Courtship Patterns in the Drosophila montium Species Subgroup: Repeated Loss of Precopulatory Courtship? Author(s): Chuan-Cheng Chen, Masayoshi Watada, Hitoshi Miyake, Takehiro K. Katoh, Zheng Sun, Yi-Feng Li, Michael G. Ritchie and Shuo-Yang Wen Source: Zoological Science, 30(12):1056-1062. 2013. Published By: Zoological Society of Japan DOI: http://dx.doi.org/10.2108/zsj.30.1056 URL: http://www.bioone.org/doi/full/10.2108/zsj.30.1056
BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder.
BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research.
ZOOLOGICAL SCIENCE 30: 1056–1062 (2013)
¤ 2013 Zoological Society of Japan
Courtship Patterns in the Drosophila montium Species Subgroup: Repeated Loss of Precopulatory Courtship? Chuan-Cheng Chen1, Masayoshi Watada2, Hitoshi Miyake2, Takehiro K. Katoh2, Zheng Sun1, Yi-Feng Li1, Michael G. Ritchie3, and Shuo-Yang Wen1* 1
Department of Entomology, South China Agricultural University, Guangzhou 510642, China 2 Graduate School of Science and Engineering, Ehime University, 3 Bunkyo-Cho, Matsuyama, Ehime 790-8577, Japan 3 School of Biology, University of St Andrews, St Andrews, Fife KY16 9TH, UK
During precopulatory courtship, male Drosophila typically produce wing vibration to generate species-specific songs before mounting females. Three species in the lini clade of the montium species subgroup have been found to produce species-specific sine song only after mounting and during copulation. Here we investigated and analyzed the courtship behavior of 29 species in the montium subgroup from video and song recordings and measured the duration of wing vibration. We describe a great diversity of courtship behavior in the montium subgroup. The courtship patterns can be categorized into four types in the montium subgroup: 1) type P/C, species with both precopulatory and copulatory courtship, such as D. parvula and D. nikananu, 2) type P-/C, species with sporadic precopulatory and mainly copulatory courtship, such as D. auraria and D. triauraria. 3) type C, species with only copulatory courtship, such as D. tani and D. pectinifera, 4) type C-, species with only very brief copulatory courtship, such as D. rufa and D. asahinai. According to a phylogenetic tree based on sequences of mitochondrial COI and COII, and the nuclear Adh, both precopulatory courtship and copulatory courtship were present in the most basal species D. parvula. Each of two branches in the montium subgroup contains four types of courtship behavior. Type C is present in each sub-branch. These results suggest that the courtship behavior initially involved both precopulatory and copulatory courtship, but that subsequently precopulatory courtship has gradually been lost in the montium subgroup. We suggest reasons why precopulatory behavior might come to be lost in the montium subgroup. Key words: evolution
the montium species subgroup, wing vibration, precopulatory courtship, copulatory courtship,
INTRODUCTION Drosophila courtship has been well studied as a model system from both behavioral and neurogenetic perspectives. The typical Drosophila courtship involves precopulatory courtship rituals in which males display behaviors to females before mounting. Although different sensory modalities can be involved in courtship (Gleason et al., 2012; Giglio and Dyer, 2013), male wing vibration is often a central element (Sturtevant, 1915; Spieth, 1952). Species-specific courtship songs are produced by wing vibration of males (Ritchie and Gleason, 1995), females receive such specific songs with the funiculus and the arista in the distal antennae and the Johnston’s organ in the pedicel antennae, and transduce antennal modulations into neural signals to the central nervous system (Gopfert and Robert, 2002). The antenna– Johnston’s organ system shows species-specific active tuning to spectral components of male song (Riabinina et al., * Corresponding author. Tel. : +86-20-85280309; Fax : +86-20-85280291; E-mail: [email protected] doi:10.2108/zsj.30.1056
2011). As early as the 1950s, the mating behavior of 101 Drosophila species was systematically investigated (Spieth, 1952). We further reviewed 135 species from 30 speciesgroups according to available literature on Drosophila courtship and found a great diversity of courtship behavior in the genus Drosophila (Wen and Li, 2011). Drosophila melanogaster is the best-studied species. Its elaborate courtship repertoire includes elements of orienting, tapping, scissoring, circling, wing-vibrating, licking, and attempting to copulate. During courtship, males and females can send and/or receive visual, chemical, tactile and acoustic signals (Greenspan and Ferveur, 2000). Some of elements are common to most species in the genus Drosophila (Greenspan and Ferveur, 2000), but the loss or gain of certain elements in courtship behavior is very common. About 74% of known species in the subgenus Drosophila do not involve any element of wing display (scissoring, flicking, waving, or rowing) which can serve as a visual stimulus, perhaps at distance (Wen and Li, 2011). In the subgenus Sophophora, only the montium subgroup and three species of the saltans species group do not use wing displays (see Table 1 in the review of Wen and Li, 2011). Very unusually, the courtship of some species of the montium subgroup has
Courtship Patterns in the montium Subgroup Table 1.
Stocks used in this study and their accession numbers.
Species
Strain code
Locality
D. auraria D. triauraria D. biauraria D. subauraria D. rufa D. asahinai D. lacteicornis D. tani D. pectinifera D. baimaii D. pseudobaimaii D. lini D. ogumai D. ohnishii D. kikkawai D. leontia D. bocki D. serrata D. birchii D. mayri D. barbarae D. truncata D. seguyi D. vulcana D. burlai D. diplacantha D. nikananu D. parvula D. bunnanda D. pseudoobscura D. tsukubaensis
A662 T544 B16 ONM29 rufa-OGM AM2K-1 IR96-1 tani-YF OGS98m 14028-0481.00 K41 BG3146.1 RGN3 MMY326 NAHA1 AO-2 IR2-37 Q122 14028-0521.00 14028-0591.00 14028-0491.01 RGN179 K59 14028-0711.00 L6 14028-0586.00 14028-0601.00 SHL17 14028-0721.00 14011-0121.94 tsuk-TKM
Japan Japan Japan Japan Japan Japan Japan China Japan Malaysia Malaysia Taiwan Myanmar Myanmar Japan Thailand Japan Philippines Australia Papua New Guinea Malaysia Myanmar Kenya Zimbabwe Kenya Cameroon Ivory Coast India Australia USA Japan
Accession number COI
COII
Adh
AB669696 AB669711 AB669697 AB669707 AB669705 AB669693 AB830535 AB669709 AB669761 AB669750 AB669762 AB669737 AB669739 AB669742 AB669734 AB669735 AB669730 AB669749 AB669745 AB669756 AB669727 AB669764 AB669716 AB669718 AB669719 AB669732 AB669743 AB669759 AB669747 AB669765 AB669766
AB243375 AB243399 AB243382 AB243396 AB243394 AB243378 AB243385 AB669770 AB243389 AB669807 AB669818 AB669794 AB669796 AB669799 AB669791 AB669792 AB669787 AB669806 AB669802 AB669813 AB669784 AB669820 AB669775 AB669777 AB669778 AB669789 AB669800 AB669816 AB669804 AB669821 AB669822
AB669826 AB669841 AB669827 AB669837 AB669835 AB669823 AB830534 AB669839 AB669891 AB669880 AB669892 AB669867 AB669869 AB669872 AB669864 AB669865 AB669860 AB669879 AB669875 AB669886 AB669857 AB669894 AB669846 AB669848 AB669849 AB669862 AB669873 AB669889 AB669877 M60981 AB669895
been found not to include any of the precopulatory courtship elements, such as tapping, licking, circling, wing display and wing vibration before mounting, as seen in most Drosophila species (Spieth and Hsu, 1950; Spieth, 1952; Tomaru and Oguma, 1994; Hoikkala and Crossley, 2000; Li, 2011; Wen et al., 2011). However, wing vibration occurs during copulation in these species (Tomaru and Oguma, 1994; Hoikkala and Crossley, 2000; Wen et al., 2011; Li et al., 2012). The montium species-subgroup is the largest subgroup of the melanogaster species group, comprising a total of 91 species from Asia and Africa (Lemeunier et al., 1986). Several groups of very closely related species have been recognized as species complexes: auraria, bakoue, bocqueti, jambulina, nikananu, serrata and kikkawai (Zhang et al., 2003; Wen, 2004; DaLage et al., 2007). Courtship behavior and species-specific courtship songs were also found to be unique in the lini clade of the kikkawai species complex. Three closely related species of the lini clade display copulatory courtship in which males vibrate wings after mounting, and females use species-specific sine song to recognize their mates during copulation (Wen et al., 2011; Li et al., 2012). These appear to influence female preferences (Li et al., 2012). Three species of the kikkawai clade also show copulatory courtship (Li, 2011). Moreover, copulatory courtship is observed more often than precopulatory courtship in
1057
D. serrata, D. birchii and species of the auraria complex (Tomaru and Oguma, 1994; Hoikkala and Crossley, 2000). In this study, we recorded videos and songs and systematically analyzed elements of courtship behavior and the wing vibration duration of 29 species of the montium subgroup. We focus on the timing of wing vibration and tried to understand the phylogenetic distribution of copulatory courtship in the montium subgroup. We used a phylogeny to examine any evolutionary trends in the distribution of precopulatory and copulatory courtship. MATERIALS AND METHODS Flies Most of the fly stocks were from Ehime-Fly (NBRP) and UC San Diego Drosophila Species Stock Center, and D. pseudobaimaii was given by H. Takamori (Tokyo Gakugei University). Flies were maintained on cornmeal-malt medium at 20°C under a 12:12 h light cycle. Virgin flies were collected and sexually separated without anesthesia within 12 h of emergence. Male flies were kept individually in vials (9.5 cm height × 1.5 cm diameter) containing culture medium to avoid male-male courtship before the experiment, while females were maintained in groups of five in vials. The detail information of stocks is shown in Table 1.
PCR amplification, sequencing and phylogenetic tree construction Two mitochondrial loci (cytochrome oxidase subunits I, COI; cytochrome oxidase subunits II, COII) and a nuclear locus (Alcohol dehydrogenase; Adh) were used for construction of a phylogenetic tree of the 29 species of the montium subgroup. DNA was extracted from one or five females of each strain using DNAzol (Invitrogen) following the supplier’s protocol. To amplify the full length of COI, two primer sets were used: COI-F1 (ATCGCCTAAACTTCAGCCAC) and COI-M1(CCAGCGGGAGGAGGAGATCC), and COI-F2 (TCTATTGCACTAATCTG-CCA) and COI-M2 (CCTGATTCTTGTCTAATAATATG). The primers COII-a (ATATGGCAGATTAGTGCAA) and COII-b (TTGCTTTCAGTCATCTAATG) were used to amplify a region of the mitochondrial COII from the start codon to the position 645. ADH-1 (AACAAGAACGTGATTTTCGT) and ADH2 (TAGATGCCGGAGTCCCAGTG) were used to amplify part of the Adh gene, which included truncated exon 1 to exon 3 (Chia et al., 1985, Moses et al., 1985). Another primer set (TGATTTTCGTTGCCGGTCTGGGAGG and CAGGGTGCCCAAGTCCAGTTTCCAGA) was used for amplification of the Adh gene in D. pseudobaimaii (Goto et al., 2004), which was not amplified by the ADH-1 and ADH2 primers. PCR amplification was carried out with Taq DNA polymerase (Invitrogen) under standard conditions and cycle profiles as recommended by the supplier. Amplified DNA products were diluted to 1 ng/μl and used as sequencing templates after their sizes were determined. We used the same primers for sequencing as that for PCR amplification. All sequence reactions were performed with the
1058
C.-C. Chen et al.
BigDye Terminator Cycle Sequencing Kit (ABI) using an ABI PRISM 310 and 3130 Genetic Analyzer. PCR products of Adh in the three species (D. ohnishii, D. bicornuta and D. pseudobaimaii) could not be sequenced directly, and were cloned into the pCR2.0 vector using the TOPO TA-cloning Kit (Invitrogen). DNA from several independent clones was extracted using the QIAprep Mini Kit (QIAGEN). Cloned DNA of Adh was sequenced in both the 5′ and 3′ orientations using the standard primers T7 and M13 reverse. D. pseudoobscura and D. tsukubaensis were used as outgroups. Phylogenetic analysis of the sequence data was performed using the MEGA5 software package (Tamura et al., 2011). COI, COII and Adh sequences were aligned using the ClustalW program (Thompson et al., 1994) included in MEGA5. Because of problems aligning introns of Adh sequences, only exon regions of this gene were used for constructing the phylogenetic tree. Combined aligned sequences were used to construct phylogenetic trees using the maximum-likelihood (ML) method. ML analyses were conducted using MEGA5, and bootstrap values from ML method were obtained after 1000 replications.
male is trying to mount was included in the duration of copulatory wing vibration for the species with copulatory courtship. Data were analyzed with Microsoft£ Excel 2010.
RESULTS Phylogenetic tree Sequences of two mitochondrial genes and a nuclear gene of the montium subgroup were submitted to DDBJ and the accession numbers are shown in Table 1. Sequences of three genes were combined to construct a maximum-likelihood (ML) tree (Fig. 1). As Figure 1 shows, the most basal species of the montium subgroup is D. parvula, and other species then split into two branches, one included D. pectinifera, D. baimaii, D. pseudobaimaii and the auraria complex, the other included the kikkawai, the serrata and the bokoue complexes and the remainder. Courtship types The categories and main elements of courtship behavior
Video recording, song recording and data analysis The video and song recordings were done separately with different facilities. The video recordings were used for analyzing courtship behavioral elements. The song recordings were for the duration of wing vibration and the mounting duration. Reproductively mature 6–11 day old virgin flies were used for video recording of courtship behavior. For each recording, one virgin male and one virgin female were introduced into a mating cell (1 cm × 3.5 cm) under a Motic£ Stereo Microscope equipped with a microscope digital camera (OPLENIC, Pro-MicroScan #5821) and linked to a computer. The courtship songs of 6–11 day-old unanaesthetized virgin fly pairs were recorded in an insulated anechoic room from 0830 to 1530 at 23.2°C (lights on 0700–1900). The system comprised a mating chamber (12 mm inside diameter, 2.5 mm internal height with acoustically transparent nylon net floors) placed in an Insectavox microphone which was connected to a filter (EF5-04 LP/HP Filter) to remove frequencies below 50 Hz and above 700 Hz. A recorder with a sampling frequency of 8 kHz was linked to one channel of the software (DataView version 8.6.1, http://www.st-andrews.ac.uk/ ~wjh/dataview/). Digital song files were subsequently analyzed for the duration of wing vibration. We also observed the courtship behavior and timed the mounting duration when we recorded the courtship songs. Mounting duration was determined Fig. 1. Phylogenetic tree and courtship types of the montium subgroup. Sequences of COI, COII from the time the male first mounted to and Adh were combined to construct a maximum-likelihood (ML) tree by using MEGA5, bootstrap the time the pair separated. For species values from ML method were obtained after 1000 replications. We superimposed the courtship without copulatory courtship, the wing types on the phylogenetic tree with different color. Green indicated the type P/C, in which flies vibration while a male was trying to display precopulatory courtship as often as copulatory courtship. Blue for the type P-/C, flies dismount was included in the duration of play mainly copulatory courtship and sporadically precopulatory courtship. Black for the type C, precopulatory wing vibration. On the flies show only copulatory courtship. Orange for the type C-, flies display sporadically copulatory courtship. *: Referred to Tomaru and Oguma (1994). other hand, the wing vibration while a
Courtship Patterns in the montium Subgroup Table 2. Type P/C P-/C C C-
1059
Courtship types and the behavioral elements in the montium subgroup. Behavioral elements
Species D. parvula, D. nikananu, D. biauraria D. triauraria, D. leontia, D. serrata, D. mayri, D. barbarae, D. diplacantha, D. montium* D. lacteicornis, D. tani, D. pectinifera, D. baimaii, D. pseudobaimaii, D. lini, D. ohnishii, D. ogumai, D. kikkawai, D. bocki, D. bunnanda, D. birchii, D. truncate, D. seguyi, D. vulcana D. rufa, D. asahinai, D. burlai
Before mounting
After mounting
Tapping/circling/(waving)/ (scissoring)/(licking)/wing vibration
Wing vibration
wing vibration/(waving)
Wing vibration
No
Wing vibration
No
Sporadically wing vibration
P: Most individuals displayed precopulatory courtship. P-: Precopulatory courtship was decreased, C: Most individuals displayed copulatory courtship. C-: Copulatory courtship was decreased. (): indicated the element presents in some species but not in others. *: according to the description in Spieth (1952).
of each type are shown in Table 2. Figure 2 illustrates the main features of courtship types in the montium subgroup. Four types of courtship behavior were categorized according to the timing of wing vibration. All investigated species in the montium subgroup displayed copulatory courtship, but to a different extent. Only a few species showed precopulatory courtship. Some species displayed precopulatory courtship as often as that of copulatory, such as D. parvula, D. nikananu and D. biauraria. They were categorized as type P/C. Some species, such as D. triauraria, D. leontia, D. serrata, D. mayri, D. barbarae and D. diplacantha, showed mainly copulatory courtship and sporadically precopulatory courtship. Most individuals of these species showed wing vibration after mounting, and a few individuals of each species before mounting, so these were categorized as type P-/C. Most species in the montium subgroup displayed only copulatory courtship, never singing before mounting; this type of courtship was categorized as type C. Three species (D. rufa, D. asahinai, and D. burlai) did not sing often either before mounting or after mounting. The courtship types of the montium subgroup are definitely different from typical Drosophila precopulatory courtship. Courtship duration Wing vibration is the main courtship element of the montium subgroup. Wing vibration before mounting has been recognized as one of major precopulatory courtship elements, while wing vibration after mounting and during copulation is a copulatory courtship behavior. Therefore, we timed wing vibration before and after mounting respectively and the mounting duration (Table 3). The mounting duration is different among species. However, it must have evolved rapidly, as this is apparently unrelated to the phylogenetic position of the species. There are large differences even among species in the
Fig. 2. Main poses of courtship types in the montium subgroup. Type P/C: flies display precopulatory (P) courtship as often as copulatory (C) courtship. Representative species: D. parvula. Type P-/C: flies display mainly copulatory courtship and, sporadically, precopulatory courtship. Representative species: D. serrata. Type C: flies show only copulatory courtship. Representative species: D. kikkawai, D. truncata. Type C-: flies display sporadically copulatory courtship. Representative species: D. asahinai, D. burlai.
1060
C.-C. Chen et al.
Table 3.
Duration of wing vibration and mounting in precopulatory and copulatory courtship.
Courtship type P/C
P-/C
C
C-
Species
N
D. parvula D. nikananu D. biauraria D. triauraria D. leontia D. serrata D. mayri D. barbarae D. diplacantha D. lacteicornis D. tani D. pectinifera D. baimaii D. pseudobaimaii D. lini D. ohnishii D. ogumai D. bocki D. kikkawai D. bunnanda D. birchii D. truncata D. seguyi D. vulcana D. rufa D. burlai D. asahinai
10 7 14 15 16 14 22 10 21 11 16 10 11 9 12 14 11 8 19 23 16 12 17 21 15 10 16
Duration of wing vibration (sec) Precopulatory (n%) 25.40 ± 28.90 (90) 23.86 ± 9.37 (100) 6.5 ± 6.32 (85.7) 1.33 ± 0.58 (20) 15.75 ± 9.50 (50) 22.75 ± 22.93 (28.5) 15.5 ± 23.69 (18.2) 4.67 ± 3.06 (30) 8.57 ± 6.35 (33) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Copulatory (n%)
Mounting duration (sec)
7.30 ± 5.81 (80) 371.00 ± 108.85 12.71 ± 8.24 (100) 696.29 ± 250.05 17.21 ± 9.08 (100) 474.29 ± 130.85 29.07 ± 16.28 (100) 407.8 ± 85.07 68.25 ± 47.91 (100) 318.88 ± 125.76 14.12 ± 8.70 (100) 303.64 ± 129.81 16.59 ± 4.92 (100) 98.19 ± 15.43 20.00 ± 20.65 (80) 583.50 ± 321.58 18.71 ± 8.43 (100) 487.19 ± 167.46 16.18 ± 7.22 (100) 555.63 ± 157.56 34.13 ± 16.67 (100) 1395.63 ± 288.81 31.80 ± 16.27 (100) 479.50 ± 181.88 29.82 ± 14.18 (100) 409.64 ± 129.82 59.56 ± 37.75 (100) 542.44 ± 166.38 110.83 ± 66.56 (100) 1319.00 ± 511.27 143.86 ± 41.74 (100) 788.64 ± 213.97 49.55 ± 19.47 (100) 425.91 ± 69.86 31.86 ± 33.92 (100) 182.14 ± 61.56 49.63 ± 28.60 (100) 309.53 ± 232.50 11.17 ± 6.04 (100) 278.65 ± 50.84 32.38 ± 19.11 (100) 249.44 ± 80.5 35.42 ± 16.06 (100) 193.25 ± 35.66 62.35 ± 53.33 (100) 318.47 ± 133.21 23.24 ± 9.96 (100) 445.24 ± 115.06 3.33 ± 5.25 (67) 298.13 ± 61.56 31.2 ± 28.85 (50) 254.10 ± 80.55 0.69 ± 1.99 (25) 380.44 ± 165.41
N: Number of investigated individuals. n%: Percentage of individuals showed wing vibration among investigated individuals. P: Precopulatory courtship, 80–100% individuals displayed precopulatory courtship. P-: Precopulatory courtship was decreased, about 18–50% individuals displayed precopulatory courtship. C: 80–100% individuals displayed copulatory courtship. C-: Copulatory courtship was decreased, about 25–67% individuals displayed copulatory courtship.
same clade of the species-complex, from 425.91 sec of D. ogumai to 1319 sec of D. lini in the lini clade of the kikkawai species complex (Table 3). For species of type P/C, most individuals sang both precopulatory and copulatory songs. 85.7–100% of individuals displayed precopulatory courtship, and 80–100% showed copulatory courtship. Drosophila nikananu and D. parvula sang precopulatory songs (mean duration, 23.86 sec and 25.40 sec, respectively) more often than copulatory songs (12.71 sec and 7.3 sec respectively). The reverse was true for D. biauraria; this species sang more copulatory songs (17.21 sec) and fewer precopulatory songs (6.5 sec). For species of type P-/C, the number of individuals which sang precopulatory songs was decreased. 18.2–50% displayed precopulatory courtship, and 80–100% showed copulatory courtship. All species, except D. serrata, sang more copulatory courtship (16.59–68.25 sec) than precopulatory courtship (1.33–15.75 sec). For species of type C, all investigated individuals sang only copulatory songs. The duration of singing is from 11.17 sec of D. bunnanda in the serrata complex to 143.86 sec of D. ohnishii in the kikkawai complex. For species of type C-, 25–67% individuals sang very brief copulatory songs, from 0.69 sec in 25% of D. asahinai
to 31.2 sec in 50% of D. burlai. Courtship types on the phylogenetic tree We superimpose the courtship types on the phylogenetic tree with different colors (Fig. 1). Green indicates the type P/C, blue for the type P-/C, black for the type C and orange for the type C-. We see that copulatory courtship is predominant in the montium subgroup. 13.8% of species are type P/C, 24.1% of species are type P-/C, 51.7% of species are type C and 10.4% of species are type C-. The most basal D. parvula has courtship of the type P/C. Two branches of montium subgroup contained types P/C, P-/C, C and C-. The species of type C are found in each sub-branch. The auraria species-complex in the branch A contained all four types: D. biauraria and D. subauraria were type P/C, D. auraria and D. triauraria were type P/-C, D. tani and D. lactericornis were type C. D. rufa and D. asahinai were type C-. Other species-complexes were type C except D. leontia in the kikkawai species complex and D. serrata in the serrata speciescomplex. Hence song types continue to change rapidly within this phylogenic group. DISCUSSION
Drosophila courtship behavior has been well studied since 1952 (Spieth, 1952). Recently, an overlooked courtship element, quivering, was found with males of D. melanogaster (Fabre et al., 2012). This quivering behavior plays a very important role in causing females to stop walking. Moreover, flies of three species of the D. virilis phylad and one species of the D. montana phylad display prolonged touching or licking and shorter singing (Vedenina et al., 2013). Many elements of Drosophila courtship may be much more variable than imagined. Diversity of courtship behavior in the montium subgroup The Drosophila montium species subgroup is a very interesting subgroup containing many species complexes (Zhang et al., 2003; Wen, 2004; DaLage et al., 2007). In this study, we found that there is a large diversity of courtship behavior but with copulatory courtship being most widespread. We categorized the courtship behavior of all investigated species into four types according to the timing of the wing vibration of the major courtship element, wing vibration before mounting and wing vibration after mounting. We tried to identify how many types of courtship are shown by spe-
Courtship Patterns in the montium Subgroup
cies in the montium subgroup, and if any species displays typical precopulatory courtship as that in D. melanogaster. We found four types of courtship patterns with copulatory courtship and gradually decreasing precopulatory courtship in this subgroup. All species in the montium subgroup display copulatory courtship, and no species display only the typical precopulatory courtship. The parameters of courtship song have been well studied as characters influencing mate recognition in Drosophila (Ritchie et al., 1999; Tomaru et al., 2004; Riabinina et al., 2011). However, the timing of singing courtship song during the courtship ritual has gained less attention. The courtship types in the montium subgroup are diverse and rapidly evolving; the timing of wing vibration is a crucial element of the diversity of the courtship. It is therefore important to consider whether the timing of songs is an important aspect of the courtship behavior of Drosophila, and what the causes and consequences of variation in this might be. Loss or gain of precopulatory courtship in the montium subgroup Mating in flight is thought to be the ancestral Dipteran mating pattern in some primitive Dipteran species, such as mosquitoes (Downes, 1969). In Drosophila, mating always occurs on food substrates and male flies display postures and movements before attempting to mount and copulate (Spieth, 1952). In the subgenus Sophophora, most species initiate courtship with tapping, and then follow with wing displays and wing vibration, courtship elements known as precopulatory courtship elements (Spieth, 1952). In the montium subgroup, only three of the species investigated frequently display both precopulatory courtship and copulatory courtship. Six investigated species sporadically showed precopulatory courtship and mainly copulatory courtship. In other words, among 29 species, only nine species had precopulatory courtship. Which occurred first in the montium subgroup, the loss of precopulatory courtship or the gain of copulatory courtship? Based on the phylogenetic tree in Fig. 1, the most basal species of the montium subgroup, D. parvula, produced more precopulatory songs than copulatory songs (Type P/C). Within the montium subgroup, branch B has a species with type P/C courtship, D. nikananu, which sang more songs before mounting than after mounting, like D. parvula. Branch A contains a species with type P/C courtship, D. biauraria, which sang more copulatory songs than precopulatory songs. In branch A, there are five, three and two species with type C, type P-/C and type C- courtships, respectively. There are ten, five and one species with type C, type P-/C and type C- courtships, respectively in branch B. Such a phylogenetic distribution of courtship types in the montium subgroup suggests that the precopulatory courtship is frequently being lost in each of branch. Interestingly, in species with type P-/C, some individuals only display copulatory courtship, for example, in D. serrata, 28.5% of individuals sang before mounting (Table 3). As Hoikkala and Crossley (2000) mentioned, males of this species retain the ability to sing before mounting, but appear not to use it frequently. This suggests that precopulatory courtship is being lost in these species. Why might P/C and type P-/C flies switch from precop-
1061
ulatory courtship to copulatory courtship? What benefits might be obtained from copulatory over precopulatory courtship? Males of many animals display copulatory courtship and it may function to induce responses in female reproductive behavior and physiology, increasing sperm utilisation (Eberhard, 1996; Peretti and Eberhard, 2010), or it could be a form of extended mate guarding. Males of the spider Physocyclus globosus perform copulatory courtship by vibrating their abdomen to bias sperm dumping (Peretti and Eberhard, 2010). If copulatory courtship is associated with sperm competition, it might be used more often in species which a female is mated with multiple males. Multiple mating is widespread throughout Drosophila and may influence many aspects of ejaculate evolution. It is unknown whether there is generally higher re-mating or other unusual aspects of sperm competition in the montium subgroup, though D. serrata has unusually high levels of polyandry (Frentiu and Chenoweth, 2008) and an EST library includes some seminal accessory proteins (Frentiu et al., 2009). Further studies of the mating system of this group are needed to evaluate the causes and consequences of a switch from precopulatory to copulatory courtship. ACKNOWLEDGMENTS We deeply thank Professor Masanori J. Toda for the long-term support of our work on the montium subgroup. We appreciate two anonymous reviewers’ crucial suggestions for improving this paper. This work is supported by NSFC to S. Y. W. (Grant no. 31372187) and partially supported by JSPS to M. W. (Grant no. 21570096).
REFERENCES Chia W, Savakis C, Karp R, Pelham H, Ashburner M (1985) Mutation of the Adh gene of Drosophila melanogaster containing an internal tandem duplication. J Mol Biol 186: 679–688 DaLage JL, Kergoat GJ, Maczkowiak F, Silvain JF, Cariou ML, Lachaise D (2007) A phylogeny of Drosophilidae using the Amyrel gene: questioning the Drosophila melanogaster speceis group boundaries. J Zool Syst Evol Res 45: 47–63 Downes JA (1969) The swarming and mating flight of Diptera. Annu Rev Entomol 14: 271–298 Eberhard WG (1996) Female control: sexual selection by cryptic female choice. Princeton University Press, Princeton, NJ Fabre CC, Hedwig B, Conduit G, Lawrence PA, Goodwin SF, Casal J (2012) Substrate-borne vibratory communication during courtship in Drosophila melanogaster. Curr Biol 22: 2180–2185 Frentiu FD, Chenoweth SF (2008) Polyandry and paternity skew in natural and experimental populations of Drosophila serrata. Mol Ecol 17: 1589–1596 Frentiu FD, Adamski M, Mcgraw EA, Blows MW, Chenoweth SF (2009) An expressed sequence tag (EST) library for Drosophila serrata, a model system for sexual selection and climatic adaptation studies. BMC Genomics 10: 40 Giglio EM, Dyer KA (2013) Divergence of premating behaviors in the closely related species Drosophila subquinaria and D. recens. Ecol Evol 3: 365–374 Gleason JM, Pierce AA, Vezeau AL, Goodman SF (2012) Different sensory modalities are required for successful courtship in two species of Drosophila willistoni group. Anim Behav 83: 217– 227 Gopfert MC, Robert D (2002) The mechanical basis of Drosophila audition. J Exp Biol 205: 1199–1208 Goto H, Inomata N, Szmidt AE, Yamazaki T (2004) Nucleotide variation of seven genes in Drosophila kikkawai. Genes Genet Syst 79: 19–26
1062
C.-C. Chen et al.
Greenspan RJ, Ferveur JF (2000) Courtship in Drosophila. Annu Rev Genet 34: 205–232 Hoikkala A, Crossley S (2000) Copulatory courtship in Drosophila behavior and songs of D. birchii and D. serrata. J Insect Behav 13: 71–76 Lemeunier F, David JR, Tsacas L, Ashburner M (1986) The melanogaster species group. In “The Genetics and Biology of Drosophila” Ed by M Ashburner, HL Carson, J Thompson, Academic Press, London and Orlando, pp 147–256 Li YF (2011) Role of sine song in Drosophila lini clade and its genetic control. PhD thesis. South China Agriculture University Li YF, Wen SY, Ritchie MG (2012) Copulatory song in three species of the Drosophila montium subgroup extends copulation and shows unusual genetic control. Anim Behav 83: 233–238 Moses K, Heberlein U, Ashburner M (1990) The Adh gene promoters of Drosophila melanogaster and Drosophila orena are functionally conserved and share features of sequence structure and nuclease-protected sites. Mol Cell Biol 10: 539–548 Peretti AV, Eberhard WG (2010) Cryptic female choice via sperm dumping favours male copulatory courtship in a spider. J Evol Biol 23: 271–281 Riabinina O, Dai M, Duke T, Albert JT (2011) Active process mediates species-specific tuning of Drosophila ears. Curr Biol 21: 658–664 Ritchie MG, Gleason JM (1995) Rapid evolution of courtship song pattern in Drosophila willistoni sibling species. J Evol Biol 8: 463–479 Ritchie MG, Halsey EJ, Gleason JM (1999) Drosophila song as a species-specific mating signal and the behavioural importance of Kyriacou & Hall cycles in D. melanogaster song. Anim Behav 58: 649–657 Spieth HT (1952) Mating behaviour within the genus Drosophila (Diptera). Bull Amer Mus Nat Hist 99: 401–474 Spieth HT, Hsu TC (1950) The influence of light on the mating behavior of seven species of the Drosophila melanogaster spe-
cies group. Evolution 4: 316–325 Sturtevant AH (1915) Experiments on sex recognition and the problem of sexual selection in Drosophila. J Anim Behav 5: 351–366 Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28: 2731–2739 Thompson JD, Higgins DG, Gibson TJ (1994) ClustalW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680 Tomaru M, Oguma Y (1994) Differences in courtship song in the species of the Drosophila auraria complex. Anim Behav 47: 133–140 Tomaru M, Yamada H, Oguma Y (2004) Female mate recognition and sexual isolation depending on courtship song in Drosophila sechellia and its siblings. Genes Genet Syst 79: 145–150 Vedenina VY, Ivanova TI, Lazebny OE (2013) Analysis of courtship behavior in closely related species of Drosophila virilis group: a new approach arises new questions. J Insect Behav 26: 402– 415 Wen SY (2004) Studies on the speciation of Drosophila lini and its related species. PhD thesis. South China Agricultural University Wen SY, Li YF (2011) An evolutionary view on courtship behavior of Drosophila: from a comparative approach. Low Temp Sci 69: 87–100 Wen SY, Yamada H, Li YF, Kimura MT, Oguma Y, Sawamura K, Toda MJ (2011) Copulatory courtship behavior and sine song as a mate recognition cue in Drosophila lini and its sibling species. Zool Sci 28: 469–475 Zhang Z, Inomata N, Cariou ML, Da LJ, Yamazaki T (2003) Phylogeny and the evolution of the Amylase multigenes in the Drosophila montium species subgroup. J Mol Evol 56: 121–30 (Received June 18, 2013 / Accepted July 26, 2013)
BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder.
BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research.
ZOOLOGICAL SCIENCE 30: 1056–1062 (2013)
¤ 2013 Zoological Society of Japan
Courtship Patterns in the Drosophila montium Species Subgroup: Repeated Loss of Precopulatory Courtship? Chuan-Cheng Chen1, Masayoshi Watada2, Hitoshi Miyake2, Takehiro K. Katoh2, Zheng Sun1, Yi-Feng Li1, Michael G. Ritchie3, and Shuo-Yang Wen1* 1
Department of Entomology, South China Agricultural University, Guangzhou 510642, China 2 Graduate School of Science and Engineering, Ehime University, 3 Bunkyo-Cho, Matsuyama, Ehime 790-8577, Japan 3 School of Biology, University of St Andrews, St Andrews, Fife KY16 9TH, UK
During precopulatory courtship, male Drosophila typically produce wing vibration to generate species-specific songs before mounting females. Three species in the lini clade of the montium species subgroup have been found to produce species-specific sine song only after mounting and during copulation. Here we investigated and analyzed the courtship behavior of 29 species in the montium subgroup from video and song recordings and measured the duration of wing vibration. We describe a great diversity of courtship behavior in the montium subgroup. The courtship patterns can be categorized into four types in the montium subgroup: 1) type P/C, species with both precopulatory and copulatory courtship, such as D. parvula and D. nikananu, 2) type P-/C, species with sporadic precopulatory and mainly copulatory courtship, such as D. auraria and D. triauraria. 3) type C, species with only copulatory courtship, such as D. tani and D. pectinifera, 4) type C-, species with only very brief copulatory courtship, such as D. rufa and D. asahinai. According to a phylogenetic tree based on sequences of mitochondrial COI and COII, and the nuclear Adh, both precopulatory courtship and copulatory courtship were present in the most basal species D. parvula. Each of two branches in the montium subgroup contains four types of courtship behavior. Type C is present in each sub-branch. These results suggest that the courtship behavior initially involved both precopulatory and copulatory courtship, but that subsequently precopulatory courtship has gradually been lost in the montium subgroup. We suggest reasons why precopulatory behavior might come to be lost in the montium subgroup. Key words: evolution
the montium species subgroup, wing vibration, precopulatory courtship, copulatory courtship,
INTRODUCTION Drosophila courtship has been well studied as a model system from both behavioral and neurogenetic perspectives. The typical Drosophila courtship involves precopulatory courtship rituals in which males display behaviors to females before mounting. Although different sensory modalities can be involved in courtship (Gleason et al., 2012; Giglio and Dyer, 2013), male wing vibration is often a central element (Sturtevant, 1915; Spieth, 1952). Species-specific courtship songs are produced by wing vibration of males (Ritchie and Gleason, 1995), females receive such specific songs with the funiculus and the arista in the distal antennae and the Johnston’s organ in the pedicel antennae, and transduce antennal modulations into neural signals to the central nervous system (Gopfert and Robert, 2002). The antenna– Johnston’s organ system shows species-specific active tuning to spectral components of male song (Riabinina et al., * Corresponding author. Tel. : +86-20-85280309; Fax : +86-20-85280291; E-mail: [email protected] doi:10.2108/zsj.30.1056
2011). As early as the 1950s, the mating behavior of 101 Drosophila species was systematically investigated (Spieth, 1952). We further reviewed 135 species from 30 speciesgroups according to available literature on Drosophila courtship and found a great diversity of courtship behavior in the genus Drosophila (Wen and Li, 2011). Drosophila melanogaster is the best-studied species. Its elaborate courtship repertoire includes elements of orienting, tapping, scissoring, circling, wing-vibrating, licking, and attempting to copulate. During courtship, males and females can send and/or receive visual, chemical, tactile and acoustic signals (Greenspan and Ferveur, 2000). Some of elements are common to most species in the genus Drosophila (Greenspan and Ferveur, 2000), but the loss or gain of certain elements in courtship behavior is very common. About 74% of known species in the subgenus Drosophila do not involve any element of wing display (scissoring, flicking, waving, or rowing) which can serve as a visual stimulus, perhaps at distance (Wen and Li, 2011). In the subgenus Sophophora, only the montium subgroup and three species of the saltans species group do not use wing displays (see Table 1 in the review of Wen and Li, 2011). Very unusually, the courtship of some species of the montium subgroup has
Courtship Patterns in the montium Subgroup Table 1.
Stocks used in this study and their accession numbers.
Species
Strain code
Locality
D. auraria D. triauraria D. biauraria D. subauraria D. rufa D. asahinai D. lacteicornis D. tani D. pectinifera D. baimaii D. pseudobaimaii D. lini D. ogumai D. ohnishii D. kikkawai D. leontia D. bocki D. serrata D. birchii D. mayri D. barbarae D. truncata D. seguyi D. vulcana D. burlai D. diplacantha D. nikananu D. parvula D. bunnanda D. pseudoobscura D. tsukubaensis
A662 T544 B16 ONM29 rufa-OGM AM2K-1 IR96-1 tani-YF OGS98m 14028-0481.00 K41 BG3146.1 RGN3 MMY326 NAHA1 AO-2 IR2-37 Q122 14028-0521.00 14028-0591.00 14028-0491.01 RGN179 K59 14028-0711.00 L6 14028-0586.00 14028-0601.00 SHL17 14028-0721.00 14011-0121.94 tsuk-TKM
Japan Japan Japan Japan Japan Japan Japan China Japan Malaysia Malaysia Taiwan Myanmar Myanmar Japan Thailand Japan Philippines Australia Papua New Guinea Malaysia Myanmar Kenya Zimbabwe Kenya Cameroon Ivory Coast India Australia USA Japan
Accession number COI
COII
Adh
AB669696 AB669711 AB669697 AB669707 AB669705 AB669693 AB830535 AB669709 AB669761 AB669750 AB669762 AB669737 AB669739 AB669742 AB669734 AB669735 AB669730 AB669749 AB669745 AB669756 AB669727 AB669764 AB669716 AB669718 AB669719 AB669732 AB669743 AB669759 AB669747 AB669765 AB669766
AB243375 AB243399 AB243382 AB243396 AB243394 AB243378 AB243385 AB669770 AB243389 AB669807 AB669818 AB669794 AB669796 AB669799 AB669791 AB669792 AB669787 AB669806 AB669802 AB669813 AB669784 AB669820 AB669775 AB669777 AB669778 AB669789 AB669800 AB669816 AB669804 AB669821 AB669822
AB669826 AB669841 AB669827 AB669837 AB669835 AB669823 AB830534 AB669839 AB669891 AB669880 AB669892 AB669867 AB669869 AB669872 AB669864 AB669865 AB669860 AB669879 AB669875 AB669886 AB669857 AB669894 AB669846 AB669848 AB669849 AB669862 AB669873 AB669889 AB669877 M60981 AB669895
been found not to include any of the precopulatory courtship elements, such as tapping, licking, circling, wing display and wing vibration before mounting, as seen in most Drosophila species (Spieth and Hsu, 1950; Spieth, 1952; Tomaru and Oguma, 1994; Hoikkala and Crossley, 2000; Li, 2011; Wen et al., 2011). However, wing vibration occurs during copulation in these species (Tomaru and Oguma, 1994; Hoikkala and Crossley, 2000; Wen et al., 2011; Li et al., 2012). The montium species-subgroup is the largest subgroup of the melanogaster species group, comprising a total of 91 species from Asia and Africa (Lemeunier et al., 1986). Several groups of very closely related species have been recognized as species complexes: auraria, bakoue, bocqueti, jambulina, nikananu, serrata and kikkawai (Zhang et al., 2003; Wen, 2004; DaLage et al., 2007). Courtship behavior and species-specific courtship songs were also found to be unique in the lini clade of the kikkawai species complex. Three closely related species of the lini clade display copulatory courtship in which males vibrate wings after mounting, and females use species-specific sine song to recognize their mates during copulation (Wen et al., 2011; Li et al., 2012). These appear to influence female preferences (Li et al., 2012). Three species of the kikkawai clade also show copulatory courtship (Li, 2011). Moreover, copulatory courtship is observed more often than precopulatory courtship in
1057
D. serrata, D. birchii and species of the auraria complex (Tomaru and Oguma, 1994; Hoikkala and Crossley, 2000). In this study, we recorded videos and songs and systematically analyzed elements of courtship behavior and the wing vibration duration of 29 species of the montium subgroup. We focus on the timing of wing vibration and tried to understand the phylogenetic distribution of copulatory courtship in the montium subgroup. We used a phylogeny to examine any evolutionary trends in the distribution of precopulatory and copulatory courtship. MATERIALS AND METHODS Flies Most of the fly stocks were from Ehime-Fly (NBRP) and UC San Diego Drosophila Species Stock Center, and D. pseudobaimaii was given by H. Takamori (Tokyo Gakugei University). Flies were maintained on cornmeal-malt medium at 20°C under a 12:12 h light cycle. Virgin flies were collected and sexually separated without anesthesia within 12 h of emergence. Male flies were kept individually in vials (9.5 cm height × 1.5 cm diameter) containing culture medium to avoid male-male courtship before the experiment, while females were maintained in groups of five in vials. The detail information of stocks is shown in Table 1.
PCR amplification, sequencing and phylogenetic tree construction Two mitochondrial loci (cytochrome oxidase subunits I, COI; cytochrome oxidase subunits II, COII) and a nuclear locus (Alcohol dehydrogenase; Adh) were used for construction of a phylogenetic tree of the 29 species of the montium subgroup. DNA was extracted from one or five females of each strain using DNAzol (Invitrogen) following the supplier’s protocol. To amplify the full length of COI, two primer sets were used: COI-F1 (ATCGCCTAAACTTCAGCCAC) and COI-M1(CCAGCGGGAGGAGGAGATCC), and COI-F2 (TCTATTGCACTAATCTG-CCA) and COI-M2 (CCTGATTCTTGTCTAATAATATG). The primers COII-a (ATATGGCAGATTAGTGCAA) and COII-b (TTGCTTTCAGTCATCTAATG) were used to amplify a region of the mitochondrial COII from the start codon to the position 645. ADH-1 (AACAAGAACGTGATTTTCGT) and ADH2 (TAGATGCCGGAGTCCCAGTG) were used to amplify part of the Adh gene, which included truncated exon 1 to exon 3 (Chia et al., 1985, Moses et al., 1985). Another primer set (TGATTTTCGTTGCCGGTCTGGGAGG and CAGGGTGCCCAAGTCCAGTTTCCAGA) was used for amplification of the Adh gene in D. pseudobaimaii (Goto et al., 2004), which was not amplified by the ADH-1 and ADH2 primers. PCR amplification was carried out with Taq DNA polymerase (Invitrogen) under standard conditions and cycle profiles as recommended by the supplier. Amplified DNA products were diluted to 1 ng/μl and used as sequencing templates after their sizes were determined. We used the same primers for sequencing as that for PCR amplification. All sequence reactions were performed with the
1058
C.-C. Chen et al.
BigDye Terminator Cycle Sequencing Kit (ABI) using an ABI PRISM 310 and 3130 Genetic Analyzer. PCR products of Adh in the three species (D. ohnishii, D. bicornuta and D. pseudobaimaii) could not be sequenced directly, and were cloned into the pCR2.0 vector using the TOPO TA-cloning Kit (Invitrogen). DNA from several independent clones was extracted using the QIAprep Mini Kit (QIAGEN). Cloned DNA of Adh was sequenced in both the 5′ and 3′ orientations using the standard primers T7 and M13 reverse. D. pseudoobscura and D. tsukubaensis were used as outgroups. Phylogenetic analysis of the sequence data was performed using the MEGA5 software package (Tamura et al., 2011). COI, COII and Adh sequences were aligned using the ClustalW program (Thompson et al., 1994) included in MEGA5. Because of problems aligning introns of Adh sequences, only exon regions of this gene were used for constructing the phylogenetic tree. Combined aligned sequences were used to construct phylogenetic trees using the maximum-likelihood (ML) method. ML analyses were conducted using MEGA5, and bootstrap values from ML method were obtained after 1000 replications.
male is trying to mount was included in the duration of copulatory wing vibration for the species with copulatory courtship. Data were analyzed with Microsoft£ Excel 2010.
RESULTS Phylogenetic tree Sequences of two mitochondrial genes and a nuclear gene of the montium subgroup were submitted to DDBJ and the accession numbers are shown in Table 1. Sequences of three genes were combined to construct a maximum-likelihood (ML) tree (Fig. 1). As Figure 1 shows, the most basal species of the montium subgroup is D. parvula, and other species then split into two branches, one included D. pectinifera, D. baimaii, D. pseudobaimaii and the auraria complex, the other included the kikkawai, the serrata and the bokoue complexes and the remainder. Courtship types The categories and main elements of courtship behavior
Video recording, song recording and data analysis The video and song recordings were done separately with different facilities. The video recordings were used for analyzing courtship behavioral elements. The song recordings were for the duration of wing vibration and the mounting duration. Reproductively mature 6–11 day old virgin flies were used for video recording of courtship behavior. For each recording, one virgin male and one virgin female were introduced into a mating cell (1 cm × 3.5 cm) under a Motic£ Stereo Microscope equipped with a microscope digital camera (OPLENIC, Pro-MicroScan #5821) and linked to a computer. The courtship songs of 6–11 day-old unanaesthetized virgin fly pairs were recorded in an insulated anechoic room from 0830 to 1530 at 23.2°C (lights on 0700–1900). The system comprised a mating chamber (12 mm inside diameter, 2.5 mm internal height with acoustically transparent nylon net floors) placed in an Insectavox microphone which was connected to a filter (EF5-04 LP/HP Filter) to remove frequencies below 50 Hz and above 700 Hz. A recorder with a sampling frequency of 8 kHz was linked to one channel of the software (DataView version 8.6.1, http://www.st-andrews.ac.uk/ ~wjh/dataview/). Digital song files were subsequently analyzed for the duration of wing vibration. We also observed the courtship behavior and timed the mounting duration when we recorded the courtship songs. Mounting duration was determined Fig. 1. Phylogenetic tree and courtship types of the montium subgroup. Sequences of COI, COII from the time the male first mounted to and Adh were combined to construct a maximum-likelihood (ML) tree by using MEGA5, bootstrap the time the pair separated. For species values from ML method were obtained after 1000 replications. We superimposed the courtship without copulatory courtship, the wing types on the phylogenetic tree with different color. Green indicated the type P/C, in which flies vibration while a male was trying to display precopulatory courtship as often as copulatory courtship. Blue for the type P-/C, flies dismount was included in the duration of play mainly copulatory courtship and sporadically precopulatory courtship. Black for the type C, precopulatory wing vibration. On the flies show only copulatory courtship. Orange for the type C-, flies display sporadically copulatory courtship. *: Referred to Tomaru and Oguma (1994). other hand, the wing vibration while a
Courtship Patterns in the montium Subgroup Table 2. Type P/C P-/C C C-
1059
Courtship types and the behavioral elements in the montium subgroup. Behavioral elements
Species D. parvula, D. nikananu, D. biauraria D. triauraria, D. leontia, D. serrata, D. mayri, D. barbarae, D. diplacantha, D. montium* D. lacteicornis, D. tani, D. pectinifera, D. baimaii, D. pseudobaimaii, D. lini, D. ohnishii, D. ogumai, D. kikkawai, D. bocki, D. bunnanda, D. birchii, D. truncate, D. seguyi, D. vulcana D. rufa, D. asahinai, D. burlai
Before mounting
After mounting
Tapping/circling/(waving)/ (scissoring)/(licking)/wing vibration
Wing vibration
wing vibration/(waving)
Wing vibration
No
Wing vibration
No
Sporadically wing vibration
P: Most individuals displayed precopulatory courtship. P-: Precopulatory courtship was decreased, C: Most individuals displayed copulatory courtship. C-: Copulatory courtship was decreased. (): indicated the element presents in some species but not in others. *: according to the description in Spieth (1952).
of each type are shown in Table 2. Figure 2 illustrates the main features of courtship types in the montium subgroup. Four types of courtship behavior were categorized according to the timing of wing vibration. All investigated species in the montium subgroup displayed copulatory courtship, but to a different extent. Only a few species showed precopulatory courtship. Some species displayed precopulatory courtship as often as that of copulatory, such as D. parvula, D. nikananu and D. biauraria. They were categorized as type P/C. Some species, such as D. triauraria, D. leontia, D. serrata, D. mayri, D. barbarae and D. diplacantha, showed mainly copulatory courtship and sporadically precopulatory courtship. Most individuals of these species showed wing vibration after mounting, and a few individuals of each species before mounting, so these were categorized as type P-/C. Most species in the montium subgroup displayed only copulatory courtship, never singing before mounting; this type of courtship was categorized as type C. Three species (D. rufa, D. asahinai, and D. burlai) did not sing often either before mounting or after mounting. The courtship types of the montium subgroup are definitely different from typical Drosophila precopulatory courtship. Courtship duration Wing vibration is the main courtship element of the montium subgroup. Wing vibration before mounting has been recognized as one of major precopulatory courtship elements, while wing vibration after mounting and during copulation is a copulatory courtship behavior. Therefore, we timed wing vibration before and after mounting respectively and the mounting duration (Table 3). The mounting duration is different among species. However, it must have evolved rapidly, as this is apparently unrelated to the phylogenetic position of the species. There are large differences even among species in the
Fig. 2. Main poses of courtship types in the montium subgroup. Type P/C: flies display precopulatory (P) courtship as often as copulatory (C) courtship. Representative species: D. parvula. Type P-/C: flies display mainly copulatory courtship and, sporadically, precopulatory courtship. Representative species: D. serrata. Type C: flies show only copulatory courtship. Representative species: D. kikkawai, D. truncata. Type C-: flies display sporadically copulatory courtship. Representative species: D. asahinai, D. burlai.
1060
C.-C. Chen et al.
Table 3.
Duration of wing vibration and mounting in precopulatory and copulatory courtship.
Courtship type P/C
P-/C
C
C-
Species
N
D. parvula D. nikananu D. biauraria D. triauraria D. leontia D. serrata D. mayri D. barbarae D. diplacantha D. lacteicornis D. tani D. pectinifera D. baimaii D. pseudobaimaii D. lini D. ohnishii D. ogumai D. bocki D. kikkawai D. bunnanda D. birchii D. truncata D. seguyi D. vulcana D. rufa D. burlai D. asahinai
10 7 14 15 16 14 22 10 21 11 16 10 11 9 12 14 11 8 19 23 16 12 17 21 15 10 16
Duration of wing vibration (sec) Precopulatory (n%) 25.40 ± 28.90 (90) 23.86 ± 9.37 (100) 6.5 ± 6.32 (85.7) 1.33 ± 0.58 (20) 15.75 ± 9.50 (50) 22.75 ± 22.93 (28.5) 15.5 ± 23.69 (18.2) 4.67 ± 3.06 (30) 8.57 ± 6.35 (33) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Copulatory (n%)
Mounting duration (sec)
7.30 ± 5.81 (80) 371.00 ± 108.85 12.71 ± 8.24 (100) 696.29 ± 250.05 17.21 ± 9.08 (100) 474.29 ± 130.85 29.07 ± 16.28 (100) 407.8 ± 85.07 68.25 ± 47.91 (100) 318.88 ± 125.76 14.12 ± 8.70 (100) 303.64 ± 129.81 16.59 ± 4.92 (100) 98.19 ± 15.43 20.00 ± 20.65 (80) 583.50 ± 321.58 18.71 ± 8.43 (100) 487.19 ± 167.46 16.18 ± 7.22 (100) 555.63 ± 157.56 34.13 ± 16.67 (100) 1395.63 ± 288.81 31.80 ± 16.27 (100) 479.50 ± 181.88 29.82 ± 14.18 (100) 409.64 ± 129.82 59.56 ± 37.75 (100) 542.44 ± 166.38 110.83 ± 66.56 (100) 1319.00 ± 511.27 143.86 ± 41.74 (100) 788.64 ± 213.97 49.55 ± 19.47 (100) 425.91 ± 69.86 31.86 ± 33.92 (100) 182.14 ± 61.56 49.63 ± 28.60 (100) 309.53 ± 232.50 11.17 ± 6.04 (100) 278.65 ± 50.84 32.38 ± 19.11 (100) 249.44 ± 80.5 35.42 ± 16.06 (100) 193.25 ± 35.66 62.35 ± 53.33 (100) 318.47 ± 133.21 23.24 ± 9.96 (100) 445.24 ± 115.06 3.33 ± 5.25 (67) 298.13 ± 61.56 31.2 ± 28.85 (50) 254.10 ± 80.55 0.69 ± 1.99 (25) 380.44 ± 165.41
N: Number of investigated individuals. n%: Percentage of individuals showed wing vibration among investigated individuals. P: Precopulatory courtship, 80–100% individuals displayed precopulatory courtship. P-: Precopulatory courtship was decreased, about 18–50% individuals displayed precopulatory courtship. C: 80–100% individuals displayed copulatory courtship. C-: Copulatory courtship was decreased, about 25–67% individuals displayed copulatory courtship.
same clade of the species-complex, from 425.91 sec of D. ogumai to 1319 sec of D. lini in the lini clade of the kikkawai species complex (Table 3). For species of type P/C, most individuals sang both precopulatory and copulatory songs. 85.7–100% of individuals displayed precopulatory courtship, and 80–100% showed copulatory courtship. Drosophila nikananu and D. parvula sang precopulatory songs (mean duration, 23.86 sec and 25.40 sec, respectively) more often than copulatory songs (12.71 sec and 7.3 sec respectively). The reverse was true for D. biauraria; this species sang more copulatory songs (17.21 sec) and fewer precopulatory songs (6.5 sec). For species of type P-/C, the number of individuals which sang precopulatory songs was decreased. 18.2–50% displayed precopulatory courtship, and 80–100% showed copulatory courtship. All species, except D. serrata, sang more copulatory courtship (16.59–68.25 sec) than precopulatory courtship (1.33–15.75 sec). For species of type C, all investigated individuals sang only copulatory songs. The duration of singing is from 11.17 sec of D. bunnanda in the serrata complex to 143.86 sec of D. ohnishii in the kikkawai complex. For species of type C-, 25–67% individuals sang very brief copulatory songs, from 0.69 sec in 25% of D. asahinai
to 31.2 sec in 50% of D. burlai. Courtship types on the phylogenetic tree We superimpose the courtship types on the phylogenetic tree with different colors (Fig. 1). Green indicates the type P/C, blue for the type P-/C, black for the type C and orange for the type C-. We see that copulatory courtship is predominant in the montium subgroup. 13.8% of species are type P/C, 24.1% of species are type P-/C, 51.7% of species are type C and 10.4% of species are type C-. The most basal D. parvula has courtship of the type P/C. Two branches of montium subgroup contained types P/C, P-/C, C and C-. The species of type C are found in each sub-branch. The auraria species-complex in the branch A contained all four types: D. biauraria and D. subauraria were type P/C, D. auraria and D. triauraria were type P/-C, D. tani and D. lactericornis were type C. D. rufa and D. asahinai were type C-. Other species-complexes were type C except D. leontia in the kikkawai species complex and D. serrata in the serrata speciescomplex. Hence song types continue to change rapidly within this phylogenic group. DISCUSSION
Drosophila courtship behavior has been well studied since 1952 (Spieth, 1952). Recently, an overlooked courtship element, quivering, was found with males of D. melanogaster (Fabre et al., 2012). This quivering behavior plays a very important role in causing females to stop walking. Moreover, flies of three species of the D. virilis phylad and one species of the D. montana phylad display prolonged touching or licking and shorter singing (Vedenina et al., 2013). Many elements of Drosophila courtship may be much more variable than imagined. Diversity of courtship behavior in the montium subgroup The Drosophila montium species subgroup is a very interesting subgroup containing many species complexes (Zhang et al., 2003; Wen, 2004; DaLage et al., 2007). In this study, we found that there is a large diversity of courtship behavior but with copulatory courtship being most widespread. We categorized the courtship behavior of all investigated species into four types according to the timing of the wing vibration of the major courtship element, wing vibration before mounting and wing vibration after mounting. We tried to identify how many types of courtship are shown by spe-
Courtship Patterns in the montium Subgroup
cies in the montium subgroup, and if any species displays typical precopulatory courtship as that in D. melanogaster. We found four types of courtship patterns with copulatory courtship and gradually decreasing precopulatory courtship in this subgroup. All species in the montium subgroup display copulatory courtship, and no species display only the typical precopulatory courtship. The parameters of courtship song have been well studied as characters influencing mate recognition in Drosophila (Ritchie et al., 1999; Tomaru et al., 2004; Riabinina et al., 2011). However, the timing of singing courtship song during the courtship ritual has gained less attention. The courtship types in the montium subgroup are diverse and rapidly evolving; the timing of wing vibration is a crucial element of the diversity of the courtship. It is therefore important to consider whether the timing of songs is an important aspect of the courtship behavior of Drosophila, and what the causes and consequences of variation in this might be. Loss or gain of precopulatory courtship in the montium subgroup Mating in flight is thought to be the ancestral Dipteran mating pattern in some primitive Dipteran species, such as mosquitoes (Downes, 1969). In Drosophila, mating always occurs on food substrates and male flies display postures and movements before attempting to mount and copulate (Spieth, 1952). In the subgenus Sophophora, most species initiate courtship with tapping, and then follow with wing displays and wing vibration, courtship elements known as precopulatory courtship elements (Spieth, 1952). In the montium subgroup, only three of the species investigated frequently display both precopulatory courtship and copulatory courtship. Six investigated species sporadically showed precopulatory courtship and mainly copulatory courtship. In other words, among 29 species, only nine species had precopulatory courtship. Which occurred first in the montium subgroup, the loss of precopulatory courtship or the gain of copulatory courtship? Based on the phylogenetic tree in Fig. 1, the most basal species of the montium subgroup, D. parvula, produced more precopulatory songs than copulatory songs (Type P/C). Within the montium subgroup, branch B has a species with type P/C courtship, D. nikananu, which sang more songs before mounting than after mounting, like D. parvula. Branch A contains a species with type P/C courtship, D. biauraria, which sang more copulatory songs than precopulatory songs. In branch A, there are five, three and two species with type C, type P-/C and type C- courtships, respectively. There are ten, five and one species with type C, type P-/C and type C- courtships, respectively in branch B. Such a phylogenetic distribution of courtship types in the montium subgroup suggests that the precopulatory courtship is frequently being lost in each of branch. Interestingly, in species with type P-/C, some individuals only display copulatory courtship, for example, in D. serrata, 28.5% of individuals sang before mounting (Table 3). As Hoikkala and Crossley (2000) mentioned, males of this species retain the ability to sing before mounting, but appear not to use it frequently. This suggests that precopulatory courtship is being lost in these species. Why might P/C and type P-/C flies switch from precop-
1061
ulatory courtship to copulatory courtship? What benefits might be obtained from copulatory over precopulatory courtship? Males of many animals display copulatory courtship and it may function to induce responses in female reproductive behavior and physiology, increasing sperm utilisation (Eberhard, 1996; Peretti and Eberhard, 2010), or it could be a form of extended mate guarding. Males of the spider Physocyclus globosus perform copulatory courtship by vibrating their abdomen to bias sperm dumping (Peretti and Eberhard, 2010). If copulatory courtship is associated with sperm competition, it might be used more often in species which a female is mated with multiple males. Multiple mating is widespread throughout Drosophila and may influence many aspects of ejaculate evolution. It is unknown whether there is generally higher re-mating or other unusual aspects of sperm competition in the montium subgroup, though D. serrata has unusually high levels of polyandry (Frentiu and Chenoweth, 2008) and an EST library includes some seminal accessory proteins (Frentiu et al., 2009). Further studies of the mating system of this group are needed to evaluate the causes and consequences of a switch from precopulatory to copulatory courtship. ACKNOWLEDGMENTS We deeply thank Professor Masanori J. Toda for the long-term support of our work on the montium subgroup. We appreciate two anonymous reviewers’ crucial suggestions for improving this paper. This work is supported by NSFC to S. Y. W. (Grant no. 31372187) and partially supported by JSPS to M. W. (Grant no. 21570096).
REFERENCES Chia W, Savakis C, Karp R, Pelham H, Ashburner M (1985) Mutation of the Adh gene of Drosophila melanogaster containing an internal tandem duplication. J Mol Biol 186: 679–688 DaLage JL, Kergoat GJ, Maczkowiak F, Silvain JF, Cariou ML, Lachaise D (2007) A phylogeny of Drosophilidae using the Amyrel gene: questioning the Drosophila melanogaster speceis group boundaries. J Zool Syst Evol Res 45: 47–63 Downes JA (1969) The swarming and mating flight of Diptera. Annu Rev Entomol 14: 271–298 Eberhard WG (1996) Female control: sexual selection by cryptic female choice. Princeton University Press, Princeton, NJ Fabre CC, Hedwig B, Conduit G, Lawrence PA, Goodwin SF, Casal J (2012) Substrate-borne vibratory communication during courtship in Drosophila melanogaster. Curr Biol 22: 2180–2185 Frentiu FD, Chenoweth SF (2008) Polyandry and paternity skew in natural and experimental populations of Drosophila serrata. Mol Ecol 17: 1589–1596 Frentiu FD, Adamski M, Mcgraw EA, Blows MW, Chenoweth SF (2009) An expressed sequence tag (EST) library for Drosophila serrata, a model system for sexual selection and climatic adaptation studies. BMC Genomics 10: 40 Giglio EM, Dyer KA (2013) Divergence of premating behaviors in the closely related species Drosophila subquinaria and D. recens. Ecol Evol 3: 365–374 Gleason JM, Pierce AA, Vezeau AL, Goodman SF (2012) Different sensory modalities are required for successful courtship in two species of Drosophila willistoni group. Anim Behav 83: 217– 227 Gopfert MC, Robert D (2002) The mechanical basis of Drosophila audition. J Exp Biol 205: 1199–1208 Goto H, Inomata N, Szmidt AE, Yamazaki T (2004) Nucleotide variation of seven genes in Drosophila kikkawai. Genes Genet Syst 79: 19–26
1062
C.-C. Chen et al.
Greenspan RJ, Ferveur JF (2000) Courtship in Drosophila. Annu Rev Genet 34: 205–232 Hoikkala A, Crossley S (2000) Copulatory courtship in Drosophila behavior and songs of D. birchii and D. serrata. J Insect Behav 13: 71–76 Lemeunier F, David JR, Tsacas L, Ashburner M (1986) The melanogaster species group. In “The Genetics and Biology of Drosophila” Ed by M Ashburner, HL Carson, J Thompson, Academic Press, London and Orlando, pp 147–256 Li YF (2011) Role of sine song in Drosophila lini clade and its genetic control. PhD thesis. South China Agriculture University Li YF, Wen SY, Ritchie MG (2012) Copulatory song in three species of the Drosophila montium subgroup extends copulation and shows unusual genetic control. Anim Behav 83: 233–238 Moses K, Heberlein U, Ashburner M (1990) The Adh gene promoters of Drosophila melanogaster and Drosophila orena are functionally conserved and share features of sequence structure and nuclease-protected sites. Mol Cell Biol 10: 539–548 Peretti AV, Eberhard WG (2010) Cryptic female choice via sperm dumping favours male copulatory courtship in a spider. J Evol Biol 23: 271–281 Riabinina O, Dai M, Duke T, Albert JT (2011) Active process mediates species-specific tuning of Drosophila ears. Curr Biol 21: 658–664 Ritchie MG, Gleason JM (1995) Rapid evolution of courtship song pattern in Drosophila willistoni sibling species. J Evol Biol 8: 463–479 Ritchie MG, Halsey EJ, Gleason JM (1999) Drosophila song as a species-specific mating signal and the behavioural importance of Kyriacou & Hall cycles in D. melanogaster song. Anim Behav 58: 649–657 Spieth HT (1952) Mating behaviour within the genus Drosophila (Diptera). Bull Amer Mus Nat Hist 99: 401–474 Spieth HT, Hsu TC (1950) The influence of light on the mating behavior of seven species of the Drosophila melanogaster spe-
cies group. Evolution 4: 316–325 Sturtevant AH (1915) Experiments on sex recognition and the problem of sexual selection in Drosophila. J Anim Behav 5: 351–366 Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28: 2731–2739 Thompson JD, Higgins DG, Gibson TJ (1994) ClustalW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680 Tomaru M, Oguma Y (1994) Differences in courtship song in the species of the Drosophila auraria complex. Anim Behav 47: 133–140 Tomaru M, Yamada H, Oguma Y (2004) Female mate recognition and sexual isolation depending on courtship song in Drosophila sechellia and its siblings. Genes Genet Syst 79: 145–150 Vedenina VY, Ivanova TI, Lazebny OE (2013) Analysis of courtship behavior in closely related species of Drosophila virilis group: a new approach arises new questions. J Insect Behav 26: 402– 415 Wen SY (2004) Studies on the speciation of Drosophila lini and its related species. PhD thesis. South China Agricultural University Wen SY, Li YF (2011) An evolutionary view on courtship behavior of Drosophila: from a comparative approach. Low Temp Sci 69: 87–100 Wen SY, Yamada H, Li YF, Kimura MT, Oguma Y, Sawamura K, Toda MJ (2011) Copulatory courtship behavior and sine song as a mate recognition cue in Drosophila lini and its sibling species. Zool Sci 28: 469–475 Zhang Z, Inomata N, Cariou ML, Da LJ, Yamazaki T (2003) Phylogeny and the evolution of the Amylase multigenes in the Drosophila montium species subgroup. J Mol Evol 56: 121–30 (Received June 18, 2013 / Accepted July 26, 2013)
