endothelial activation is due to copper chelation rather than other, non-specific (antioxidant) effects.
Redox Report
2014
VOL.
19
NO.
1
43
Wei et al.
Effects of copper and tetrathiomolybdate on inflammatory gene expression
Figure 2 Copper dose-dependently increases cell surface protein levels of CAMs and induces NF-κB and AP-1 activation. For (A), HAECs were incubated for 6 hours in ECM without (control) or with 10–100 μM cupric sulfate or 25 μM TTM, and cell surface protein levels of VCAM-1, ICAM-1, and E-selectin were measured by cell ELISA as described in Materials and methods. Data are presented as OD 492 nm values and represent the mean ± SEM of three independent experiments. For (B), HAECs were incubated for 1 hour in ECM without (control) or with 100 μM cupric sulfate or 25 μM TTM. Nuclear proteins were extracted and levels of the NF-κB subunit, p65, and the AP-1 subunit, c-fos, were measured by ELISA as described in Materials and methods. Data represent the mean ± SEM of three independent experiments. Asterisks denote statistically significant differences compared to control (ANOVA, P < 0.05). ‘#’denotes statistically significant differences compared to cells treated with 100 μM cupric sulfate (ANOVA, P < 0.05).
In concert with decreased gene transcription, TTM dose-dependently inhibited the TNFα-induced increase in protein levels of CAMs and MCP-1. Treating HAECs with 25 μM TTM caused maximum reduction of VCAM-1, ICAM-1, E-selectin, and MCP-1 protein levels by 53, 36, 87, and 49%, respectively (P < 0.05, ANOVA) (Fig. 4A and C). As above, treatment of HAECs with only 5 μM TTM also exerted significant inhibitory effects on protein synthesis of VCAM-1, ICAM-1, Eselectin, and MCP-1, which were abolished by preincubation of TTM with 15 μM cupric sulfate (Fig. 4B and D).
44
Redox Report
2014
VOL.
19
NO.
1
Figure 3 Tetrathiomolybdate dose-dependently inhibits TNFα-induced gene transcription of CAMs and MCP-1. HAECs were preincubated for 24 hours in ECM without (control) or with 1 to 25 μM TTM (A) or with 5 μM TTM plus 15 μM cupric sulfate (B). Cells were washed twice with M199 medium and incubated for 4 hours with 50 U/ml TNFα, with (A) or without (B) the same concentration of TTM used during preincubation. Total RNA was extracted and mRNA levels of VCAM-1, ICAM-1, and MCP-1 were measured by real-time qPCR as described in Materials and methods. Data represent the mean ± SEM of three independent experiments. Asterisks denote statistically significant differences compared to control (ANOVA, P < 0.05). ‘#’ denotes statistically significant differences compared to cells treated with 50 U/ml TNFα (ANOVA, P < 0.05). ‘∧’denotes no statistically significant differences compared to cells treated with 50 U/ml TNFα alone.
TTM inhibits TNFα-induced activation of NF-κB and AP-1 In agreement with the above data, TNFα (50 U/ml) strongly induced NF-κB activation in HAECs by more than 4-fold, and was dose-dependently inhibited by 5–25 μM TTM (P < 0.05, linear regression) (Fig. 5). Likewise, AP-1 nuclear levels were increased by 2.2-fold following treatment of HAECs with TNFα, and TTM caused a dose-dependent inhibition (P < 0.05, linear regression) (Fig. 5). These data show that NF-κB plays a particularly important role in mediating TNFα-induced endothelial activation, and NF-κB is more sensitive to be inhibited by TTM than AP-1. To further understand
Wei et al.
Effects of copper and tetrathiomolybdate on inflammatory gene expression
Figure 4 Tetrathiomolybdate dose-dependently inhibits TNFα-induced increase of protein levels of CAMs and MCP-1. HAECs were preincubated for 24 hours without or with TTM or cupric sulfate, washed, and incubated for 6 hours with 50 U/ml TNFα as described in the legend of Fig. 3. Cell surface protein levels of VCAM-1, ICAM-1, and E-selectin (A and B), and protein levels of MCP-1 in the medium (C and D) were measured by ELISA as described in Materials and methods. Data represent the mean ± SEM of three independent experiments. Asterisks denote statistically significant differences compared to control (ANOVA, P < 0.05). ‘#’ denotes statistically significant differences compared to cells treated with 50 U/ml TNFα (ANOVA, P < 0.05). ‘∧’denotes no statistically significant differences compared to cells treated with 50 U/ml TNFα alone.
how NF-κB activity is affected by TTM, we analyzed phosphorylation and subsequent proteolytic degradation of IκBα, the cytosolic inhibitory subunit of NF-κB. As shown in Fig. 6A, TNFα (50 U/ml) induced a significant increase of IκBα phosphorylation, which was dose-dependently inhibited by 2–20 μM TTM (P < 0.05, linear regression), while 5 μM TTM did not alter baseline phospho-IκBα levels. Based on the densitometry data, the strongest reduction of TNFα-induced IκBα phosphorylation was 43% with 20 μM TTM (Fig. 6B). Treating HAECs with TNFα also caused degradation of IκBα, which was significantly inhibited by 5 and 20 μM TTM (P < 0.05, ANOVA) (Fig. 6A and C). Figure 5 Tetrathiomolybdate inhibits TNFα-induced activation of NF-κB and AP-1. HAECs were preincubated for 24 hours without or with 5 to 25 μM TTM, washed, and incubated for 1 hour with 50 U/ml TNFα as described in the legend of Fig. 3. Nuclear proteins were extracted and levels of the NF-κB subunit, p65, and the AP-1 subunit, c-fos, were measured by ELISA as described in Materials and methods. Data represent the mean ± SEM of three independent experiments. Asterisks denote statistically significant differences compared to control (ANOVA, P < 0.05). ‘#’ denotes statistically significant differences compared to cells treated with 50 U/ml TNFα (ANOVA, P < 0.05).
Discussion In the current study, we investigated two aspects of the ( patho)physiological role of copper in endothelial activation: (i) the capacity of exogenous copper to trigger inflammatory responses in HAECs and (ii) the role of intracellular copper in TNFα-induced HAEC activation, employing the copper chelator TTM. Incubating HAECs with copper led to moderately enhanced expression of CAMs and MCP-1, which
Redox Report
2014
VOL.
19
NO.
1
45
Wei et al.
Effects of copper and tetrathiomolybdate on inflammatory gene expression
Figure 6 Tetrathiomolybdate inhibits TNFα-induced phosphorylation and degradation of IκBα. HAECs were preincubated for 24 hours without or with 2–20 μM TTM, washed, and incubated for 1 hour with 50 U/ml TNFα as described in the legend of Fig. 3. Total protein was extracted and Western blot analysis of phospho-IκBα and IκBα (A) was performed as described in Materials and methods. Densitometric data of phospho-IκBα (B) and IκBα (C) were obtained by analyzing Western blots using the photodocumentation system as described in Materials and methods. Data are presented as the percentage of TNFα stimulation (B) or control (C) and represent the mean ± SEM of three independent experiments. Asterisks denote statistically significant differences compared to control (ANOVA, P < 0.05). ‘#’ denotes statistically significant differences compared to cells treated with 50 U/ml TNFα (ANOVA, P < 0.05).
was accompanied by activation of the redox-sensitive transcription factors, NF-κB and AP-1. As indicated by the lack of effect of extracellular catalase, endothelial activation induced by copper was not due to the extracellular hydrogen peroxide, a ROS potentially generated by free copper ions in cell culture media. Moreover, addition of TTM almost completely abolished copper-induced activation of NF-κB and AP-1 and expression of CAMs and MCP-1, further confirming the direct role of copper in activating aortic
46
Redox Report
2014
VOL.
19
NO.
1
endothelial cells. TTM has been shown to reduce bioavailable copper in humans and animals, likely through formation of a high-affinity tripartite complex with copper and proteins.37 In our study, TTM may have reduced intracellular bioavailable copper by forming a complex with copper and its chaperon, Atx1,28 and/or a complex with copper and extracellular albumin, preventing copper transport into cells. The above data suggest that copper is a functional component of the innate immune system and
Wei et al.
positively regulates inflammatory responses. In agreement with this notion, previous studies have shown that copper deficiency is associated with decreased activation of bovine monocyte-derived macrophages,38 decreased neutrophil function in rats,39 and reduced inflammatory responses in mice.26 Consistent with our previous observations,40 we further confirmed that TNFα-induced activation of NF-κB and AP-1, as well as increased expression of CAMs and MCP-1, were all significantly suppressed by copper chelation with TTM. Preloading TTM with cupric sulfate in a 1:3 ratio to saturate its copper binding sites27 and eliminate its copper chelating capacity lead to a significant loss of the ability of TTM to inhibit TNFα-induced endothelial activation. These data suggest that TTM counteracts the stimulatory effects of TNFα on endothelial cells mainly by copper chelation, not non-specific, antioxidant effects. In agreement with previous findings that NF-κB is the major transcription factor orchestrating innate inflammatory responses in aortic endothelial cells, we observed that NF-κB appeared to be more important than AP-1 in TNFα-stimulated inflammatory signaling in HAECs and was more strongly inhibited by copper chelation with TTM. To further address the underlying mechanism by which TTM down-regulates TNFα-induced activation of NF-κB, we analyzed phosphorylation and degradation of IκBα, a member of the inhibitory protein family of NF-κB that prevents NF-κB from entering the nucleus. Once IκBα is phosphorylated, it is directed for degradation, which releases free cytosolic NF-κB and allows its translocation to the nucleus. Our results suggest that TTM exerts its anti-inflammatory function, in part, through inhibition of the phosphorylation and consequent degradation of IκBα by reducing intracellular bioavailable copper. Inflammatory endothelial activation can be elicited by various stimuli, including pro-inflammatory cytokines, NADPH oxidase-derived ROS, oxidatively modified LDL, and infectious agents.3 Here we have shown that copper, a transition metal ion, can directly induce inflammatory response independent of extracellular hydrogen peroxide production. The concept that TNFα contributes to the development of atherosclerosis is supported by considerable evidence. Elicited by either transition metals or pro-inflammatory cytokines, the endothelium upregulates cell surface expression of CAMs and release of MCP-1, providing a fertile environment for leukocyte adhesion and transmigration into the intima of the vessel wall. The disruption of this environment by relatively low concentrations of TTM, as shown in this study, would hinder the initiation of atherosclerosis. This may explain the beneficial effects of TTM treatment observed in animal models of acute inflammation
Effects of copper and tetrathiomolybdate on inflammatory gene expression
and atherosclerosis,31,32 and may offer a critical opportunity for atherosclerosis treatment or prevention. We acknowledge the limitation that the concentrations of copper used in our study are somewhat supra-physiological. These concentrations may only be achieved under certain conditions, e.g., patients with copper-coated titanium implants for joint replacement41 or suffering from Wilson’s disease.34 Nevertheless, our data support the notion that under pathophysiological conditions, elevated intracellular concentrations of copper may contribute to the innate inflammatory response mediated by redox-sensitive cell signaling pathways including NF-κB and AP-1 activation. We speculate that the inflammation elicited by short time incubations with high concentrations of copper, as observed in our study, may be operative physiologically with lower concentrations of excess copper over long periods of time. The ability of copper to induce low-level inflammation may have relevance to the development of atherosclerosis, which is characterized by chronic vascular inflammation. In conclusion, the present study provides new evidence that an increase of intracellular copper may induce endothelial activation by upregulating CAMs and MCP-1 through activation of NF-κB and AP-1. Our findings reinforce the notion that transition metal ions play a critical role in inflammatory responses, likely through modulating the activity of ROS-sensitive cell signaling pathways. Moreover, our data demonstrate that copper chelation with TTM inhibits TNFα-elicited inflammatory endothelial activation and, hence, may potentially be helpful in ameliorating vascular inflammation and atherosclerosis.
Acknowledgement The work described in this paper was supported by US National Institutes of Health, National Center for Complementary and Alternative Medicine (NCCAM) grant number P01 AT002034 (BF and WJZ). Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the National Institutes of Health.
References 1 Berliner JA, Navab M, Fogelman AM, Frank JS, Demer LL, Edwards PA, et al. Atherosclerosis: basic mechanisms. Oxidation, inflammation, and genetics. Circulation 1995;91: 2488–96. 2 Libby P. What have we learned about the biology of atherosclerosis? The role of inflammation. Am J Cardiol 2001;88:3J–6J. 3 Libby P. Inflammation in atherosclerosis. Nature 2002;420: 868–74. 4 Libby P, Ridker PM, Maseri A. Inflammation and atherosclerosis. Circulation 2002;105:1135–43. 5 Pearson JD. Normal endothelial cell function. Lupus 2000;9: 183–8. 6 Rajavashisth TB, Andalibi A, Territo MC, Berliner JA, Navab M, Fogelman AM, et al. Induction of endothelial cell expression
Redox Report
2014
VOL.
19
NO.
1
47
Wei et al.
Effects of copper and tetrathiomolybdate on inflammatory gene expression
7
8 9
10 11 12 13
14 15
16
17 18 19 20 21 22 23 24 25
48
of granulocyte and macrophage colony-stimulating factors by modified low-density lipoproteins. Nature 1990;344:254–7. Bevilacqua MP, Pober JS, Wheeler ME, Cotran RS, Gimbrone MA, Jr. Interleukin 1 acts on cultured human vascular endothelium to increase the adhesion of polymorphonuclear leukocytes, monocytes, and related leukocyte cell lines. J Clin Invest 1985;76:2003–11. Pober JS, Cotran RS. Cytokines and endothelial cell biology. Physiol Rev 1990;70:427–51. Gu L, Okada Y, Clinton SK, Gerard C, Sukhova GK, Libby P, et al. Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low density lipoprotein receptor-deficient mice. Mol Cell 1998;2:275–81. Ross R. Atherosclerosis – an inflammatory disease. N Engl J Med 1999;340:115–26. Hunt BJ. The endothelium in atherogenesis. Lupus 2000;9: 189–93. Iademarco MF, McQuillan JJ, Rosen GD, Dean DC. Characterization of the promoter for vascular cell adhesion molecule-1 (VCAM-1). J Biol Chem 1992;267:16323–29. Neish AS, Khachigian LM, Park A, Baichwal VR, Collins T. Sp1 is a component of the cytokine-inducible enhancer in the promoter of vascular cell adhesion molecule-1. J Biol Chem 1995;270:28903–09. Neish AS, Williams AJ, Palmer HJ, Whitley MZ, Collins T. Functional analysis of the human vascular cell adhesion molecule 1 promoter. J Exp Med 1992;176:1583–93. Korenaga R, Ando J, Kosaki K, Isshiki M, Takada Y, Kamiya A. Negative transcriptional regulation of the VCAM-1 gene by fluid shear stress in murine endothelial cells. Am J Physiol 1997;273:C1506–1515. Chen YH, Lin SJ, Ku HH, Shiao MS, Lin FY, Chen JW, et al. Salvianolic acid B attenuates VCAM-1 and ICAM-1 expression in TNF-alpha-treated human aortic endothelial cells. J Cell Biochem 2001;82:512–21. Collins T, Cybulsky MI. NF-kappaB: pivotal mediator or innocent bystander in atherogenesis? J Clin Invest 2001;107:255–64. Alom-Ruiz SP, Anilkumar N, Shah AM. Reactive oxygen species and endothelial activation. Antioxid Redox Signal 2008;10:1089–100. Wang S, Leonard SS, Castranova V, Vallyathan V, Shi X. The role of superoxide radical in TNF-alpha induced NF-kappaB activation. Ann Clin Lab Sci 1999;29:192–9. Harris ED. Copper transport: an overview. Proc Soc Exp Biol Med 1991;196:130–40. Linder MC, Hazegh-Azam M. Copper biochemistry and molecular biology. Am J Clin Nutr 1996;63:797S–811S. Wang XF, Cynader MS. Pyruvate released by astrocytes protects neurons from copper-catalyzed cysteine neurotoxicity. J Neurosci 2001;21:3322–31. Cui JZ, Wang XF, Hsu L, Matsubara JA. Inflammation induced by photocoagulation laser is minimized by copper chelators. Lasers Med Sci 2009;24:653–7. Ferns GA, Lamb DJ, Taylor A. The possible role of copper ions in atherogenesis: the Blue Janus. Atherosclerosis 1997;133: 139–52. Volker W, Dorszewski A, Unruh V, Robenek H, Breithardt G, Buddecke E. Copper-induced inflammatory reactions of rat carotid arteries mimic restenosis/arteriosclerosis-like neointima formation. Atherosclerosis 1997;130:29–36.
Redox Report
2014
VOL.
19
NO.
1
26 Pan Q, Kleer CG, van Golen KL, Irani J, Bottema KM, Bias C, et al. Copper deficiency induced by tetrathiomolybdate suppresses tumor growth and angiogenesis. Cancer Res 2002;62: 4854–9. 27 George GN, Pickering IJ, Harris HH, Gailer J, Klein D, Lichtmannegger J, et al. Tetrathiomolybdate causes formation of hepatic copper-molybdenum clusters in an animal model of Wilson’s disease. J Am Chem Soc 2003;125:1704–5. 28 Alvarez HM, Xue Y, Robinson CD, Canalizo-Hernandez MA, Marvin RG, Kelly RA, et al. Tetrathiomolybdate inhibits copper trafficking proteins through metal cluster formation. Science 2010;327:331–4 29 Brewer GJ, Dick RD, Yuzbasiyan-Gurkin V, Tankanow R, Young AB, Kluin KJ. Initial therapy of patients with Wilson’s disease with tetrathiomolybdate. Arch Neurol 1991; 48:42–7. 30 Brewer GJ, Dick RD, Johnson V, Wang Y, Yuzbasiyan-Gurkan V, Kluin K, et al. Treatment of Wilson’s disease with ammonium tetrathiomolybdate. I. Initial therapy in 17 neurologically affected patients. Arch Neurol 1994;51:545–54. 31 Wei H, Frei B, Beckman JS, Zhang WJ. Copper chelation by tetrathiomolybdate inhibits lipopolysaccharide-induced inflammatory responses in vivo. Am J Physiol Heart Circ Physiol 2011;301:H712–720. 32 Wei H, Zhang WJ, McMillen TS, Leboeuf RC, Frei B. Copper chelation by tetrathiomolybdate inhibits vascular inflammation and atherosclerotic lesion development in apolipoprotein E-deficient mice. Atherosclerosis 2012;223:306–13. 33 Brewer GJ. Tetrathiomolybdate anticopper therapy for Wilson’s disease inhibits angiogenesis, fibrosis and inflammation. J Cell Mol Med 2003;7:11–20. 34 Brewer GJ. Copper control as an antiangiogenic anticancer therapy: lessons from treating Wilson’s disease. Exp Biol Med (Maywood) 2001;226:665–73. 35 Brewer GJ, Ullenbruch MR, Dick R, Olivarez L, Phan SH. Tetrathiomolybdate therapy protects against bleomycininduced pulmonary fibrosis in mice. J Lab Clin Med 2003;141: 210–6. 36 Zhang WJ, Frei B. Alpha-lipoic acid inhibits TNF-alphainduced NF-kappaB activation and adhesion molecule expression in human aortic endothelial cells. FASEB J 2001; 15:2423–32. 37 George GN, Pickering IJ, Harris HH, Gailer J, Klein D, Lichtmannegger J, et al. Tetrathiomolybdate causes formation of hepatic copper-molybdenum clusters in an animal model of Wilson’s disease. J Am Chem Soc 2003;125:1704–5. 38 Cerone S, Sansinanea A, Streitenberger S, Garcia C, Auza N. Bovine monocyte-derived macrophage function in induced copper deficiency. Gen Physiol Biophys 2000;19:49–58. 39 Babu U, Failla ML. Copper status and function of neutrophils are reversibly depressed in marginally and severely copperdeficient rats. J Nutr 1990;120:1700–9. 40 Zhang WJ, Frei B. Intracellular metal ion chelators inhibit TNFalpha-induced SP-1 activation and adhesion molecule expression in human aortic endothelial cells. Free Radic Biol Med 2003;34:674–82. 41 Hoene A, Prinz C, Walschus U, Lucke S, Patrzyk M, Wilhelm L, et al. In vivo evaluation of copper release and acute local tissue reactions after implantation of copper-coated titanium implants in rats. Biomed Mater 2013;8:035009.
Copyright of Redox Report is the property of Maney Publishing and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
Copper induces – and copper chelation by tetrathiomolybdate inhibits – endothelial activation in vitro Hao Wei 1,2, Wei-Jian Zhang 1, Renee LeBoeuf 2, Balz Frei 1 1
Linus Pauling Institute, Oregon State University, Corvallis, OR 97331, USA, 2Department of Medicine, University of Washington, Seattle, WA 98109, USA Endothelial activation with increased expression of cellular adhesion molecules and chemokines critically contributes to vascular inflammation and atherogenesis. Redox-active transition metal ions play an important role in vascular oxidative stress and inflammation. Therefore, the goal of the present study was to investigate the role of copper in endothelial activation and the potential anti-inflammatory effects of copper chelation by tetrathiomolybdate (TTM) in human aortic endothelial cells (HAECs). Incubating HAECs with cupric sulfate dose- and time-dependently increased mRNA and protein expression of vascular cell adhesion molecule-1 (VCAM-1), intercellular adhesion molecule-1 (ICAM-1), and monocyte chemotactic protein-1 (MCP-1). Copper also activated the redox-sensitive transcription factors, nuclear factor kappa B (NF-κB) and activator protein-1 (AP-1), which was inhibited by pretreatment of the cells with TTM. Furthermore, TTM dose-dependently inhibited tumor necrosis factor α (TNFα)-induced activation of NF-κB and AP-1, as well as mRNA and protein expression of VCAM-1, ICAM-1, and MCP-1, which was abolished by preincubating the cells with 5 μM TTM and 15 μM cupric sulfate. The inhibitory effect of TTM on TNFα-induced NF-κB activation was associated with decreased phosphorylation and degradation of IκBα. These data suggest that intracellular copper causes activation of redox-sensitive transcription factors and upregulation of inflammatory mediators in endothelial cells. Copper chelation by TTM may attenuate TNFα-induced endothelial activation and, hence, inhibit vascular inflammation and atherosclerosis. Keywords: Endothelial activation, Metal chelation, NF-κB, AP-1, Vascular inflammation
Introduction As the leading cause of morbidity and mortality in developed countries, atherosclerosis is increasingly recognized as a chronic inflammatory disease of the vasculature.1–4 The single layer of endothelial cells lining vascular walls serves not only as a physical barrier but also exerts numerous physiological functions,5 of which modulation of innate immunity plays a critical role in atherosclerosis. Exposure of vascular endothelial cells to inflammatory stimuli, such as pro-inflammatory cytokines, bacterial endotoxin, or oxidized lipoproteins, causes increased expression of cellular adhesion molecules (CAMs) and interactions with circulating leukocytes.6–8 The main CAMs facilitating attraction and attachment of leukocytes to the endothelium are E-selectin, vascular cell adhesion molecule-1 (VCAM-1), and intercellular
Correspondence to: Wei-Jian Zhang or Balz Frei, Linus Pauling Institute, Oregon State University, Corvallis, OR 97331, USA. Email: weijian. [email protected]; [email protected]
40
© W. S. Maney & Son Ltd 2014 DOI 10.1179/1351000213Y.0000000070
adhesion molecule-1 (ICAM-1). Endothelial cells also synthesize and secrete chemokines that promote recruitment and transendothelial migration of leukocytes, in particular monocyte chemotactic protein-1 (MCP-1).9 The subsequent activation of local leukocytes triggers the release of additional cytokines, chemokines, and growth factors, thereby promoting atherogenesis.10,11 Endothelial expression of CAMs and chemokines induced by pro-inflammatory cytokines, such as tumor necrosis factor α (TNFα), is mediated by activation of the transcription factors, such as nuclear factor kappa B (NF-κB), activator protein-1 (AP-1), and specificity protein-1 (SP-1).12–17 Endothelial activation can be elicited not only by pro-inflammatory cytokines but also reactive oxygen species (ROS) that affect redox-sensitive cell signaling pathways and transcription factors.18,19 Copper is an essential trace element required for various cellular functions, e.g., cellular energy production, ROS scavenging, and angiogenesis.20,21
Redox Report
2014
VOL.
19
NO.
1
Wei et al.
As a redox-active transition metal, copper can act as an electron carrier to catalyze the generation of ROS, potentiating oxidative stress and inducing inflammation.22,23 Copper has been implicated either directly or indirectly in atherosclerosis24 and has been shown to stimulate atherosclerotic lesion formation in rats by inducing vascular inflammation.25 Moreover, copper deficiency downregulates inflammatory cytokine expression in mice.26 Therefore, it is reasonable to hypothesize that copper plays a role in redox-sensitive cell signaling pathways leading to endothelial activation. In the present study, we employed tetrathiomolybdate (TTM), an intracellular copper chelator, to examine the role of copper in endothelial activation. TTM is a small hydrophilic compound that chelates copper with high affinity in a 1 to 3 molar ratio.27 It can form a stable complex with copper and its chaperon, Atx1, thereby disrupting intracellular copper trafficking and downstream copper delivery to cuproproteins.28 In addition to its high specificity for binding copper, TTM also has a good safety index.29,30 TTM has been utilized to chelate copper in animal models of various diseases, including Wilson’s disease, acute inflammation, atherosclerosis, and pulmonary fibrosis.31–35 The goal of the present study was to investigate the role of copper in endothelial inflammation and the potential anti-inflammatory effects of TTM in vascular endothelial cells.
Materials and methods Materials Ammonium tetrathiomolybdate, cupric sulfate, and bovine catalase were purchased from Sigma (St Louis, MO, USA). Human recombinant TNFα was purchased from Roche Applied Science (Indianapolis, IN, USA). Solutions of copper and TTM were prepared by dissolving cupric sulfate and ammonium tetrathiomolybdate, respectively, in Hank’s balanced salt solution (HBSS) (Sigma).
Culture of human aortic endothelial cells Primary human aortic endothelial cells (HAECs) were purchased from Clonetics (San Diego, CA, USA) in passage 3 and cultured in endothelial cell growth medium (Clonetics) at 37°C in a humidified 95% air 5% CO2 cell culture incubator. For experiments, cells were grown to confluence using endothelial culture medium consisting of M199 medium supplemented with 20% fetal bovine serum (Invitrogen, Carlsbad, CA, USA), 100 ng/ml streptomycin, 100 IU/ml penicillin, 1 mM glutamine (Invitrogen), and 1 ng/ml human recombinant basic fibroblast growth factor (Roche Applied Science). HAECs in passage 7 were used in all experiments.
Effects of copper and tetrathiomolybdate on inflammatory gene expression
Treatment of HAECs with copper HAECs were incubated with cupric sulfate (with or without co-incubation of TTM or catalase) for various time periods, viz.: 0, 4, 8, 12, and 16 hours for measurement of mRNA levels of CAMs and MCP-1; 6 hours for measurement of cell surface protein levels of CAMs; and 1 hour for measurement of nuclear transcription factors by enzyme-linked immunosorbent assay (ELISA). Control cells were incubated for the same periods of time with media containing the vehicle HBSS.
Stimulation of TTM-pretreated HAECs with TNFα HAECs were pretreated with the indicated concentrations of TTM (with or without copper) for 24 hours. Subsequently, cells were washed twice with M199 medium and incubated with 50 U/ml TNFα and the same concentration of TTM (and copper) was used during pretreatment for various time periods. Cells were harvested at various time points, viz.: 3 hours for measurement of mRNA levels of CAMs and MCP-1; 6 hours for cell surface protein levels of CAMs and MCP-1 secreted into the medium; and 1 hour for measurements of nuclear transcription factors by ELISA and phosphorylation and degradation of IκBα by Western blot.
Measurement of cell surface CAMs by ELISA Cell surface expression of CAMs (VCAM-1, ICAM-1, and E-selectin) was quantified by cell ELISA as described.36 Briefly, ELISA was performed on HAEC monolayers in flat-bottom 96-well plates. After treatment, cells were fixed before incubation with a primary mouse monoclonal anti-human antibody to either VCAM-1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), ICAM-1 (R&D Systems, Minneapolis, MN, USA), or E-selection (R&D Systems). Cells were then incubated with a horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG secondary antibody (Cell Signaling Technology, Danvers, MA, USA) at 37°C for 1 hour. Protein levels of VCAM-1, ICAM-1, and E-selectin were measured by the absorbance at 492 nm using a microplate spectrophotometer after addition of the peroxidase substrate, o-phenylendiaminehydrochloride (Sigma).
Measurement of mRNA levels of CAMs and MCP-1 Total cellular RNA was isolated from HAECs using TRIzol Reagent from Invitrogen. Messenger RNA levels of VCAM-1, ICAM-1, MCP-1, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were quantitated using real-time quantitative polymerase chain reaction (qPCR). First-strand cDNA was synthesized using the High Capacity cDNA
Redox Report
2014
VOL.
19
NO.
1
41
Wei et al.
Effects of copper and tetrathiomolybdate on inflammatory gene expression
Table 1
SYBR green PCR primers (5′ →3′ )
VCAM-1 ICAM-1 MCP-1 GAPDH
Forward: Reverse: Forward: Reverse: Forward: Reverse: Forward: Reverse:
GGGAAGATGGTCGTGATCCTT TCTGGGGTGGTCTCGATTTTA TTGGGCATAGAGACCCCGTT GCACATTGCTCAGTTCATACACC CAGCCAGATGCAATCAATGCC TGGAATCCTGAACCCACTTCT ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC
Archive Kit from Applied Biosystems (Foster City, CA, USA). All primers were obtained from Invitrogen (Table 1) and SYBR Green reagents were purchased from Applied Biosystems. Real-time qPCR was performed in 25-μl reaction, with a standard curve constructed for each gene in every PCR run, using DNA Engine Opticon 2 Real-Time PCR Detection System from Bio-Rad Laboratories (Waltham, MA, USA). After normalization to the internal control gene, GAPDH, for each sample, the result for each target gene was expressed as fold change of control.
Measurement of secreted MCP-1 in the culture medium After treatment, cell culture medium was collected and cell debris was removed by centrifugation. Levels of MCP-1 were measured using an ELISA kit from R&D Systems according to the manufacturer’s instructions. The sensitivity of the ELISA kit is 2 pg/ml of MCP-1.
Western blot analysis Cell lysate was prepared from HAECs after treatment. Protein samples of 20 μg were separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) on 4–12% bis-tris gel (Invitrogen) and transferred onto nitrocellulose membrane (Invitrogen). Membranes were incubated with rabbit anti-human IκBα or phospho-IκBα antibody (Cell Signaling Technology), and then probed with an HRP conjugated donkey anti-rabbit secondary antibody (Cell Signaling Technology). Immunoreactive bands were detected by the enhanced chemiluminescence detection system (GE Healthcare Life Sciences, Piscataway, NJ, USA). Bands were visualized and quantified on the Alpha Innotech photodocumentation system (Alpha Innotech Corp., San Leandro, CA, USA). To ensure equal loading, all blots were probed for β-actin (Santa Cruz Biotechnology).
Measurement of nuclear transcription factors Nuclear proteins were extracted from HAECs immediately after harvesting, using a nuclear protein extraction kit from Active Motif (Carlsbad, CA, USA) according to the manufacturer’s instructions. Nuclear
42
Redox Report
2014
VOL.
19
NO.
1
protein levels of the NF-κB subunit, p65, and the AP-1 subunit, c-fos, were measured using Trans-AM ELISA kits from Active Motif according to the manufacturer’s instructions.
Statistical analysis All results are reported as mean ± SEM and analyzed using non-parametric analysis of variance (ANOVA) followed by multiple comparisons (Bonferroni correction) as appropriate. Dose- and time-dependency were analyzed by linear regression. Differences are considered statistically significant at the P < 0.05 level.
Results Copper time- and dose-dependently upregulates gene transcription of CAMs and MCP-1 Treating HAECs with 100 μM copper time-dependently increased mRNA levels of VCAM-1, ICAM-1, and MCP-1, with maximum induction of 4.2-, 3.0-, and 5.8-fold, respectively, after 4 hours of incubation (Fig. 1A–C). After 12 hours of incubation, mRNA levels returned to baseline. To investigate whether induction of inflammatory gene expression by copper was dose-dependent, HAECs were incubated with 10–100 μM copper for 4 hours and mRNA levels of CAMs and MCP-1 were assessed. As shown in Fig. 1D, ≥25 μM copper significantly increased mRNA levels of VCAM-1 and MCP-1, while ICAM-1 gene expression was significantly increased by ≥50 μM copper. Maximum induction was effected by 100 μM copper, which increased mRNA levels of VCAM-1, ICAM-1, and MCP-1 by 3.6-, 3.1-, and 4.6-fold, respectively. Free, non-protein bound copper can participate in free radical reactions generating ROS. Addition of copper to the cell culture medium may produce extracellular superoxide and hydrogen peroxide. To determine whether exogenous hydrogen peroxide was involved in copper-induced activation of HAECs, cells were co-incubated with copper and catalase, which catalyzes the decomposition of hydrogen peroxide to water and oxygen. As shown in Fig. 1D, addition of catalase (50 U/ml) did not inhibit gene expression of CAMs and MCP-1 induced by 100 μM copper. In contrast, co-incubation of HAECs with 100 μM copper and 25 μM TTM abolished the copper-induced increase in inflammatory gene expression (Fig. 1D). Finally, up to 200 μM copper, or 50 μM TTM, or their mixture did not cause any adverse effects on cell viability, as assessed by the MTT assay (data not shown).
Wei et al.
Effects of copper and tetrathiomolybdate on inflammatory gene expression
Figure 1 Copper time- and dose-dependently upregulates gene transcription of CAMs and MCP-1. HAECs were incubated for up to 16 hours in ECM without (control) or with 100 μM cupric sulfate (A–C), or for 4 hours in ECM without (control) or with 10 to 100 μM cupric sulfate, 50 U/ml catalase, or 25 μM TTM (D). Total RNA was extracted and mRNA levels of VCAM-1 (A and D), MCP1 (B and D), and ICAM-1 (C and D) were measured by real-time qPCR as described in Materials and methods. Data are presented as fold of control at the 0-hour time-point and represent the mean ± SEM of three independent experiments. Asterisks denote statistically significant differences in mRNA levels compared to control (ANOVA, P < 0.05). ‘#’ denotes statistically significant differences compared to cells treated with 100 μM cupric sulfate (ANOVA, P < 0.05).
Copper dose-dependently increases cell surface protein levels of CAMs and stimulates NF-κB and AP-1 activation In concert with upregulation of gene transcription, 10–100 μM copper dose-dependently increased protein levels of CAMs on HAECs (P < 0.05, linear regression) (Fig. 2A). Maximum induction was reached with 50–100 μM copper. Treatment of the cells with 100 μM copper increased protein levels of VCAM-1, ICAM-1, and E-selectin by 4.2-, 3.6-, and 8.9-fold, respectively. However, co-treatment of HAECs with 100 μM copper and 25 μM TTM suppressed the copper-induced increase of VCAM-1, ICAM-1, and E-selectin by 66, 76, and 87%, respectively (P < 0.05, ANOVA), whereas treatment of HAECs with 25 μM TTM alone did not have any effect (Fig. 2A). To investigate whether activation of the redox-sensitive transcription factors, NF-κB and AP-1, mediates the effect of copper on inflammatory gene expression, HAECs were incubated with 100 μM copper for 1 hour and nuclear extracts were prepared and analyzed by ELISA for the NF-κB subunit, p65, and the AP-1 subunit, c-fos. In the presence of 100 μM copper NF-κB and AP-1 were significantly activated by 2.4and 1.5-fold, respectively (P < 0.05, ANOVA). Copper-induced NF-κB and AP-1 activation was
abolished by co-treatment of HAECs with 100 μM copper and 25 μM TTM, whereas 25 μM TTM alone had no effect (Fig. 2B).
TTM dose-dependently inhibits TNFα-induced upregulation of mRNA and protein levels of CAMs and MCP-1 The above observation that incubation of HAECs with copper induces NF-κB and AP-1 activation and inflammatory gene expression suggests that copper may also play a critical role in endothelial activation induced by other inflammatory stimuli, such as TNFα. To address this question, HAECs were pretreated with TTM for 24 hours to chelate intracellular copper and then stimulated with TNFα (50 U/ml). As shown in Fig. 3A, TTM in concentrations of 5 to 25 μM dose-dependently inhibited TNFα-induced gene expression of CAMs and MCP-1. The TNFαinduced increase of VCAM-1, ICAM-1, and MCP-1 mRNA levels was significantly inhibited by 77, 52, and 70%, respectively, by 25 μM TTM (P < 0.05, ANOVA) (Fig. 3A). However, preincubating the cells with 5 μM TTM plus 15 μM cupric sulfate completely abolished the TTM’s inhibitory effect (Fig. 3B). These data suggest that the inhibitory effect of TTM on endothelial activation is due to copper chelation rather than other, non-specific (antioxidant) effects.
Redox Report
2014
VOL.
19
NO.
1
43
Wei et al.
Effects of copper and tetrathiomolybdate on inflammatory gene expression
Figure 2 Copper dose-dependently increases cell surface protein levels of CAMs and induces NF-κB and AP-1 activation. For (A), HAECs were incubated for 6 hours in ECM without (control) or with 10–100 μM cupric sulfate or 25 μM TTM, and cell surface protein levels of VCAM-1, ICAM-1, and E-selectin were measured by cell ELISA as described in Materials and methods. Data are presented as OD 492 nm values and represent the mean ± SEM of three independent experiments. For (B), HAECs were incubated for 1 hour in ECM without (control) or with 100 μM cupric sulfate or 25 μM TTM. Nuclear proteins were extracted and levels of the NF-κB subunit, p65, and the AP-1 subunit, c-fos, were measured by ELISA as described in Materials and methods. Data represent the mean ± SEM of three independent experiments. Asterisks denote statistically significant differences compared to control (ANOVA, P < 0.05). ‘#’denotes statistically significant differences compared to cells treated with 100 μM cupric sulfate (ANOVA, P < 0.05).
In concert with decreased gene transcription, TTM dose-dependently inhibited the TNFα-induced increase in protein levels of CAMs and MCP-1. Treating HAECs with 25 μM TTM caused maximum reduction of VCAM-1, ICAM-1, E-selectin, and MCP-1 protein levels by 53, 36, 87, and 49%, respectively (P < 0.05, ANOVA) (Fig. 4A and C). As above, treatment of HAECs with only 5 μM TTM also exerted significant inhibitory effects on protein synthesis of VCAM-1, ICAM-1, Eselectin, and MCP-1, which were abolished by preincubation of TTM with 15 μM cupric sulfate (Fig. 4B and D).
44
Redox Report
2014
VOL.
19
NO.
1
Figure 3 Tetrathiomolybdate dose-dependently inhibits TNFα-induced gene transcription of CAMs and MCP-1. HAECs were preincubated for 24 hours in ECM without (control) or with 1 to 25 μM TTM (A) or with 5 μM TTM plus 15 μM cupric sulfate (B). Cells were washed twice with M199 medium and incubated for 4 hours with 50 U/ml TNFα, with (A) or without (B) the same concentration of TTM used during preincubation. Total RNA was extracted and mRNA levels of VCAM-1, ICAM-1, and MCP-1 were measured by real-time qPCR as described in Materials and methods. Data represent the mean ± SEM of three independent experiments. Asterisks denote statistically significant differences compared to control (ANOVA, P < 0.05). ‘#’ denotes statistically significant differences compared to cells treated with 50 U/ml TNFα (ANOVA, P < 0.05). ‘∧’denotes no statistically significant differences compared to cells treated with 50 U/ml TNFα alone.
TTM inhibits TNFα-induced activation of NF-κB and AP-1 In agreement with the above data, TNFα (50 U/ml) strongly induced NF-κB activation in HAECs by more than 4-fold, and was dose-dependently inhibited by 5–25 μM TTM (P < 0.05, linear regression) (Fig. 5). Likewise, AP-1 nuclear levels were increased by 2.2-fold following treatment of HAECs with TNFα, and TTM caused a dose-dependent inhibition (P < 0.05, linear regression) (Fig. 5). These data show that NF-κB plays a particularly important role in mediating TNFα-induced endothelial activation, and NF-κB is more sensitive to be inhibited by TTM than AP-1. To further understand
Wei et al.
Effects of copper and tetrathiomolybdate on inflammatory gene expression
Figure 4 Tetrathiomolybdate dose-dependently inhibits TNFα-induced increase of protein levels of CAMs and MCP-1. HAECs were preincubated for 24 hours without or with TTM or cupric sulfate, washed, and incubated for 6 hours with 50 U/ml TNFα as described in the legend of Fig. 3. Cell surface protein levels of VCAM-1, ICAM-1, and E-selectin (A and B), and protein levels of MCP-1 in the medium (C and D) were measured by ELISA as described in Materials and methods. Data represent the mean ± SEM of three independent experiments. Asterisks denote statistically significant differences compared to control (ANOVA, P < 0.05). ‘#’ denotes statistically significant differences compared to cells treated with 50 U/ml TNFα (ANOVA, P < 0.05). ‘∧’denotes no statistically significant differences compared to cells treated with 50 U/ml TNFα alone.
how NF-κB activity is affected by TTM, we analyzed phosphorylation and subsequent proteolytic degradation of IκBα, the cytosolic inhibitory subunit of NF-κB. As shown in Fig. 6A, TNFα (50 U/ml) induced a significant increase of IκBα phosphorylation, which was dose-dependently inhibited by 2–20 μM TTM (P < 0.05, linear regression), while 5 μM TTM did not alter baseline phospho-IκBα levels. Based on the densitometry data, the strongest reduction of TNFα-induced IκBα phosphorylation was 43% with 20 μM TTM (Fig. 6B). Treating HAECs with TNFα also caused degradation of IκBα, which was significantly inhibited by 5 and 20 μM TTM (P < 0.05, ANOVA) (Fig. 6A and C). Figure 5 Tetrathiomolybdate inhibits TNFα-induced activation of NF-κB and AP-1. HAECs were preincubated for 24 hours without or with 5 to 25 μM TTM, washed, and incubated for 1 hour with 50 U/ml TNFα as described in the legend of Fig. 3. Nuclear proteins were extracted and levels of the NF-κB subunit, p65, and the AP-1 subunit, c-fos, were measured by ELISA as described in Materials and methods. Data represent the mean ± SEM of three independent experiments. Asterisks denote statistically significant differences compared to control (ANOVA, P < 0.05). ‘#’ denotes statistically significant differences compared to cells treated with 50 U/ml TNFα (ANOVA, P < 0.05).
Discussion In the current study, we investigated two aspects of the ( patho)physiological role of copper in endothelial activation: (i) the capacity of exogenous copper to trigger inflammatory responses in HAECs and (ii) the role of intracellular copper in TNFα-induced HAEC activation, employing the copper chelator TTM. Incubating HAECs with copper led to moderately enhanced expression of CAMs and MCP-1, which
Redox Report
2014
VOL.
19
NO.
1
45
Wei et al.
Effects of copper and tetrathiomolybdate on inflammatory gene expression
Figure 6 Tetrathiomolybdate inhibits TNFα-induced phosphorylation and degradation of IκBα. HAECs were preincubated for 24 hours without or with 2–20 μM TTM, washed, and incubated for 1 hour with 50 U/ml TNFα as described in the legend of Fig. 3. Total protein was extracted and Western blot analysis of phospho-IκBα and IκBα (A) was performed as described in Materials and methods. Densitometric data of phospho-IκBα (B) and IκBα (C) were obtained by analyzing Western blots using the photodocumentation system as described in Materials and methods. Data are presented as the percentage of TNFα stimulation (B) or control (C) and represent the mean ± SEM of three independent experiments. Asterisks denote statistically significant differences compared to control (ANOVA, P < 0.05). ‘#’ denotes statistically significant differences compared to cells treated with 50 U/ml TNFα (ANOVA, P < 0.05).
was accompanied by activation of the redox-sensitive transcription factors, NF-κB and AP-1. As indicated by the lack of effect of extracellular catalase, endothelial activation induced by copper was not due to the extracellular hydrogen peroxide, a ROS potentially generated by free copper ions in cell culture media. Moreover, addition of TTM almost completely abolished copper-induced activation of NF-κB and AP-1 and expression of CAMs and MCP-1, further confirming the direct role of copper in activating aortic
46
Redox Report
2014
VOL.
19
NO.
1
endothelial cells. TTM has been shown to reduce bioavailable copper in humans and animals, likely through formation of a high-affinity tripartite complex with copper and proteins.37 In our study, TTM may have reduced intracellular bioavailable copper by forming a complex with copper and its chaperon, Atx1,28 and/or a complex with copper and extracellular albumin, preventing copper transport into cells. The above data suggest that copper is a functional component of the innate immune system and
Wei et al.
positively regulates inflammatory responses. In agreement with this notion, previous studies have shown that copper deficiency is associated with decreased activation of bovine monocyte-derived macrophages,38 decreased neutrophil function in rats,39 and reduced inflammatory responses in mice.26 Consistent with our previous observations,40 we further confirmed that TNFα-induced activation of NF-κB and AP-1, as well as increased expression of CAMs and MCP-1, were all significantly suppressed by copper chelation with TTM. Preloading TTM with cupric sulfate in a 1:3 ratio to saturate its copper binding sites27 and eliminate its copper chelating capacity lead to a significant loss of the ability of TTM to inhibit TNFα-induced endothelial activation. These data suggest that TTM counteracts the stimulatory effects of TNFα on endothelial cells mainly by copper chelation, not non-specific, antioxidant effects. In agreement with previous findings that NF-κB is the major transcription factor orchestrating innate inflammatory responses in aortic endothelial cells, we observed that NF-κB appeared to be more important than AP-1 in TNFα-stimulated inflammatory signaling in HAECs and was more strongly inhibited by copper chelation with TTM. To further address the underlying mechanism by which TTM down-regulates TNFα-induced activation of NF-κB, we analyzed phosphorylation and degradation of IκBα, a member of the inhibitory protein family of NF-κB that prevents NF-κB from entering the nucleus. Once IκBα is phosphorylated, it is directed for degradation, which releases free cytosolic NF-κB and allows its translocation to the nucleus. Our results suggest that TTM exerts its anti-inflammatory function, in part, through inhibition of the phosphorylation and consequent degradation of IκBα by reducing intracellular bioavailable copper. Inflammatory endothelial activation can be elicited by various stimuli, including pro-inflammatory cytokines, NADPH oxidase-derived ROS, oxidatively modified LDL, and infectious agents.3 Here we have shown that copper, a transition metal ion, can directly induce inflammatory response independent of extracellular hydrogen peroxide production. The concept that TNFα contributes to the development of atherosclerosis is supported by considerable evidence. Elicited by either transition metals or pro-inflammatory cytokines, the endothelium upregulates cell surface expression of CAMs and release of MCP-1, providing a fertile environment for leukocyte adhesion and transmigration into the intima of the vessel wall. The disruption of this environment by relatively low concentrations of TTM, as shown in this study, would hinder the initiation of atherosclerosis. This may explain the beneficial effects of TTM treatment observed in animal models of acute inflammation
Effects of copper and tetrathiomolybdate on inflammatory gene expression
and atherosclerosis,31,32 and may offer a critical opportunity for atherosclerosis treatment or prevention. We acknowledge the limitation that the concentrations of copper used in our study are somewhat supra-physiological. These concentrations may only be achieved under certain conditions, e.g., patients with copper-coated titanium implants for joint replacement41 or suffering from Wilson’s disease.34 Nevertheless, our data support the notion that under pathophysiological conditions, elevated intracellular concentrations of copper may contribute to the innate inflammatory response mediated by redox-sensitive cell signaling pathways including NF-κB and AP-1 activation. We speculate that the inflammation elicited by short time incubations with high concentrations of copper, as observed in our study, may be operative physiologically with lower concentrations of excess copper over long periods of time. The ability of copper to induce low-level inflammation may have relevance to the development of atherosclerosis, which is characterized by chronic vascular inflammation. In conclusion, the present study provides new evidence that an increase of intracellular copper may induce endothelial activation by upregulating CAMs and MCP-1 through activation of NF-κB and AP-1. Our findings reinforce the notion that transition metal ions play a critical role in inflammatory responses, likely through modulating the activity of ROS-sensitive cell signaling pathways. Moreover, our data demonstrate that copper chelation with TTM inhibits TNFα-elicited inflammatory endothelial activation and, hence, may potentially be helpful in ameliorating vascular inflammation and atherosclerosis.
Acknowledgement The work described in this paper was supported by US National Institutes of Health, National Center for Complementary and Alternative Medicine (NCCAM) grant number P01 AT002034 (BF and WJZ). Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the National Institutes of Health.
References 1 Berliner JA, Navab M, Fogelman AM, Frank JS, Demer LL, Edwards PA, et al. Atherosclerosis: basic mechanisms. Oxidation, inflammation, and genetics. Circulation 1995;91: 2488–96. 2 Libby P. What have we learned about the biology of atherosclerosis? The role of inflammation. Am J Cardiol 2001;88:3J–6J. 3 Libby P. Inflammation in atherosclerosis. Nature 2002;420: 868–74. 4 Libby P, Ridker PM, Maseri A. Inflammation and atherosclerosis. Circulation 2002;105:1135–43. 5 Pearson JD. Normal endothelial cell function. Lupus 2000;9: 183–8. 6 Rajavashisth TB, Andalibi A, Territo MC, Berliner JA, Navab M, Fogelman AM, et al. Induction of endothelial cell expression
Redox Report
2014
VOL.
19
NO.
1
47
Wei et al.
Effects of copper and tetrathiomolybdate on inflammatory gene expression
7
8 9
10 11 12 13
14 15
16
17 18 19 20 21 22 23 24 25
48
of granulocyte and macrophage colony-stimulating factors by modified low-density lipoproteins. Nature 1990;344:254–7. Bevilacqua MP, Pober JS, Wheeler ME, Cotran RS, Gimbrone MA, Jr. Interleukin 1 acts on cultured human vascular endothelium to increase the adhesion of polymorphonuclear leukocytes, monocytes, and related leukocyte cell lines. J Clin Invest 1985;76:2003–11. Pober JS, Cotran RS. Cytokines and endothelial cell biology. Physiol Rev 1990;70:427–51. Gu L, Okada Y, Clinton SK, Gerard C, Sukhova GK, Libby P, et al. Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low density lipoprotein receptor-deficient mice. Mol Cell 1998;2:275–81. Ross R. Atherosclerosis – an inflammatory disease. N Engl J Med 1999;340:115–26. Hunt BJ. The endothelium in atherogenesis. Lupus 2000;9: 189–93. Iademarco MF, McQuillan JJ, Rosen GD, Dean DC. Characterization of the promoter for vascular cell adhesion molecule-1 (VCAM-1). J Biol Chem 1992;267:16323–29. Neish AS, Khachigian LM, Park A, Baichwal VR, Collins T. Sp1 is a component of the cytokine-inducible enhancer in the promoter of vascular cell adhesion molecule-1. J Biol Chem 1995;270:28903–09. Neish AS, Williams AJ, Palmer HJ, Whitley MZ, Collins T. Functional analysis of the human vascular cell adhesion molecule 1 promoter. J Exp Med 1992;176:1583–93. Korenaga R, Ando J, Kosaki K, Isshiki M, Takada Y, Kamiya A. Negative transcriptional regulation of the VCAM-1 gene by fluid shear stress in murine endothelial cells. Am J Physiol 1997;273:C1506–1515. Chen YH, Lin SJ, Ku HH, Shiao MS, Lin FY, Chen JW, et al. Salvianolic acid B attenuates VCAM-1 and ICAM-1 expression in TNF-alpha-treated human aortic endothelial cells. J Cell Biochem 2001;82:512–21. Collins T, Cybulsky MI. NF-kappaB: pivotal mediator or innocent bystander in atherogenesis? J Clin Invest 2001;107:255–64. Alom-Ruiz SP, Anilkumar N, Shah AM. Reactive oxygen species and endothelial activation. Antioxid Redox Signal 2008;10:1089–100. Wang S, Leonard SS, Castranova V, Vallyathan V, Shi X. The role of superoxide radical in TNF-alpha induced NF-kappaB activation. Ann Clin Lab Sci 1999;29:192–9. Harris ED. Copper transport: an overview. Proc Soc Exp Biol Med 1991;196:130–40. Linder MC, Hazegh-Azam M. Copper biochemistry and molecular biology. Am J Clin Nutr 1996;63:797S–811S. Wang XF, Cynader MS. Pyruvate released by astrocytes protects neurons from copper-catalyzed cysteine neurotoxicity. J Neurosci 2001;21:3322–31. Cui JZ, Wang XF, Hsu L, Matsubara JA. Inflammation induced by photocoagulation laser is minimized by copper chelators. Lasers Med Sci 2009;24:653–7. Ferns GA, Lamb DJ, Taylor A. The possible role of copper ions in atherogenesis: the Blue Janus. Atherosclerosis 1997;133: 139–52. Volker W, Dorszewski A, Unruh V, Robenek H, Breithardt G, Buddecke E. Copper-induced inflammatory reactions of rat carotid arteries mimic restenosis/arteriosclerosis-like neointima formation. Atherosclerosis 1997;130:29–36.
Redox Report
2014
VOL.
19
NO.
1
26 Pan Q, Kleer CG, van Golen KL, Irani J, Bottema KM, Bias C, et al. Copper deficiency induced by tetrathiomolybdate suppresses tumor growth and angiogenesis. Cancer Res 2002;62: 4854–9. 27 George GN, Pickering IJ, Harris HH, Gailer J, Klein D, Lichtmannegger J, et al. Tetrathiomolybdate causes formation of hepatic copper-molybdenum clusters in an animal model of Wilson’s disease. J Am Chem Soc 2003;125:1704–5. 28 Alvarez HM, Xue Y, Robinson CD, Canalizo-Hernandez MA, Marvin RG, Kelly RA, et al. Tetrathiomolybdate inhibits copper trafficking proteins through metal cluster formation. Science 2010;327:331–4 29 Brewer GJ, Dick RD, Yuzbasiyan-Gurkin V, Tankanow R, Young AB, Kluin KJ. Initial therapy of patients with Wilson’s disease with tetrathiomolybdate. Arch Neurol 1991; 48:42–7. 30 Brewer GJ, Dick RD, Johnson V, Wang Y, Yuzbasiyan-Gurkan V, Kluin K, et al. Treatment of Wilson’s disease with ammonium tetrathiomolybdate. I. Initial therapy in 17 neurologically affected patients. Arch Neurol 1994;51:545–54. 31 Wei H, Frei B, Beckman JS, Zhang WJ. Copper chelation by tetrathiomolybdate inhibits lipopolysaccharide-induced inflammatory responses in vivo. Am J Physiol Heart Circ Physiol 2011;301:H712–720. 32 Wei H, Zhang WJ, McMillen TS, Leboeuf RC, Frei B. Copper chelation by tetrathiomolybdate inhibits vascular inflammation and atherosclerotic lesion development in apolipoprotein E-deficient mice. Atherosclerosis 2012;223:306–13. 33 Brewer GJ. Tetrathiomolybdate anticopper therapy for Wilson’s disease inhibits angiogenesis, fibrosis and inflammation. J Cell Mol Med 2003;7:11–20. 34 Brewer GJ. Copper control as an antiangiogenic anticancer therapy: lessons from treating Wilson’s disease. Exp Biol Med (Maywood) 2001;226:665–73. 35 Brewer GJ, Ullenbruch MR, Dick R, Olivarez L, Phan SH. Tetrathiomolybdate therapy protects against bleomycininduced pulmonary fibrosis in mice. J Lab Clin Med 2003;141: 210–6. 36 Zhang WJ, Frei B. Alpha-lipoic acid inhibits TNF-alphainduced NF-kappaB activation and adhesion molecule expression in human aortic endothelial cells. FASEB J 2001; 15:2423–32. 37 George GN, Pickering IJ, Harris HH, Gailer J, Klein D, Lichtmannegger J, et al. Tetrathiomolybdate causes formation of hepatic copper-molybdenum clusters in an animal model of Wilson’s disease. J Am Chem Soc 2003;125:1704–5. 38 Cerone S, Sansinanea A, Streitenberger S, Garcia C, Auza N. Bovine monocyte-derived macrophage function in induced copper deficiency. Gen Physiol Biophys 2000;19:49–58. 39 Babu U, Failla ML. Copper status and function of neutrophils are reversibly depressed in marginally and severely copperdeficient rats. J Nutr 1990;120:1700–9. 40 Zhang WJ, Frei B. Intracellular metal ion chelators inhibit TNFalpha-induced SP-1 activation and adhesion molecule expression in human aortic endothelial cells. Free Radic Biol Med 2003;34:674–82. 41 Hoene A, Prinz C, Walschus U, Lucke S, Patrzyk M, Wilhelm L, et al. In vivo evaluation of copper release and acute local tissue reactions after implantation of copper-coated titanium implants in rats. Biomed Mater 2013;8:035009.
Copyright of Redox Report is the property of Maney Publishing and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
