Cell Tissue Res DOI 10.1007/s00441-015-2150-7
REGULAR ARTICLE
Cranial neural crest deletion of VEGFa causes cleft palate with aberrant vascular and bone development Cynthia Hill & Britni Jacobs & Lucy Kennedy & Sarah Rohde & Bin Zhou & Scott Baldwin & Steven Goudy
Received: 13 July 2014 / Accepted: 5 February 2015 # Springer-Verlag Berlin Heidelberg 2015
Abstract Cleft palate is among the most common craniofacial congenital anomalies. Up to 30 % of patients with cleft palate also have associated cardiac and vascular defects. VEGFa, a critical growth factor involved in multiple developmental processes including angiogenesis and ossification, is also required for palate development. Conditional deletion of VEGFa in cranial neural crest (CNC) cells using Wnt1-Cre (VEGFaCKO) resulted in cleft palate in mice. The phenotype included reduced proliferation of cells within the palatal shelves, abnormal palatal shelf elongation and elevation, and the inability to undergo fusion. Vascularization of the VEGFaCKO palatal shelves was greatly reduced, suggesting a non-cell autonomous role of VEGFa signaling from the CNC-derived cells to the endothelium during vessel formation. Defective vascular development was coupled with deficient intramembranous ossification of maxillary and palatal mesenchyme. In vitro assessment of CNC-derived palatal mesenchymal cells from VEGFaCKO mice demonstrated normal ossification after BMP2 stimulation, suggesting that inadequate expression of Bmp2 in VEGFaCKO mice was, in part, responsible for reduced ossification. Taken together, these data demonstrate that VEGFa produced in the CNC-derived Electronic supplementary material The online version of this article (doi:10.1007/s00441-015-2150-7) contains supplementary material, which is available to authorized users. C. Hill (*) : B. Jacobs : L. Kennedy : S. Rohde : S. Goudy Department of Otolaryngology, Vanderbilt School of Medicine, 7309 21st Ave South, Nashville, TN 27232, USA e-mail: [email protected] B. Zhou Department of Genetics, Albert Einstein College of Medicine, 1301 Morris Park Ave, Bronx, NY 20461, USA S. Baldwin Department of Pediatrics, Vanderbilt School of Medicine, 2200 Children’s Way, Nashville, TN 37232, USA
mesenchyme drives proliferation, vascularization, and ossification, all of which are critical for palate development. Keywords Cleft palate . Cranial neural crest . Ossification . Angiogenesis . VEGF
Introduction Cleft palate occurs in ~1 in 1000 live births making it one of the most common craniofacial anomalies in children (Murray and Schutte 2004; Schutte and Murray 1999). Palatogenesis requires the coordination of palatal shelf elongation, elevation and fusion during early embryonic development, and interruption of any of these processes leads to cleft palate (Chai and Maxson 2006; Gritli-Linde 2007). Cleft palate in humans is often associated with distinct syndromes for which many genetic causes have been identified (Murray and Schutte 2004). Frequently, patients who develop cleft palate will also have associated vascular anomalies, most commonly cardiac abnormalities, which occur in up to 30 % of cases (Wyse et al. 1990). Angiogenesis is particularly affected by VEGFa growth factor signaling which delivers the cues necessary to initiate blood vessel branching and endothelial tip cell extension (Gerhardt et al. 2003; Ruhrberg et al. 2002). Furthermore, VEGFa is also required in multiple processes including neurogenesis and osteogenesis, all of which are critical for the development of many organ systems during embryogenesis (Ferrara et al. 2003; Haigh 2008). Abnormal osteogenesis has been associated with hypomorphic mutations in VEGFa, with concomitant skeletal and vascular defects noted (Maes et al. 2002; Zelzer et al. 2002). Specifically, hypomorphic VEGF120/120 mice were found to have craniofacial defects with reduced extracellular matrix deposition and deficient frontal bone ossification (Zelzer
Cell Tissue Res
et al. 2002). Further examination of the VEGF120/120 mice revealed cleft palate formation with hypoplastic maxillary and palatine bones coupled with reduced vascular density in the mandible (Stalmans et al. 2003). We explored the requirement of VEGFa in cranial neural crest (CNC) cells, which contribute to the majority of the palatal mesenchyme during development. Loss of VEGFa expression in CNC cells impaired palatal shelf elongation and elevation, leading to cleft palate associated with reduced cell proliferation. VEGFaCKO mice also demonstrated deficient vascular and bone development within their palatal shelves and maxilla. Understanding the association between defective vascularization and ossification in the manifestation of cleft palate may inform surgeons about potential wound-healing problems and inadequate bone growth following repair in these patients.
PH3 (Imclone), and cleaved Caspase 3 (Cell Signaling) diluted in 1 % donkey serum overnight at 4 °C. The following day, the slides were washed, incubated with secondary antibodies (Invitrogen) for 3 h at room temperature, and counterstained with DAPI (Vectastain). Vascular channels were quantified by counting number of PECAM+ vessels per high-powered field at ×40. Proliferative and apoptotic cells were quantified by counting PH3+ and Caspase 3+ cells, respectively, and dividing by total cells per high powered field at ×40. In each palate shelf, 5 sections were analyzed separately in the anterior (same plane as the vomeronasal organ) and posterior regions (same plane as the orbits), and the plane of the lateral nasal wall and hinge region were used to determine the lateral edge of the palate shelf to be counted. All imaging was performed on a Nikon E800 microscope, and images were obtained with SPOT imaging software (Diagnostic Instruments).
Materials and methods qPCR Murine model Wnt1-cre mice (MGI 2386470) were obtained from Jackson labs and VEGFaF/F (MGI 103178) were a gift from Dr. Nancy Ferrara (Gerber et al. 1999). Wnt1-Cre−;VEGFaF/F (Control) and Wnt1-Cre+;VEGFaF/F (VEGFaCKO) mice were analyzed at E12.5–18.5 via timed pregnancies. All procedures and protocols were done in accordance with a Vanderbilt IACUC approved protocol. Histology Embryos were harvested at E12.5–18.5, genotyped, and processed as previously described (Hill et al. 2014; Humphreys et al. 2012). Briefly, heads were fixed in 4 % paraformaldehyde (PFA) for 30 min to 1 h and frozen in optimal cutting temperature (OCT) media after sucrose dehydration. All staining was performed on 8-μm-thick coronal sections that were thawed and rehydrated in phosphate-buffered saline (PBS). Following rehydration, sections were stained in Meyer’s hematoxylin for 5 min, dehydrated again, and counter-stained with eosin according to standard protocols. Von Kossa staining was performed as previously described (Hill et al. 2014). Palatal measurements were analyzed as previously described (Goudy et al. 2010). Palatal shelf length is defined as the length from the hinge of the palatal shelf to the tip of the medial edge epithelium (MEE) (Rice et al. 2004).
To determine changes in gene expression, we used qPCR as previously described (Hill et al. 2012). Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. cDNA was generated from 1 μg total RNA using oligo-dT primers and Superscript III polymerase (Invitrogen). Real-time PCR analysis was done with iQ SYBR green supermix (Bio-Rad). The expression levels were calculated using the ΔΔCT method. The fold change in expression levels, R, was calculated as follows: R=2−ΔΔCT (where R=2 (ΔCT treated−ΔCT control) ) to normalize the abundance of all transcripts to the level of GAPDH RNA expression. Primer pairs are shown in Table 1. Mouse embryonic palatal mesenchymal cell culture Primary mouse embryonic palatal mesenchymal (MEPM) cells were generated from E14.5 embryos similar to that previously described for maxillary mesenchymal cells (Hill et al. 2014). Embryos were harvested and the palatal shelves were dissected and incubated in trypsin at 37 °C with 5 % CO2 for 30 min. The epithelium was removed from the mesenchyme, and the tissue was pipetted up and down vigorously until the cells were dispersed. The cells were filtered through a 100-μm mesh and cultured in DMEM/F12 supplemented with 10 % FBS and 100 μg/mL penicillin/streptomycin (Invitrogen). Osteoblast mineralization
Immunofluorescence Sections were fixed in acetone, washed and permeabilized in 0.1 % Tween-20. Sections were blocked with 10 % donkey serum for 1 h at room temperature and incubated with primary antibodies: PECAM (BD Pharmingen), SMA (Millipore),
The capacity of MEPM cells to mineralize surrounding matrix was tested by providing confluent monolayers osteogenic media (OM): α-MEM containing 2.5 % FBS, 100 μg/mL penicillin/streptomycin, 100 μg/mL ascorbic acid, 5 mM β-glycerophosphate, and 100 ng/mL BMP2 (R&D Systems) as
Cell Tissue Res Table 1
qPCR primer sequences
Gene name
Forward primer 5′→3′
Reverse primer 5′→3′
Sm22α SmαA Pecam Flk1 Tie2 Runx2 Alk Phos Osteocalcin Osterix Tgfβ1 Tgfβ2 Tgfβ3 Bmp2 Bmp4 Alk2 Alk3 Alk5
agccagtgaaggtgcctgagaac gagaagcccagccagtcg tggttgtcattggagtggtc tgcgggctcctgactacactac ttggattgtcacgaggtcaagaag cccagccacctttacctaca gctgatcattcccacgtttt tgcttgtgacgagctatcag atcttccacttcgcctgc cctgggttggaagtggatc tgctaacttctgtgctggg caggatctaggctggaaatgg ttatcaggacatggttgtggag gtagtgccattcggagcg agagggtcgatatttgggc accatttccagccctaca ccttctgatccatcggttga
tgcccaaagccattagagtcctc ctcttgctctgggcttca ttctcgctgttggagttcag ttcccaaatgctccaccaactctg caatacaccataggaccagacatcac tatggagtgctgctggtctg ctgggcctggtagttgttgt gaggacagggaggatcaagt aaccaatgggtccagcac ttggttgtagagggcaagg gcttcgggatttatggtgttg gggttcagggtgttgtatagtc gggaaatattaaagtgtcagctgg atcagcattcggttaccagg aacttgggtcattgggaac tcactgggcaccatgtt ccattggcataccagcat
TgfβR2 TgfβR3 Bmpr2
ggagaagtgaaggattacgagc agcatttgtgatcggagc ttctctggatctttcagccac
cacacgatctggatgccc tgctccctatgctgtgg cctgatttgccatcttgtgttg
previously described (Hill et al. 2014). Cultures were incubated for 16 days at 37 °C with 5 % CO2 with changes of media every 2 days and stained with alizarin red solution (ARS). Statistical analysis Paired Student’s t test was performed to establish significance using Excel software. Data are presented as the mean of three independent experiments±SEM, unless otherwise specified. P values of
REGULAR ARTICLE
Cranial neural crest deletion of VEGFa causes cleft palate with aberrant vascular and bone development Cynthia Hill & Britni Jacobs & Lucy Kennedy & Sarah Rohde & Bin Zhou & Scott Baldwin & Steven Goudy
Received: 13 July 2014 / Accepted: 5 February 2015 # Springer-Verlag Berlin Heidelberg 2015
Abstract Cleft palate is among the most common craniofacial congenital anomalies. Up to 30 % of patients with cleft palate also have associated cardiac and vascular defects. VEGFa, a critical growth factor involved in multiple developmental processes including angiogenesis and ossification, is also required for palate development. Conditional deletion of VEGFa in cranial neural crest (CNC) cells using Wnt1-Cre (VEGFaCKO) resulted in cleft palate in mice. The phenotype included reduced proliferation of cells within the palatal shelves, abnormal palatal shelf elongation and elevation, and the inability to undergo fusion. Vascularization of the VEGFaCKO palatal shelves was greatly reduced, suggesting a non-cell autonomous role of VEGFa signaling from the CNC-derived cells to the endothelium during vessel formation. Defective vascular development was coupled with deficient intramembranous ossification of maxillary and palatal mesenchyme. In vitro assessment of CNC-derived palatal mesenchymal cells from VEGFaCKO mice demonstrated normal ossification after BMP2 stimulation, suggesting that inadequate expression of Bmp2 in VEGFaCKO mice was, in part, responsible for reduced ossification. Taken together, these data demonstrate that VEGFa produced in the CNC-derived Electronic supplementary material The online version of this article (doi:10.1007/s00441-015-2150-7) contains supplementary material, which is available to authorized users. C. Hill (*) : B. Jacobs : L. Kennedy : S. Rohde : S. Goudy Department of Otolaryngology, Vanderbilt School of Medicine, 7309 21st Ave South, Nashville, TN 27232, USA e-mail: [email protected] B. Zhou Department of Genetics, Albert Einstein College of Medicine, 1301 Morris Park Ave, Bronx, NY 20461, USA S. Baldwin Department of Pediatrics, Vanderbilt School of Medicine, 2200 Children’s Way, Nashville, TN 37232, USA
mesenchyme drives proliferation, vascularization, and ossification, all of which are critical for palate development. Keywords Cleft palate . Cranial neural crest . Ossification . Angiogenesis . VEGF
Introduction Cleft palate occurs in ~1 in 1000 live births making it one of the most common craniofacial anomalies in children (Murray and Schutte 2004; Schutte and Murray 1999). Palatogenesis requires the coordination of palatal shelf elongation, elevation and fusion during early embryonic development, and interruption of any of these processes leads to cleft palate (Chai and Maxson 2006; Gritli-Linde 2007). Cleft palate in humans is often associated with distinct syndromes for which many genetic causes have been identified (Murray and Schutte 2004). Frequently, patients who develop cleft palate will also have associated vascular anomalies, most commonly cardiac abnormalities, which occur in up to 30 % of cases (Wyse et al. 1990). Angiogenesis is particularly affected by VEGFa growth factor signaling which delivers the cues necessary to initiate blood vessel branching and endothelial tip cell extension (Gerhardt et al. 2003; Ruhrberg et al. 2002). Furthermore, VEGFa is also required in multiple processes including neurogenesis and osteogenesis, all of which are critical for the development of many organ systems during embryogenesis (Ferrara et al. 2003; Haigh 2008). Abnormal osteogenesis has been associated with hypomorphic mutations in VEGFa, with concomitant skeletal and vascular defects noted (Maes et al. 2002; Zelzer et al. 2002). Specifically, hypomorphic VEGF120/120 mice were found to have craniofacial defects with reduced extracellular matrix deposition and deficient frontal bone ossification (Zelzer
Cell Tissue Res
et al. 2002). Further examination of the VEGF120/120 mice revealed cleft palate formation with hypoplastic maxillary and palatine bones coupled with reduced vascular density in the mandible (Stalmans et al. 2003). We explored the requirement of VEGFa in cranial neural crest (CNC) cells, which contribute to the majority of the palatal mesenchyme during development. Loss of VEGFa expression in CNC cells impaired palatal shelf elongation and elevation, leading to cleft palate associated with reduced cell proliferation. VEGFaCKO mice also demonstrated deficient vascular and bone development within their palatal shelves and maxilla. Understanding the association between defective vascularization and ossification in the manifestation of cleft palate may inform surgeons about potential wound-healing problems and inadequate bone growth following repair in these patients.
PH3 (Imclone), and cleaved Caspase 3 (Cell Signaling) diluted in 1 % donkey serum overnight at 4 °C. The following day, the slides were washed, incubated with secondary antibodies (Invitrogen) for 3 h at room temperature, and counterstained with DAPI (Vectastain). Vascular channels were quantified by counting number of PECAM+ vessels per high-powered field at ×40. Proliferative and apoptotic cells were quantified by counting PH3+ and Caspase 3+ cells, respectively, and dividing by total cells per high powered field at ×40. In each palate shelf, 5 sections were analyzed separately in the anterior (same plane as the vomeronasal organ) and posterior regions (same plane as the orbits), and the plane of the lateral nasal wall and hinge region were used to determine the lateral edge of the palate shelf to be counted. All imaging was performed on a Nikon E800 microscope, and images were obtained with SPOT imaging software (Diagnostic Instruments).
Materials and methods qPCR Murine model Wnt1-cre mice (MGI 2386470) were obtained from Jackson labs and VEGFaF/F (MGI 103178) were a gift from Dr. Nancy Ferrara (Gerber et al. 1999). Wnt1-Cre−;VEGFaF/F (Control) and Wnt1-Cre+;VEGFaF/F (VEGFaCKO) mice were analyzed at E12.5–18.5 via timed pregnancies. All procedures and protocols were done in accordance with a Vanderbilt IACUC approved protocol. Histology Embryos were harvested at E12.5–18.5, genotyped, and processed as previously described (Hill et al. 2014; Humphreys et al. 2012). Briefly, heads were fixed in 4 % paraformaldehyde (PFA) for 30 min to 1 h and frozen in optimal cutting temperature (OCT) media after sucrose dehydration. All staining was performed on 8-μm-thick coronal sections that were thawed and rehydrated in phosphate-buffered saline (PBS). Following rehydration, sections were stained in Meyer’s hematoxylin for 5 min, dehydrated again, and counter-stained with eosin according to standard protocols. Von Kossa staining was performed as previously described (Hill et al. 2014). Palatal measurements were analyzed as previously described (Goudy et al. 2010). Palatal shelf length is defined as the length from the hinge of the palatal shelf to the tip of the medial edge epithelium (MEE) (Rice et al. 2004).
To determine changes in gene expression, we used qPCR as previously described (Hill et al. 2012). Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. cDNA was generated from 1 μg total RNA using oligo-dT primers and Superscript III polymerase (Invitrogen). Real-time PCR analysis was done with iQ SYBR green supermix (Bio-Rad). The expression levels were calculated using the ΔΔCT method. The fold change in expression levels, R, was calculated as follows: R=2−ΔΔCT (where R=2 (ΔCT treated−ΔCT control) ) to normalize the abundance of all transcripts to the level of GAPDH RNA expression. Primer pairs are shown in Table 1. Mouse embryonic palatal mesenchymal cell culture Primary mouse embryonic palatal mesenchymal (MEPM) cells were generated from E14.5 embryos similar to that previously described for maxillary mesenchymal cells (Hill et al. 2014). Embryos were harvested and the palatal shelves were dissected and incubated in trypsin at 37 °C with 5 % CO2 for 30 min. The epithelium was removed from the mesenchyme, and the tissue was pipetted up and down vigorously until the cells were dispersed. The cells were filtered through a 100-μm mesh and cultured in DMEM/F12 supplemented with 10 % FBS and 100 μg/mL penicillin/streptomycin (Invitrogen). Osteoblast mineralization
Immunofluorescence Sections were fixed in acetone, washed and permeabilized in 0.1 % Tween-20. Sections were blocked with 10 % donkey serum for 1 h at room temperature and incubated with primary antibodies: PECAM (BD Pharmingen), SMA (Millipore),
The capacity of MEPM cells to mineralize surrounding matrix was tested by providing confluent monolayers osteogenic media (OM): α-MEM containing 2.5 % FBS, 100 μg/mL penicillin/streptomycin, 100 μg/mL ascorbic acid, 5 mM β-glycerophosphate, and 100 ng/mL BMP2 (R&D Systems) as
Cell Tissue Res Table 1
qPCR primer sequences
Gene name
Forward primer 5′→3′
Reverse primer 5′→3′
Sm22α SmαA Pecam Flk1 Tie2 Runx2 Alk Phos Osteocalcin Osterix Tgfβ1 Tgfβ2 Tgfβ3 Bmp2 Bmp4 Alk2 Alk3 Alk5
agccagtgaaggtgcctgagaac gagaagcccagccagtcg tggttgtcattggagtggtc tgcgggctcctgactacactac ttggattgtcacgaggtcaagaag cccagccacctttacctaca gctgatcattcccacgtttt tgcttgtgacgagctatcag atcttccacttcgcctgc cctgggttggaagtggatc tgctaacttctgtgctggg caggatctaggctggaaatgg ttatcaggacatggttgtggag gtagtgccattcggagcg agagggtcgatatttgggc accatttccagccctaca ccttctgatccatcggttga
tgcccaaagccattagagtcctc ctcttgctctgggcttca ttctcgctgttggagttcag ttcccaaatgctccaccaactctg caatacaccataggaccagacatcac tatggagtgctgctggtctg ctgggcctggtagttgttgt gaggacagggaggatcaagt aaccaatgggtccagcac ttggttgtagagggcaagg gcttcgggatttatggtgttg gggttcagggtgttgtatagtc gggaaatattaaagtgtcagctgg atcagcattcggttaccagg aacttgggtcattgggaac tcactgggcaccatgtt ccattggcataccagcat
TgfβR2 TgfβR3 Bmpr2
ggagaagtgaaggattacgagc agcatttgtgatcggagc ttctctggatctttcagccac
cacacgatctggatgccc tgctccctatgctgtgg cctgatttgccatcttgtgttg
previously described (Hill et al. 2014). Cultures were incubated for 16 days at 37 °C with 5 % CO2 with changes of media every 2 days and stained with alizarin red solution (ARS). Statistical analysis Paired Student’s t test was performed to establish significance using Excel software. Data are presented as the mean of three independent experiments±SEM, unless otherwise specified. P values of
