Int. .I Cancer: . 52,726-730 (1992) 8 1992 Wiley-Liss, Inc.

Publication of the International Union Against Cancer Publication de Wnion lnternationale Contre le Cancer

CORRELATION BETWEEN THE SERUM LEVEL OF HEPATITIS C VIRUS RNA AND DISEASE ACTIVITIES IN ACUTE AND CHRONIC HEPATITIS C Toshiaki GUNJI',Nobuyuki KATO', Shigehisa MORI', Yuko OOTSUYAMA', Makoto HIJIKATA', Michio IMAWARI? and Kunitada sHIMOTOHNO'.3 I Virology Division, National Cancer Center Research Institute, Tokyo 104; and 2Third Department of Internal Medicine, Faculty of Medicine, University of Tokyo, Tokyo 113, Japan. The influence of viremia on hepatic injury in patients infected with hepatitis C virus was examined by analysis of the relationship between alanine aminotransferase activity and the amount of hepatitis C virus RNA in sequential serum samples from I untreated patient with acute hepatitis C and 3 untreated patients with chronic hepatitis C. Semiquantitative analysis by the competitive-reverse-transcription/polymerase-chain-reaction method indicated that the quantity of hepatitis C virus RNA in the serum affected the disease activities of acute and chronic hepatitis C through their natural clinical courses in all these patients. The nucleotide sequence encoding the putative envelope region of the viral genome in the patient with acute hepatitis C was examined. Blood samples taken serially at 2 times of exacerbation of the hepatitis revealed 2 nucleotide mutations, resulting in changes of predicted amino acid residues. This finding suggests that nucleotide mutations in the envelope region of the viral genome may be responsible for the recurrent hepatic injury attributed to recurrence of viremia in patients with hepatitis C. From these aspects, the serial divergence of the virus genome in infected individuals, especially in the region encoding the viral envelope protein, may possibly play an important role in developing chronic infection of hepatitis C virus.

o 1992 Wdq-Liss, Inc. It is widely accepted that hepatitis C virus (HCV), the entire genome of which was molecularly cloned in the United States (Choo et a[., 1989) and Japan (Kato et a/., 1990), is a causative agent of most, if not all, cases of post-transfusional non-A, non-B hepatitis (NANBH) and nearly half those of sporadic hepatitis (Kuo et al., 1989; Alter et al., 1989; Esteban et al., 1989). An immunoassay system for detecting circulating antibodies to a recombinant HCV fusion protein (C100) expressed in yeast is now available, and the importance of this test has been established by sero-epidemiologic studies on patients with NANBH (Kuo etal., 1989; Alter et al., 1989; Esteban et al., 1989; Van der Poel et al., 1989). The presence of anti-HCV antibodies, however, does not necessarily imply ongoing viral replication or the existence of the virus genome itself in the serum, as the appearance of serum antibodies depends on the immune response of the host (Garson et al., 1990a). Moreover, the low sensitivity in the serological test and a time lag between infection and seroconversion occasionally result in false negative results (Kuo et al., 1989; Alter et al., 1989; Weiner et al., 1990; Inchauspe et al., 1991). Therefore, direct estimation of viral R N A seems more suitable than assay of the antibody for evaluation of the biological events involved in viral infection and replication (Weiner er a/., 1990; Fong el al., 1991). In the present study, to determine the relationship between viremia and liver damage, we measured the serum levels of HCV R N A semiquantitatively by the competitive-reversetranscriptionipolymerase-chain-reaction (competitive R T / PCR) method (Gilliland et al., 1990; Kaneko et a/., 1992) in serial blood samples from an untreated patient with acute hepatitis C and untreated patients with chronic hepatitis C, and compared these levels with those of serum alanine aminotransferase (ALT). To investigate serial divergence of the viral genome in an infected individual, we determined the sequences of hypervariable regions of the putative viral enve-

lope region in serial blood samples from the patient with acute hepatitis C. PATIENTS AND METHODS

Patients Studies were made on 1 patient with acute hepatitis C and 3 with chronic hepatitis C who were admitted to the Third Department of Internal Medicine, Tokyo University Hospital, in 1987. The diagnosis of acute or chronic hepatitis C was based on the findings of ALT levels of more than twice the upper limit of the normal range, clinical observations, histological findings in needle biopsy specimens and a positive reaction for anti-HCV antibody with a commercially available ELISA kit (Ortho, Raritan, NJ). Histologically, the biopsy specimens from the 3 cases with chronic hepatitis C showed chronic aggressive hepatitis (CAH). All 4 patients had a history of blood transfusions, the patients with chronic hepatitis C having received blood transfusions about 10 to 20 years previously. The patients received conservative therapy, but not any antiviral therapy such as interferon, throughout the clinical course of the disease. Preparation of RNA RNAs were extracted from samples of 100 kl of serum by the acid guanidium thiocyanateiphenolichloroform extraction method (Chomczynski and Sacchi, 1987). The extracted RNAs were solubilized in sterile water and stored at -70°C until use. The mutant R N A used as an internal control in measurement of the amount of HCV R N A in serum was obtained as follows. cDNA containing nucleotides 31 to 500 of the HCV-J sequence (Kato et al., 1990) was cloned into the EcoRI site of the pTZ 19R vector. The plasmid was then digested with ThtIII and AatI, which have unique restriction sites at nucleotides 187 and 278 respectively. The resulting plasmid, in which about 90 base pairs (bp) of the 5' non-coding region of HCV cDNA was deleted, was linearized by FspI digestion, and used as a template for in vitro transcription with T7 R N A polymerase (Promega, Madison. WI) according to the manufacturer's instructions. The reaction product was overlaid on a cushion of CsTFA (density 1.5 g/ml) and centrifuged at 150,OOOg for 24 hr. The pellet of R N A sample was then suspended in solution D (4 M guanidine isothiocyanate, 25 mM sodium citrate, 0.5% sodium sarcosylate, 0.1 M p-mercaptoethanol), extracted once with phenolichloroform, and once with chloroform, and precipitated with ethanol. Serial 5-fold dilutions of the purified mutant R N A were added to each serum R N A sample during R N A extraction after suspension in solution D, and used as template for the following competitive RT-PCR. RT-PCR The sense primer (primer 196) used in PCR corresponds to nucleotides 83 to 102 of the HCV-J genome (S'CCATGGCGT3To whom correspondence and reprint requests should be addressed, at Virology Division, National Cancer Center Research Institute. 5-1-1 Tsukiji, Chuo-ku, Tokyo 104, Japan. Received: May 4, 1992 and in revised form July 7, 1992.

727

ROLE OF VIREMIA IN HEPATITIS C

b 55

54

53

5’

50

1987

d

C

I

100

50 100 *0°:

C5l 0.

I

1988

I

1989

I

1990

I

5

0

r\ ,1 -

I

55

Bri

1988

54

53

52

5’

I

1989

I

1990

1

5O

FIGURE1 -Time courses of change in serum alanine aminotransferase activities and HCV RNA levels in the patients. Solid line indicates ALT activity, and dotted line the relative amount of serum HCV RNA.

TAGTATGAGTG 3’), and that of the anti-sense primer (primer 319 R ) to nucleotides 329 to 349 (5’GTGCTCATGGTGCACGGTCTA 3’). both of which are located in the highly conserved S’-non-coding region. The cDNA was synthesized in 10 pI of reaction mixture containing 4 p1 of RNA sample, 1 X R T buffer (50 mM Tris-HCI, 75 mM KCI, 3 mM Mg CI2, p H 8.3). 500 p M of each dNTP, 1 p M anti-sense primer (319 R), and 200 units of Moloney murine leukemia virus (M-MLV) reverse transcriptase (BRL, Gaithersburg, MD) at 37°C for 60 min. PCR amplification of the cDNAs was carried out by addition of 40 pl of reaction mixture containing 1 x PCR buffer (10 mM (NH4)2 S 0 4 , 70 mM Tris-HC1,2 mM MgCI2, 1 mM DTT, bovine serum albumin (BSA) at 100 pgiml, 0.1% Triton X-100, pH 8.8), 1 p M of each sense (196) and anti-sense (319R) primer, 200 p M of each dNTP, and 3 units of Taq polymerase (Perkin Elmer-Cetus, Nonvalk, CT) in a DNA Thermal Cycler (Perkin Elmer-Cetus) for 34 cycles. Each PCR cycle consisted of annealing at 55°C for 45 sec, primer extension at 72°C for 2 min, and denaturation at 94°C for 1 min, followed by a final extension at 72°C for 8 min. The sizes of the amplified DNA fragments from the intact and mutant RNAs were expected to be 266 bp and 176 bp respectively. To avoid possible false-positive results due to contamination of components with DNA, a control reaction without reverse

transcriptase was carried out in parallel. The amplified products were size-fractionated by electrophoresis in 2% agarose gel and blotted onto a nylon filter Hybond N+ ( h e r s h a m , Aylesbury, UK). After hybridization with [32P]-labeledHCVcDNA probe, corresponding to nucleotide 103 to 127 of the HCV-J sequence, at a final radioactivity of 1 x lo6 cpmiml, the filters were exposed to Fuji (Tokyo, Japan) Imaging Plates at room temperature for 1 hr, and the intensity of each band originating from the HCV R N A in the serum and the mutant RNA was calculated with a Fuji Image Analyzer. The amount of HCV RNA in serum was estimated to be nearly the same as that of the mutant R N A at the dilution point where the bands amplified from each type of HCV RNA had the same intensity. The sequences of cDNA amplified by PCR were determined as described in detail previously (Kato et al., 1992). RESULTS

Semi-quantitative atialysis of HCVRNA it1 serum The serial changes in the ALT level and amount of HCV RNA in the sera of the patients are shown in Figure 1. In the patient with acute hepatitis C (case l ) , a high HCV RNA level was detected during the initial increase of ALT activity 3

728

GUNJI E T A .

months after blood transfusion. Although HCV R N A disappeared from the circulation with normalization of the ALT activity, it reappeared in the serum in the period coincident with subsequent increase of ALT. After this second exacerbation of the hepatitis, the acute infection of HCV resolved spontaneously, with normal value of ALT levels for more than 3 years, and HCV R N A in serum also became undetectable simultaneously with ceasing of hepatic injury. The finding of a liver biopsy specimen obtained after the subsequent ALT elevation was compatible with that of acute hepatitis C. In 2 of the 3 patients with chronic hepatitis C (cases 2 and 3), the ALT levels fluctuated in parallel with serial changes in the amount of HCV RNA. In the other patient (case 4), a strict correlation between the 2 parameters was not observed during the follow-up period. This patient underwent laparoscopy and liver biopsy in 1985 and 1988, and both examinations indicated features compatible with CAH. The hepatic functional reserves of the patient, however, have decreased rapidly since 1989, and on repeated admissions to hospital, icterus and recurrent hepatic encephalopathy caused by advanced liver cirrhosis have been noted. Interestingly, in this patient the amount of serum HCV RNA increases just at the time when hepatic damage is progressing rapidly.

Serial change of the HCVgenome in the patient with acute hepatitis C PCR-amplified cDNAs of serum specimens taken serially from the patient with acute hepatitis C (case 1) were directly sequenced in the putative envelope region of the HCV genome from nucleotide 1434 to 1847 of the HCV-J sequence. The amplified region encodes the C-terminal 15 amino acids of gp35 and the N-terminal 123 amino acids of gp70, both of which are considered to be envelope proteins of HCV (Hijikata et a/., 1991a), and correspond to amino acids positions 369 to 506 of the HCV polyprotein precursor. The cDNAs of HCV genomes could be obtained only from blood samples taken during exacerbations of ALT activity, since there was no detectable HCV R N A in each phase when the hepatitis subsided, as shown in Figure 1. To reduce the possibility of misreading by Taq polymerase during the PCR reaction, we carried out sequence analyses on 7 clones and 6 clones obtained from blood samples taken during the initial attack and the subsequent exacerbation respectively. In the 414 nucleotide sequences of the amplified region, point mutations were observed at 2 positions. Both mutations were of the second base of a codon. and they resulted in change of the deduced amino acids from His (CAC) to Arg (CGC) at amino acid position 394 and from Glu (GAA) to Gly (GGA) at amino acid position 482 (Fig. 2). The former mutation was within hypervariable region 1 (HVR 1) (Hijikata et al., 1991b ; Kato et al., 1992) corresponding to the region between amino acids positions 384 and 410, and was consistently observed in the cDNAs obtained from both blood samples. The latter mutation was, however, observed in only 2 of 6 clones derived from the specimen obtained during the subsequent exacerbation of hepatitis, the nucleotide sequences of the other 4 clones being identical to that of 7 clones obtained during the first exacerbation. DISCUSSION

Although it has been shown that about 80 to 90% of post-transfusional NANBH are caused by HCV (Kuo et al., 1989; Alter et al., 1989; Esteban et al., 1989), the precise biology of HCV infection still remains to be determined. In order to discover whether hepatitis C viremia really affects the activity of hepatitis, we investigated the time courses of change in viremia and serum ALT activity in untreated patients with acute and chronic hepatitis C. For semi-quantitative analysis of HCV R N A in serum, we employed a competitive RT-PCR

w35

7gP70

370

400 HCV-1 AKVLVVLLLF AGVDAETHVS GGSA H VSG IAGLFTSGAR

9

HCV-2 : AKVLVVLLLF AGVDAETHVS GGSA

VSG IAGLFTSGAR

HVR-1

440

1 :

QNIQLINTNG SWHINRTALN CNDSLNTGWV AGLFYHYKFN

2:

-

QNlQLlNTNG SWHINRTALN CNDSLNTGWV AGLFYHYKFN 480

1 : SSGCSERLAS

CRRLTDFAQC WGPISYANGS G P ~ P Y C W H

z : SSGCSERLAS CRRLTDFAQC WGPISYANGS G P D ~ P Y C W H 500 1 : YPPRPCGIVP

HVR-2

ARSVCGP

2 : YPPRPCGIVP ARSVCGP

FTCURE 2 - Comparison of the predicted amino acid sequences of the HCV genome in the 2 phases of exacerbation in the patient with acute hepatitis C. HCV-1 and 2 represent the amino acid residues deduced from the nucleotide sequence of blood samples taken in the first and second period of exacerbation. The changed amino acid residues due to nucleotide mutations are boxed. The amino acid sequence is numbered according to the HCV-J sequence. The boundary between gp35 and gp70 is indicated. The regions corresponding to hypervariable region- 1 (HVR-1) and -2 (HVR-2) are underlined.

method using stepwise diluted mutant RNA as an internal control, since serological assay cannot directly determine the presence of infectious agents in a host (Garson et al., 1990~). In our cases of chronic hepatitis C, HCV R N A persisted in the serum throughout the natural clinical course of the disease, except at one time in case 2. Moreover, serial changes in the amount of HCV R N A were closely correlated with changes in ALT activity in 2 of 3 patients. In the third case (case 4), a strict correlation between these 2 parameters was not observed, but a burst of hepatitis C viremia appeared to be related with the rapid progress of chronic liver disease. Since ALT activity usually remains low in patients with liver cirrhosis, the discrepancy between the 2 parameters in case 4 who developed advanced liver cirrhosis is understandable. Thus, the profile of change in serum HCV R N A appears to reflect the serial change of viral replication in the liver. The results of semiquantitative analysis of HCV RNA in case 4 also suggest that considerable HCV still remains in patients with advanced liver cirrhosis, a situation different from that in HBV infection. Garson et al. (1990b) reported longitudinal patterns of viremia during the natural development of acute or chronic hepatitis C in hemophiliacs who received factor VIII concentrate contaminated with HCV. One pattern they observed in patients who developed chronic hepatitis C after infusion was long-lasting viremia throughout the follow-up period; the other pattern was intermittent viremia, including the delayed appearance of HCV R N A in the circulation, many months after the onset of the initial ALT elevation. The former pattern of viremia was consistent with that described here, whereas the latter pattern was not observed in our study. Although the reason for the conflicting results is unknown, it seems likely that the biological state of HCV infection and replication might be different in the early and late phases of development of chronic hepatitis C. Other possibilities are that the primer position (NS 5) used in PCR and/or the conditions of serum storage might have caused false-negative results in assays of HCV R N A in the study by Garson et al. (1990b) whereas primers derived from the highly conserved 5’ non-coding region of the HCV genome might have increased the yield on PCR amplification in our study (Inchauspe et al., 1991; Busch

729

ROLE OF VIREMIA IN HEPATITIS C

and Wilber, 1992). To clarify the accurate association of viremia with hepatocellular injury, a larger number of cases must be studied. A striking correlation between the serum HCV RNA and ALT levels was also observed in the case with acute hepatitis C (case 1). In this case, after the first disappearance of HCV RNA, recurrence of viremia coincided with a second increase in serum ALT, and then HCV R N A disappeared from the circulation with self-limitation of hepatitis. Recently, a similar pattern of hepatitis C viremia with reappearance of HCV RNA in the circulation has been observed in patients with chronic hepatitis C who received interferon administration, and in these patients relapse of hepatitis was observed even after the ALT level had been normalized by interferon treatment (Chayama et al., 1991). The precise mechanism of recurrent viremia is unclear. Possibly HCV remains in hepatocytes even when HCV RNA can no longer be detected in the serum. Our observation that the nucleotide and deduced amino acid sequences of the HCV genome changed in a single patient during natural development of hepatitis C indicates the alternative possibility that, after the first disappearance of HCV RNA from the circulation, a population with a new and different HCV genome appears. HCV genomes are known to show sequence diversity in different individuals and often also in individual patients (Hijikata et al., 19916; Weiner et al., 1991; Ogata et al., 1991; Kato et al., 1992). However, surprisingly, we found that in one patient the nucleotide sequence of the HCV genome in the initial attack changed within as short a time as 2 months to that in a second exacerbation of hepatitis, suggesting that, after a healing period, the second increase of ALT activity was due to emergence of HCV variants capable of escaping from the immune network of the infected host. Judging from these observations, acute infection with HCV should be resolved in patients in whom all HCV genomes are eliminated, whereas in patients in whom HCV variants emerge

serially even after one of them has been cleared by the immune response, acute infection should result in chronic hepatitis. One of the 2 sequence mutations of the HCV genome that we detected was in hypervariable region 1 of the HCV envelope region, the other being in the region adjacent to hypervariable region 2. These regions have both been shown to be highly divergent regions in HCV-J isolates (Hijikata et al., 19916; Kato et al., 1992). As the HCV variants obtained in the subsequent episode in case 1would probably have been subject to immune selection during the first attack of hepatitis, our findings are consistent with a recent suggestion that the viral protein encoded by these regions is a candidate for the target epitope attacked by the immune response of infected hosts (Weiner et al., 1992). Thus the antigenic epitope of the HCV genome seems to change sequentially in the host during viral replication. This finding implies that development of a vaccine against HCV infection will be difficult. In this study, we demonstrated that the disease activities in patients with acute or chronic hepatitis C are closely associated with the quantities of HCV R N A in the serum, and that emergence of HCV variants with serial nucleotide mutations in the envelope region might be responsible for recurrence of viremia and exacerbation of hepatitis, which would lead to chronic HCV infection. Our results also indicate that longitudinal monitoring of the amount of HCV RNA in the serum is useful for predicting the clinical course and prognosis of patients infected with HCV and probably also for determining the timing of the start and discontinuation of interferon administration. ACKNOWLEDGEMENTS

This work was supported by a Grant-in-Aid for the Comprehensive 10-Year Strategy for Cancer Control from the Ministry of Health and Welfare of Japan.

REFERENCES J.C., HOUGH- in haemophiliacs treated with hepatitis-C-virus-contaminatedfactor ALTER,H.J., PURCELL. R.H., SHIH,J.W., MELPOLDER, Kuo. G., Detection of antibody to hepatitis C VllI concentrates. Lancet, 11, 1022-1025 (1990b). virus in prospectively followed transfusion recipients with acute and GILLILAND, G., PERRIN, S., BLANCHARD, K. and BUNN,H.F., Analysis chronic non-A, non-B hepatitis. New Engl. J. Med., 321, 1494-1500 of cytokine mRNA and DNA: detection and quantitation by competi(1 989). tive polymerase chain reaction. Proc. nat. Acad. Sci. (Wash.), 87, BUSCH,M.P. and WILBER,J.C., Hepatitis C virus replication. New 2725-2729 (1990). Etzgl. J. Med.. 326,64-65 (1992). HIJIKATA, M., KATo, N., OOTSUYAMA, Y . ,NAKAGAWA, M., OHKOSHI, K., Hypervariable regions in the putative glycoproCHAYAMA. K., SAITOH,S., ARASE,Y . , IKEDA,K., MATSUMOTO, T., S. and SHIMOTOHNO, SAKAI, Y.. KOBAYASHI, M., UNAKAMI. M., MORINAGA, T. and KU- tein of hepatitis C virus. Biochem. Eiophys. Res. Comm., 175, 220-228 MADA. H., Effect of interferon administration on serum hepatitis C ( 199lb). virus RNA in atients with chronic hepatitis C. Hepalology, 13, HIJIKATA,M.. KATo, N., OOTSUYAMA, Y . , NAKAGAWA, M. and 1040-1043 (1991p. SHIMOTOHNO, K., Gene mapping of the putative structural region of CHOMCZYNSKI, P. and SACCHI,N., Single-step method of RNA the hepatitis C virus genome by in vi/ro rocessing analysis. Proc. nu/. isolation by acid guanidium thiocyanate-phenol-chloroform extrac- Acad. Sci. (Wash.),88,5547-5551 (1991ar. tion. Anal. Biochem., 162,156-159 (1987). INCHAUSPE, G., ABE, K., ZEBEDEE, S., NASOFF,M. and PRINCE, A.M., CHOO,Q.L., Kuo, G., WEINER, A.J., OVERBY, L.R., BRADLEY, D.W. Use of conserved sequences from hepatitis C virus for the detection of and HOUGHTON. M., Isolation of a cDNA clone derived from a viral RNA in infected sera by polymerase chain reaction. Heparology, blood-borne non-A, non-B viral hepatitis genome. Science, 244, 14,595-600 (1991). 359-362 (1989). KANEKO, S., MURAKAMI, S., UNOURA, M. and KOBAYASHI. K., QuantiESTEBAN, J.I., ESTEBAN. R., VILADOMIU, L., LOPEZ-TALAVERA, J.C., tation of hepatitis C virus RNA by competitive polymerase chain GONZALEZ, A,. HERNANDEZ, J.M., ROGET,M., VARGAS, V., GENESCA, reaction. J. Med. Virology (1992) (In press). J. and BUTI,M.. Hepatitis C virus antibodies among risk groups in KATO. N., HIJIKATA, M., OOTSUYAMA, Y . , NAKAGAWA, M., OHKOSHI, Spain. Lancet, 11, 294296 (1989). s., SUGIMURA, T. and SHIMOTOHNO, K., Molecular cloning Of the FONG,T.L., SHINDO, M.. &INSTONE, S.M., HOOFNAGLE. J.H. and human hepatitis C virus genome from Japanese patients with non-A, BISCEGLIE. A.M.D., Detection of replicative intermediates of hepatitis non-B hepatitis. Proc. nat. Acad. Sci. (Wash.),87,9524-9528 (1990). C viral RNA in liver and serum of patients with chronic hepatitis C. J. KATo, N., OOTSUYAMA, Y., TANAKA, T., NAKAGAWA, M.. NAKAZAWA, clin. [tivest., 88, 1058-1060 (1991). T., MURAISO, K., OHKOSHI, S., HIJIKATA. M. and SHIMOTOHNO, K., GARSON, J.A., TEDDER,R.S., BRIGGS,M., TUKE,P., GLAZEBROOK,Marked sequence diversity in the putative envelope proteins of J.A., TRUTE,A,, PARKER, D., BARBARA, J.A.J., CONTRERAS, M. and hepatitis Cviruses. VintsRes., 22, 107-123 (1992). ALOYSIUS. S., Detection of hepatitis C viral sequences in blood Kuo, G., CHOO.Q.L., ALTER,H.J.. GITNICK, G.L., REDEKER, A.G., donations by “nested” polymerase chain reaction and prediction of PURCELL, R.H.. MIYAMURA,T.,DIENSTAG, J.L.,ALTER,M.J.,STEVENS, infectivity. Lancet, 11, 1419-1422 (1990~). C.E., TEGTMEIER, G.E., BONINO,F.. COLOMBO, M., LEE,W.S., Kuo, J.R., OVERBY, L.R., BRADLEY, D.W. and GARSON, J.A., TUKE.P.W., MAKRIS,M., BRIGGS,M., MACHIN, S.J., C., BERGER,K., SHUSTER, PRESTON, F.E. and TEDDER, R.S., Demonstration of viraemia patterns HOUGHTON, M.. An assay for circulating antibodies to a major TON, M., CHOO,Q.L. and

730

GUNJI E T A L .

etiologic virus of human non-A, non-B hepatitis. Science, 244, 362-364 proteins and the Pestivirus envelope glycoproteins. Virology, 180, (1989). 842-848 (1991). OGATA,N., ALTER.H.J.. MILLER,R.H. and PURCELL,R.H., Nucle- WLINER,A.J., GEYSEN,H.M., CHRISTOPHERSON, C., HALL, J.E., otide sequence and mutation rate of the H strain of hepatitis C virus. MASON,T.J.. SARACCO, G., BONINO, F.. CRAWFORD, K., MARION. C.D.. Proc. nut. Acad. Sci. (Wash.), 88,3392-3396 (1991). CRAWFORD,K.A., BRUNETTO,M., BARR, P.J., MIYAMURA,T., J. and HOUGHTON. M., Evidence for immune selecVAN DER POEL, C.L., REESINK, H.W., LELIE, P.N., LEENTVAAR- MCHUTCHINSON. tion of hepatitis C virus (HCV) putative envelope glycoprotein KUYPERS. A., CHOO.Q.L., Kuo, G. and HOUGHTON, M., Anti-hepatitis C antibodies and non-A, non-B post-transfusion hepatitis in the variants: Potential role in chronic HCV infections. Proc. nut. Acad. Sci. (Wash.),89,3468-3472 (1992). Netherlands. Lancer, 11,297-298 (1989). WEINER. A.J.. BRAUER, M.J., ROSENBLATT, J., RICHMAN, K.H., TUNG, WEINER, A.J., KUO, G.. BRADLEY, D.W.. BONINO,F., SARACCO, G., J., CRAWFORD, K., BONINO,F., SARACCO, G., CHOO.Q.L., HOUGHTON, LEE, C., ROSENBLAT,J., CHOO,Q.L. and HOUGHTON, M., Detection M. and HAN.J.H., Variable and hypenariable domains are found in of hepatitis C viral sequences in non-A, non-B hepatitis. Lancer, I, 1-3 the regions of HCV corresponding to the Flavivirus envelope and NS1 (1990).