This article was downloaded by: [New York University] On: 18 May 2015, At: 23:59 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
GM Crops & Food: Biotechnology in Agriculture and the Food Chain Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/kgmc20
Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus ab
b
Dung Tien Le , Ha Duc Chu & Takahide Sasaya
a
a
Research Team for Vector-borne Diseases; National Agriculture Research Center; Tsukuba, Ibaraki, Japan b
National Key Laboratory of Plant and Cell Technology; Agricultural Genetics Institute; Vietnam Academy of Agricultural Science; Hanoi, Vietnam Published online: 18 May 2015.
Click for updates To cite this article: Dung Tien Le, Ha Duc Chu & Takahide Sasaya (2015) Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus, GM Crops & Food: Biotechnology in Agriculture and the Food Chain, 6:1, 47-53, DOI: 10.1080/21645698.2015.1025188 To link to this article: http://dx.doi.org/10.1080/21645698.2015.1025188
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
GM Crops & Food, 6:47–53, 2015 Ó 2015 Taylor & Francis Group, LLC ISSN: 2164-5698 print / 2164-5701 online DOI: 10.1080/21645698.2015.1025188
Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus Dung Tien Le,1,2,* Ha Duc Chu,2 and Takahide Sasaya1,y 1
Downloaded by [New York University] at 23:59 18 May 2015
Research Team for Vector-borne Diseases; National Agriculture Research Center; Tsukuba, Ibaraki, Japan 2 National Key Laboratory of Plant and Cell Technology; Agricultural Genetics Institute; Vietnam Academy of Agricultural Science; Hanoi, Vietnam
ABSTRACT. Rice tungro spherical virus (RTSV), also known as Rice waika virus, does not cause visible symptoms in infected rice plants. However, the virus plays a critical role in spreading Rice tungro bacilliform virus (RTBV), which is the major cause of severe symptoms of rice tungro disease. Recent studies showed that RNA interference (RNAi) can be used to develop virusresistance transgenic rice plants. In this report, we presented simple procedures and protocols needed for the creation of transgenic rice plants capable of producing small interfering RNA specific against RTSV sequences. Notably, our study showed that 60 out of 64 individual hygromycin-resistant lines (putative transgenic lines) obtained through transformation carried transgenes designed for producing hairpin double-stranded RNA. Northern blot analyses revealed the presence of small interfering RNA of 21- to 24-mer in 46 out of 56 confirmed transgenic lines. Taken together, our study indicated that transgenic rice plants carrying an inverted repeat of 500-bp fragments encoding various proteins of RTSV can produce small interfering RNA from the hairpin RNA transcribed from that transgene. In light of recent studies with other viruses, it is possible that some of these transgenic rice lines might be resistant to RTSV. KEYWORDS. rice tungro disease, RNAi, transgenic rice, disease resistance, rice tungro spherical virus ABBREVIATIONS. RTSV, rice tungro spherical virus; RTBS, rice tungro bacilliform virus; CP, coat protein; NTP, nucleotide triphosphat-binding protein; Pro, 3C-like protease; Pol, RNAdependent RNA polymerase
INTRODUCTION Tungro disease of rice is caused by 2 viruses, Rice tungro bacilliform virus (RTBV) and Rice
tungro spherical virus (RTSV). The diseased plants that were infected with both viruses showed stunting, yellowing or yellow-orange discoloration and reduced tillering (Hibino and
*Correspondence to: Dr. Dung Tien Le; Email: [email protected] Received December 9, 2015; Revised February 24, 2015; Accepted February 24, 2015. y Present address: Plant Disease Group, Agro-Environment Research Division, Kyushu Okinawa Agricultural Research Center, Koshi, Kumamoto, Japan 47
Downloaded by [New York University] at 23:59 18 May 2015
48
Le et al.
Cabauatan, 1987). RTBV-infected plants exhibited milder symptom while RTSVinfected plants showed only mild stunting. RTBV is a badnavirus of 100-300 nm in length and 30-35 nm in width. It possesses a circular double-stranded DNA molecule. By contrast, RTSV is polyhedral in shape with a diameter about 30 nm, carrying a single-stranded RNA molecule. RTBV and RTSV are transmitted semi-persistently by Nephotettix spp., of which Nephotettix virescens is the most effective vector. Right after feeding on plants infected with RTBV and RTSV, the leafhoppers transmit the viruses either together or RTBV or RTSV alone. The transmission capacity remains active for 4 to 5 days for RTBV but only 2 to 4 days for RTSV. The insect vectors could acquire RTSV from the plant infected with RTSV alone but fails to acquire RTBV from the plant infected with only RTBV. A detailed mechanism on how the vector insect transmits RTSV and RTBV had been thoroughly reviewed (Hibino, 1996). The single-stranded polyadenylated RNA of RTSV consists of 12,180 nucleotides encoding a pyloprotein of 393 kDa. Due to several common features between RTSV and animal picornavirus, RTSV was sometimes called a “plant picornavirus.” Some of the processed products of the polyprotein have been identified, including coat proteins 1-3, nucleotide triphosphatebinding protein, a protease and an RNA-dependent RNA polymerase (Fig. 1A) (Hibino, 1996). Recent progress in the application of RNA interference (RNAi) in developing virus-resistant transgenic rice plants had provided promising result. Notably, using an inverted repeat of the genes encoding Pns9 and Pns12 in rice gall dwarf virus (RGDV) and rice dwarf virus (RDV), respectively, Shimizu et al. have successfully developed the transgenic rice plants resistant to these viruses (Shimizu et al., 2009; Shimizu et al., 2012). Very often, the disruption of a single virus gene by RNAi could lead to a virus-resistant phenotype (Shimizu, NakazonoNagaoka, Akita et al., 2011; Shimizu, Nakazono-Nakaoka, Uehara-Ichiki et al., 2011, 2013). In 2008, Tyagi et al. reported the creation of a construct carrying an inverted repeat of the gene encoding ORF-IV protein of RTBV. Rice
plants transformed with this construct exhibited lower virus titers, and one of the 2 lines showed very mild symptom (Tyagi et al., 2008). Quite recently, Verma et al. found a delayed in virus accumulation and low virus transmission from transgenic rice overexpressing RTSV RNA in either sense or anti-sense direction (Verma et al., 2012). Another study targeting RTSV was by Huet et al., where the authors overexpressed a truncated form of RTSV replicase in rice and found the transgenic rice to be immunized from RTSV infection (Huet et al., 1999). The same group also found overexpression of RTSV coat proteins in rice could offer moderate protection against RTSV infection (Sivamani et al., 1999). In this work, we created transgenic rice plants capable of producing small interfering RNA against genes coding for coat protein 1 (CP1), coat protein 2 (CP2), coat protein 3 (CP3) or nucleotide triphosphate-binging protein (NTP) of RTSV aiming at developing rice plants resistant to not only RTSV infection but also the tungro disease.
MATERIALS AND METHODS Construction of Plasmids To create RNAi-inducing constructs, each 500-bp fragments was amplified from the cDNA library obtained from RTSV RNA by the following primer sets (Table 1) targeted to the RTSV genes for CP1, CP2, CP3, and NTP. The resulting fragments were first cloned into GatewayÒ entry vector pENTR-D/TOPO (Invitrogen) and were then transferred into GatewayÒ -compatible destination vector pANDA (Miki and Shimamoto, 2004) using LR clonase reaction according to the manufacture’s instruction (Invitrogen). The presence of the inverted repeats was confirmed by sequencing and reconfirmed by colony PCR after the vector was transformed into Agrobacterium.
Rice Transformation Rice (Oryza sativa) calli of japonica nihonbare variety were induced from mature seeds and subjected to co-culture with Agrobacterium
RNA INTERFERENCE OF RICE TUNGRO SPHERICAL VIRUS
49
Downloaded by [New York University] at 23:59 18 May 2015
FIGURE 1. Schematic presentation of the creation of transgenic rice plants producing short RNAs of rice tungro spherical virus (RTSV). (A) Genome organization of RTSV RNA (CP1-3, coat protein 1-3; NTP, nucleotide triphosphate-binding protein; Pro, 3C-like protease; Pol, RNA-dependent RNA polymerase), (B) procedures involving in constructing an RNA silencing-trigger vector, and (C) transformation and screening of transgenic events producing short RNAs.
harboring plasmid. The transformation process followed a published procedure (Hiei et al., 1994). Transformants were selected by 50 mg/ L hygromycin B. Regenerated T0 plants were transferred to pots containing commercial soil (Bonsol; Sumitomo Chemical, Tokyo, Japan). The pots were placed in a greenhouse at 25§ 3 C under natural sunlight.
Screening by PCR To confirm the presence of transgenes in the putative transgenic plants, the transgenic plants were evaluated by PCR as described previously (Shimizu et al., 2009; Shimizu et al., 2012).
Briefly, a small portion of the leaves of T0 plants were collected and DNA were extracted using 250 mL buffer containing 0.2M Tris-Cl pH7.5, 0.25M NaCl, 25mM EDTA and 0.5% SDS plus 50 mL of PCI solution (phenol, chloroform and isoamyl alcohol). The resulting supernatant were then diluted 10-fold in distilled deionized water and were used in PCR reactions. The duplexing PCR contained 2 primer sets (Table 1) -one to detect the GUSlinker from the transgene insert, the other to detect rice actin gene. Following duplex PCR reaction, a positively confirmed transgenic plant must result in 2 bands of 650bp (GUSLinker) and 450bp (rice actin).
50
Le et al.
Downloaded by [New York University] at 23:59 18 May 2015
Table 1. Primers used in this study
RESULTS
Primer names
Primer sequences (50 to 30 )
Creation of RNAi-Inducing Constructs
RTSV-CP1-F RTSV-CP1-R RTSV-CP2-F RTSV-CP2-R RTSV-CP3-F RTVS-CP3-R RTSV-NTP-F RTSV-NTP-R GUS-Linker-F GUS-Linker-R Actin-F Actin-R
CACCGCTGGCGAAACGGTCATTG ACAAGCGAGCCCAAGTTAGC CACCGATTTGCAGGCCATAATAGC CCAGCAACGACATAAAAGCC CACCCACAAGCCTTAGTTGGTTGAG TCTTATTCGGCACCTCCGTCAC CACCCGCTTTCGAGGCTTTGGTGG TGTTTACCCTTATCTTCGAC CATGAAGATGCGGACTTACG ATCCACGCCGTATTCGG TCCATCTTGGCATCTCTCAG GTACCCGCATCAGGCATCTG
Using the primer sets listed in the Materials and Methods section and the cDNA (synthesized from RNA of purified virus using random hexamers and Invitrogen’s reagents following manufacturer protocol), 500-bp fragments encoding 4 proteins CP1, CP2, CP3 and NTP were obtained. The 500-bp trigger sequences were cloned into an entry vector, which subsequently recombined with pANDA using LR reactions. The resulting pANDA plasmid carried an inverted repeat of the 500-bp trigger joint by a GUS-linker (Fig. 1B).
Isolation and Detection of Small RNAs Total RNA was isolated from rice leaves using Trizol reagent (Invitrogen) following the manufacturer’s protocol. Northern blot analysis was conducted as described previously (Shimizu, Nakazono-Nagaoka, Uehara-Ichiki et al., 2011). For detection of siRNAs, a riboprobe was prepared for each insert fragment using a Digoxigenin RNA labeling Kit (Roche Diagnostics GmbH., Mannheim, Germany).
Creation and Confirmation of Transgenic Plants The pANDA binary vectors were transformed into rice calli using a method as described in the Materials and Methods section. The scheme for creation and confirmation of transgenic rice plants is presented in
FIGURE 2. Identification of transformation events by duplex PCR. DNA was extracted by a simple procedure and was used to amplify the GUS linker (650 base pairs) and beta-actin (450 base pairs). PCR products were electrophoresed on 1.5% agarose gel. CP1, CP2, CP3 and NTP representing transgenic rice plants transformed with corresponding trigger vectors. M, DNA ladders; 116, individual transgenic lines (with 2 bands) and non-transgenic line (without the 650-bp band).
RNA INTERFERENCE OF RICE TUNGRO SPHERICAL VIRUS
51
Downloaded by [New York University] at 23:59 18 May 2015
FIGURE 3. Detection of the presence of the virus-specific short interfering RNA by Northern blot analyses. Individual transgenic lines identified in Fig. 2 were sampled for RNA extraction. Short RNAs were separated on 15% acrylamide gels and transferred to nitrocellulose membranes. Detection was carried using 500-bp DIG-labeled trigger probe.
Figure 1C. Sixteen putative transgenic plants for each construct were tested for the presence of transgene inserts. Data on Figure 2 shows that most of the putative transgenic plants carried the transgene insert. All of the 16 putative transgenic plants were confirmed to contain the transgenes for CP2 and NTP – 14 of the 16 plants were confirmed to contain the inserts for CP1 and CP3. These results indicate that our transformation and selection procedure was highly efficient.
Accumulation of Transgene-Specific siRNAs in the Transgenic Plants In order to identify the transgenic plants that can produce transgene-specific siRNA, we performed a northern blot analysis using a DIGlabeled RNA probe complement to the 500-bp trigger sequences. Our result on Figure 3 indicated that not all transgenic plants carrying the
inverted repeat can produce siRNA, and for those can, different levels of siRNA were produced. Specifically, among 14 lines carrying transgenic inserts of each construct, we could obtain 4 to 5 lines that produced siRNA at higher levels.
DISCUSSIONS RNA silencing is a process where double stranded RNAs are sliced into short RNAs of 21 to 24 nucleotides. These short interfering RNAs (siRNAs) act as a guiding sequence to degrade other complementary messenger RNAs (Baulcombe 2005, Hamilton et al., 2002). One of the key factors to confer virus resistance in plants via the RNAi approach lies in the selection of virus genes to target for silencing. To ensure effectiveness, target sequences should be highly conserved. To this
Downloaded by [New York University] at 23:59 18 May 2015
52
Le et al.
end, the sequences encoding CP1, CP2, CP3 and NTP were selected for this study. To generate RNAi-inducing constructs, the GatewayÒ compatible pANDA vector system was used (Miki and Shimamoto, 2004). This vector system allows the use of recombinase reaction, thus, eliminated the troubling digestion-ligation steps. The selection in plants can be performed with 50 mg/L of Hygromycin B. The targeted sequence presented as an inverted repeat under the control of a promoter for maize Ubiquitin. The GUS-linker is designed to assist the transcribed RNA to restructure into a hairpin double-stranded RNA (Fig. 1). When the plasmids were transformed into rice calli via Agrobacterium and selected by hygromycin, we obtained 16 putative transgenic lines for each construct. As the first step to screen for transgenic events, a confirmation of the presence of the insert was performed. For rice plants resulting from transformation with constructs carrying CP2 and NTP, all 16 lines were carrying the transgene inserts. For rice plants resulted from other 2 plasmids, only 2 lines each were found not to have the inserted DNA. This result further confirmed the effectiveness of the pANDA vector system in rice. Next, to verify if the transgenic lines indeed produce short interfering RNA, we performed the northern blot analyses. Total RNA from the T0 transgenic plants were isolated and separated on acrylamide gels. After transferring to nitrocellulose membrane, the presence of siRNA was confirmed by hybridization with DIG-labeled RNA probes complementary to the target sequences. Data on Figure 3 indicated that the siRNA levels were highly variable between lines – and for some lines, no siRNA was detected. Because each lane was loaded with the same amount of RNA, this evidence suggested either insertion positions or the copy number may play an important role in this approach. In the lines undetectable for siRNA (7 lines in total, Fig. 3), the presence of the inverted repeat may have been rearranged. For each construct, we found 4 lines with high levels of siRNA. These lines are highly likely to be resistant to the tungro disease. This is the first phase of work which seeks to develop tungro resistant rice via targeting RTSV.
DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST No potential conflicts of interest were disclosed.
ACKNOWLEDGMENT The authors wish to thank Georgina Smith for English editing.
FUNDING DTL was funded by a postdoctoral fellowship from the Japan Society for the Promotion of Science. Part of this work was funded by a grant from the National Foundation for Science and Technology Development of Vietnam (106-NN.02-2013.46). References Baulcombe D. RNA silencing. Trends Biochem Sci 2005; 30:290-3; PMID:15950871; http://dx.doi.org/10.1016/ j.tibs.2005.04.012 Hamilton A, Voinnet O, Chappell L, Baulcombe D. Two classes of short interfering RNA in RNA silencing. EMBO J 2002; 21:4671-9; PMID:12198169; http://dx. doi.org/10.1093/emboj/cdf464 Hibino H. Biology and epidemiology of rice viruses. Ann Rev Phytopathol 1996; 34:249-74; PMID:15012543; http://dx.doi.org/10.1146/annurev.phyto.34.1.249 Hibino H, Cabauatan PQ. Infectivity neutralization of rice tungro-associated viruses acquired by vector leafhoppers. Phytopatholgy 1987; 77:473-6; http://dx.doi.org/ 10.1094/Phyto-77-473 Hiei Y, Ohta S, Komari T, Kumashiro T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 1994; 6:271-82; PMID:7920717; http://dx.doi.org/10.1046/j.1365313X.1994.6020271.x Huet H, Mahendra S, Wang J, Sivamani E, Ong CA, Chen L, de Kochko A, Beachy RN, Fauquet C. Near immunity to rice tungro spherical virus achieved in rice by a replicase-mediated resistance strategy. Phytopathology 1999; 89:1022-7; PMID:18944657; http://dx.doi.org/ 10.1094/PHYTO.1999.89.11.1022 Miki D, Shimamoto K. Simple RNAi vectors for stable and transient suppression of gene function in rice. Plant Cell Physiol 2004; 45:490-5; PMID:15111724; http://dx.doi.org/10.1093/pcp/pch048
Downloaded by [New York University] at 23:59 18 May 2015
RNA INTERFERENCE OF RICE TUNGRO SPHERICAL VIRUS
Shimizu T, Nakazono-Nagaoka E, Akita F, UeharaIchiki T, Omura T, Sasaya T. Immunity to Rice black streaked dwarf virus, a plant reovirus, can be achieved in rice plants by RNA silencing against the gene for the viroplasm component protein. Virus Res 2011; 160:400-3; PMID:21621568; http://dx.doi.org/10.1016/j.virusres.2011.05.011 Shimizu T, Nakazono-Nagaoka E, Akita F, Wei T, Sasaya T, Omura T, Uehara-Ichiki T. Hairpin RNA derived from the gene for Pns9, a viroplasm matrix protein of Rice gall dwarf virus, confers strong resistance to virus infection in transgenic rice plants. J Biotechnol 2012; 157:421-7; PMID:22212819; http://dx.doi.org/ 10.1016/j.jbiotec.2011.12.015 Shimizu T, Nakazono-Nagaoka E, Uehara-Ichiki T, Sasaya T, Omura T. Targeting specific genes for RNA interference is crucial to the development of strong resistance to rice stripe virus. Plant Biotechnol J 2011; 9:503-12; PMID:21040387; http://dx.doi.org/10.1111/ j.1467-7652.2010.00571.x Shimizu T, Ogamino T, Hiraguri A, Nakazono-Nagaoka E, Uehara-Ichiki T, Nakajima M, Akutsu K, Omura T, Sasaya T. Strong resistance against Rice grassy stunt virus is induced in transgenic rice plants expressing double-stranded RNA of the viral genes for nucleocapsid or movement proteins as targets for RNA interference.
53
Phytopathology 2013; 103:513-9; PMID:23190115; http://dx.doi.org/10.1094/PHYTO-07-12-0165-R Shimizu T, Yoshii M, Wei T, Hirochika H, Omura T. Silencing by RNAi of the gene for Pns12, a viroplasm matrix protein of Rice dwarf virus, results in strong resistance of transgenic rice plants to the virus. Plant Biotechnol J 2009; 7:24-32; PMID:18761654; http:// dx.doi.org/10.1111/j.1467-7652.2008.00366.x Sivamani E, Huet H, Shen P, Ong C, de Kochko A, Fauquet C, Beachy R. Rice plant (Oryza sativa L.) containing Rice tungro spherical virus (RTSV) coat protein transgenes are resistant to virus infection. Mol Breeding 1999; 5:177-85; http://dx.doi.org/ 10.1023/A:1009633816713 Tyagi H, Rajasubramaniam S, Rajam MV, Dasgupta I. RNA-interference in rice against Rice tungro bacilliform virus results in its decreased accumulation in inoculated rice plants. Transgenic Res 2008; 17:897904; PMID:18306054; http://dx.doi.org/10.1007/ s11248-008-9174-7 Verma V, Sharma S, Devi SV, Rajasubramaniam S, Dasgupta I. Delay in virus accumulation and low virus transmission from transgenic rice plants expressing Rice tungro spherical virus RNA. Virus Genes 2012; 45:350-9; PMID:22826155; http://dx.doi.org/10.1007/ s11262-012-0787-9
GM Crops & Food: Biotechnology in Agriculture and the Food Chain Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/kgmc20
Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus ab
b
Dung Tien Le , Ha Duc Chu & Takahide Sasaya
a
a
Research Team for Vector-borne Diseases; National Agriculture Research Center; Tsukuba, Ibaraki, Japan b
National Key Laboratory of Plant and Cell Technology; Agricultural Genetics Institute; Vietnam Academy of Agricultural Science; Hanoi, Vietnam Published online: 18 May 2015.
Click for updates To cite this article: Dung Tien Le, Ha Duc Chu & Takahide Sasaya (2015) Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus, GM Crops & Food: Biotechnology in Agriculture and the Food Chain, 6:1, 47-53, DOI: 10.1080/21645698.2015.1025188 To link to this article: http://dx.doi.org/10.1080/21645698.2015.1025188
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
GM Crops & Food, 6:47–53, 2015 Ó 2015 Taylor & Francis Group, LLC ISSN: 2164-5698 print / 2164-5701 online DOI: 10.1080/21645698.2015.1025188
Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus Dung Tien Le,1,2,* Ha Duc Chu,2 and Takahide Sasaya1,y 1
Downloaded by [New York University] at 23:59 18 May 2015
Research Team for Vector-borne Diseases; National Agriculture Research Center; Tsukuba, Ibaraki, Japan 2 National Key Laboratory of Plant and Cell Technology; Agricultural Genetics Institute; Vietnam Academy of Agricultural Science; Hanoi, Vietnam
ABSTRACT. Rice tungro spherical virus (RTSV), also known as Rice waika virus, does not cause visible symptoms in infected rice plants. However, the virus plays a critical role in spreading Rice tungro bacilliform virus (RTBV), which is the major cause of severe symptoms of rice tungro disease. Recent studies showed that RNA interference (RNAi) can be used to develop virusresistance transgenic rice plants. In this report, we presented simple procedures and protocols needed for the creation of transgenic rice plants capable of producing small interfering RNA specific against RTSV sequences. Notably, our study showed that 60 out of 64 individual hygromycin-resistant lines (putative transgenic lines) obtained through transformation carried transgenes designed for producing hairpin double-stranded RNA. Northern blot analyses revealed the presence of small interfering RNA of 21- to 24-mer in 46 out of 56 confirmed transgenic lines. Taken together, our study indicated that transgenic rice plants carrying an inverted repeat of 500-bp fragments encoding various proteins of RTSV can produce small interfering RNA from the hairpin RNA transcribed from that transgene. In light of recent studies with other viruses, it is possible that some of these transgenic rice lines might be resistant to RTSV. KEYWORDS. rice tungro disease, RNAi, transgenic rice, disease resistance, rice tungro spherical virus ABBREVIATIONS. RTSV, rice tungro spherical virus; RTBS, rice tungro bacilliform virus; CP, coat protein; NTP, nucleotide triphosphat-binding protein; Pro, 3C-like protease; Pol, RNAdependent RNA polymerase
INTRODUCTION Tungro disease of rice is caused by 2 viruses, Rice tungro bacilliform virus (RTBV) and Rice
tungro spherical virus (RTSV). The diseased plants that were infected with both viruses showed stunting, yellowing or yellow-orange discoloration and reduced tillering (Hibino and
*Correspondence to: Dr. Dung Tien Le; Email: [email protected] Received December 9, 2015; Revised February 24, 2015; Accepted February 24, 2015. y Present address: Plant Disease Group, Agro-Environment Research Division, Kyushu Okinawa Agricultural Research Center, Koshi, Kumamoto, Japan 47
Downloaded by [New York University] at 23:59 18 May 2015
48
Le et al.
Cabauatan, 1987). RTBV-infected plants exhibited milder symptom while RTSVinfected plants showed only mild stunting. RTBV is a badnavirus of 100-300 nm in length and 30-35 nm in width. It possesses a circular double-stranded DNA molecule. By contrast, RTSV is polyhedral in shape with a diameter about 30 nm, carrying a single-stranded RNA molecule. RTBV and RTSV are transmitted semi-persistently by Nephotettix spp., of which Nephotettix virescens is the most effective vector. Right after feeding on plants infected with RTBV and RTSV, the leafhoppers transmit the viruses either together or RTBV or RTSV alone. The transmission capacity remains active for 4 to 5 days for RTBV but only 2 to 4 days for RTSV. The insect vectors could acquire RTSV from the plant infected with RTSV alone but fails to acquire RTBV from the plant infected with only RTBV. A detailed mechanism on how the vector insect transmits RTSV and RTBV had been thoroughly reviewed (Hibino, 1996). The single-stranded polyadenylated RNA of RTSV consists of 12,180 nucleotides encoding a pyloprotein of 393 kDa. Due to several common features between RTSV and animal picornavirus, RTSV was sometimes called a “plant picornavirus.” Some of the processed products of the polyprotein have been identified, including coat proteins 1-3, nucleotide triphosphatebinding protein, a protease and an RNA-dependent RNA polymerase (Fig. 1A) (Hibino, 1996). Recent progress in the application of RNA interference (RNAi) in developing virus-resistant transgenic rice plants had provided promising result. Notably, using an inverted repeat of the genes encoding Pns9 and Pns12 in rice gall dwarf virus (RGDV) and rice dwarf virus (RDV), respectively, Shimizu et al. have successfully developed the transgenic rice plants resistant to these viruses (Shimizu et al., 2009; Shimizu et al., 2012). Very often, the disruption of a single virus gene by RNAi could lead to a virus-resistant phenotype (Shimizu, NakazonoNagaoka, Akita et al., 2011; Shimizu, Nakazono-Nakaoka, Uehara-Ichiki et al., 2011, 2013). In 2008, Tyagi et al. reported the creation of a construct carrying an inverted repeat of the gene encoding ORF-IV protein of RTBV. Rice
plants transformed with this construct exhibited lower virus titers, and one of the 2 lines showed very mild symptom (Tyagi et al., 2008). Quite recently, Verma et al. found a delayed in virus accumulation and low virus transmission from transgenic rice overexpressing RTSV RNA in either sense or anti-sense direction (Verma et al., 2012). Another study targeting RTSV was by Huet et al., where the authors overexpressed a truncated form of RTSV replicase in rice and found the transgenic rice to be immunized from RTSV infection (Huet et al., 1999). The same group also found overexpression of RTSV coat proteins in rice could offer moderate protection against RTSV infection (Sivamani et al., 1999). In this work, we created transgenic rice plants capable of producing small interfering RNA against genes coding for coat protein 1 (CP1), coat protein 2 (CP2), coat protein 3 (CP3) or nucleotide triphosphate-binging protein (NTP) of RTSV aiming at developing rice plants resistant to not only RTSV infection but also the tungro disease.
MATERIALS AND METHODS Construction of Plasmids To create RNAi-inducing constructs, each 500-bp fragments was amplified from the cDNA library obtained from RTSV RNA by the following primer sets (Table 1) targeted to the RTSV genes for CP1, CP2, CP3, and NTP. The resulting fragments were first cloned into GatewayÒ entry vector pENTR-D/TOPO (Invitrogen) and were then transferred into GatewayÒ -compatible destination vector pANDA (Miki and Shimamoto, 2004) using LR clonase reaction according to the manufacture’s instruction (Invitrogen). The presence of the inverted repeats was confirmed by sequencing and reconfirmed by colony PCR after the vector was transformed into Agrobacterium.
Rice Transformation Rice (Oryza sativa) calli of japonica nihonbare variety were induced from mature seeds and subjected to co-culture with Agrobacterium
RNA INTERFERENCE OF RICE TUNGRO SPHERICAL VIRUS
49
Downloaded by [New York University] at 23:59 18 May 2015
FIGURE 1. Schematic presentation of the creation of transgenic rice plants producing short RNAs of rice tungro spherical virus (RTSV). (A) Genome organization of RTSV RNA (CP1-3, coat protein 1-3; NTP, nucleotide triphosphate-binding protein; Pro, 3C-like protease; Pol, RNA-dependent RNA polymerase), (B) procedures involving in constructing an RNA silencing-trigger vector, and (C) transformation and screening of transgenic events producing short RNAs.
harboring plasmid. The transformation process followed a published procedure (Hiei et al., 1994). Transformants were selected by 50 mg/ L hygromycin B. Regenerated T0 plants were transferred to pots containing commercial soil (Bonsol; Sumitomo Chemical, Tokyo, Japan). The pots were placed in a greenhouse at 25§ 3 C under natural sunlight.
Screening by PCR To confirm the presence of transgenes in the putative transgenic plants, the transgenic plants were evaluated by PCR as described previously (Shimizu et al., 2009; Shimizu et al., 2012).
Briefly, a small portion of the leaves of T0 plants were collected and DNA were extracted using 250 mL buffer containing 0.2M Tris-Cl pH7.5, 0.25M NaCl, 25mM EDTA and 0.5% SDS plus 50 mL of PCI solution (phenol, chloroform and isoamyl alcohol). The resulting supernatant were then diluted 10-fold in distilled deionized water and were used in PCR reactions. The duplexing PCR contained 2 primer sets (Table 1) -one to detect the GUSlinker from the transgene insert, the other to detect rice actin gene. Following duplex PCR reaction, a positively confirmed transgenic plant must result in 2 bands of 650bp (GUSLinker) and 450bp (rice actin).
50
Le et al.
Downloaded by [New York University] at 23:59 18 May 2015
Table 1. Primers used in this study
RESULTS
Primer names
Primer sequences (50 to 30 )
Creation of RNAi-Inducing Constructs
RTSV-CP1-F RTSV-CP1-R RTSV-CP2-F RTSV-CP2-R RTSV-CP3-F RTVS-CP3-R RTSV-NTP-F RTSV-NTP-R GUS-Linker-F GUS-Linker-R Actin-F Actin-R
CACCGCTGGCGAAACGGTCATTG ACAAGCGAGCCCAAGTTAGC CACCGATTTGCAGGCCATAATAGC CCAGCAACGACATAAAAGCC CACCCACAAGCCTTAGTTGGTTGAG TCTTATTCGGCACCTCCGTCAC CACCCGCTTTCGAGGCTTTGGTGG TGTTTACCCTTATCTTCGAC CATGAAGATGCGGACTTACG ATCCACGCCGTATTCGG TCCATCTTGGCATCTCTCAG GTACCCGCATCAGGCATCTG
Using the primer sets listed in the Materials and Methods section and the cDNA (synthesized from RNA of purified virus using random hexamers and Invitrogen’s reagents following manufacturer protocol), 500-bp fragments encoding 4 proteins CP1, CP2, CP3 and NTP were obtained. The 500-bp trigger sequences were cloned into an entry vector, which subsequently recombined with pANDA using LR reactions. The resulting pANDA plasmid carried an inverted repeat of the 500-bp trigger joint by a GUS-linker (Fig. 1B).
Isolation and Detection of Small RNAs Total RNA was isolated from rice leaves using Trizol reagent (Invitrogen) following the manufacturer’s protocol. Northern blot analysis was conducted as described previously (Shimizu, Nakazono-Nagaoka, Uehara-Ichiki et al., 2011). For detection of siRNAs, a riboprobe was prepared for each insert fragment using a Digoxigenin RNA labeling Kit (Roche Diagnostics GmbH., Mannheim, Germany).
Creation and Confirmation of Transgenic Plants The pANDA binary vectors were transformed into rice calli using a method as described in the Materials and Methods section. The scheme for creation and confirmation of transgenic rice plants is presented in
FIGURE 2. Identification of transformation events by duplex PCR. DNA was extracted by a simple procedure and was used to amplify the GUS linker (650 base pairs) and beta-actin (450 base pairs). PCR products were electrophoresed on 1.5% agarose gel. CP1, CP2, CP3 and NTP representing transgenic rice plants transformed with corresponding trigger vectors. M, DNA ladders; 116, individual transgenic lines (with 2 bands) and non-transgenic line (without the 650-bp band).
RNA INTERFERENCE OF RICE TUNGRO SPHERICAL VIRUS
51
Downloaded by [New York University] at 23:59 18 May 2015
FIGURE 3. Detection of the presence of the virus-specific short interfering RNA by Northern blot analyses. Individual transgenic lines identified in Fig. 2 were sampled for RNA extraction. Short RNAs were separated on 15% acrylamide gels and transferred to nitrocellulose membranes. Detection was carried using 500-bp DIG-labeled trigger probe.
Figure 1C. Sixteen putative transgenic plants for each construct were tested for the presence of transgene inserts. Data on Figure 2 shows that most of the putative transgenic plants carried the transgene insert. All of the 16 putative transgenic plants were confirmed to contain the transgenes for CP2 and NTP – 14 of the 16 plants were confirmed to contain the inserts for CP1 and CP3. These results indicate that our transformation and selection procedure was highly efficient.
Accumulation of Transgene-Specific siRNAs in the Transgenic Plants In order to identify the transgenic plants that can produce transgene-specific siRNA, we performed a northern blot analysis using a DIGlabeled RNA probe complement to the 500-bp trigger sequences. Our result on Figure 3 indicated that not all transgenic plants carrying the
inverted repeat can produce siRNA, and for those can, different levels of siRNA were produced. Specifically, among 14 lines carrying transgenic inserts of each construct, we could obtain 4 to 5 lines that produced siRNA at higher levels.
DISCUSSIONS RNA silencing is a process where double stranded RNAs are sliced into short RNAs of 21 to 24 nucleotides. These short interfering RNAs (siRNAs) act as a guiding sequence to degrade other complementary messenger RNAs (Baulcombe 2005, Hamilton et al., 2002). One of the key factors to confer virus resistance in plants via the RNAi approach lies in the selection of virus genes to target for silencing. To ensure effectiveness, target sequences should be highly conserved. To this
Downloaded by [New York University] at 23:59 18 May 2015
52
Le et al.
end, the sequences encoding CP1, CP2, CP3 and NTP were selected for this study. To generate RNAi-inducing constructs, the GatewayÒ compatible pANDA vector system was used (Miki and Shimamoto, 2004). This vector system allows the use of recombinase reaction, thus, eliminated the troubling digestion-ligation steps. The selection in plants can be performed with 50 mg/L of Hygromycin B. The targeted sequence presented as an inverted repeat under the control of a promoter for maize Ubiquitin. The GUS-linker is designed to assist the transcribed RNA to restructure into a hairpin double-stranded RNA (Fig. 1). When the plasmids were transformed into rice calli via Agrobacterium and selected by hygromycin, we obtained 16 putative transgenic lines for each construct. As the first step to screen for transgenic events, a confirmation of the presence of the insert was performed. For rice plants resulting from transformation with constructs carrying CP2 and NTP, all 16 lines were carrying the transgene inserts. For rice plants resulted from other 2 plasmids, only 2 lines each were found not to have the inserted DNA. This result further confirmed the effectiveness of the pANDA vector system in rice. Next, to verify if the transgenic lines indeed produce short interfering RNA, we performed the northern blot analyses. Total RNA from the T0 transgenic plants were isolated and separated on acrylamide gels. After transferring to nitrocellulose membrane, the presence of siRNA was confirmed by hybridization with DIG-labeled RNA probes complementary to the target sequences. Data on Figure 3 indicated that the siRNA levels were highly variable between lines – and for some lines, no siRNA was detected. Because each lane was loaded with the same amount of RNA, this evidence suggested either insertion positions or the copy number may play an important role in this approach. In the lines undetectable for siRNA (7 lines in total, Fig. 3), the presence of the inverted repeat may have been rearranged. For each construct, we found 4 lines with high levels of siRNA. These lines are highly likely to be resistant to the tungro disease. This is the first phase of work which seeks to develop tungro resistant rice via targeting RTSV.
DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST No potential conflicts of interest were disclosed.
ACKNOWLEDGMENT The authors wish to thank Georgina Smith for English editing.
FUNDING DTL was funded by a postdoctoral fellowship from the Japan Society for the Promotion of Science. Part of this work was funded by a grant from the National Foundation for Science and Technology Development of Vietnam (106-NN.02-2013.46). References Baulcombe D. RNA silencing. Trends Biochem Sci 2005; 30:290-3; PMID:15950871; http://dx.doi.org/10.1016/ j.tibs.2005.04.012 Hamilton A, Voinnet O, Chappell L, Baulcombe D. Two classes of short interfering RNA in RNA silencing. EMBO J 2002; 21:4671-9; PMID:12198169; http://dx. doi.org/10.1093/emboj/cdf464 Hibino H. Biology and epidemiology of rice viruses. Ann Rev Phytopathol 1996; 34:249-74; PMID:15012543; http://dx.doi.org/10.1146/annurev.phyto.34.1.249 Hibino H, Cabauatan PQ. Infectivity neutralization of rice tungro-associated viruses acquired by vector leafhoppers. Phytopatholgy 1987; 77:473-6; http://dx.doi.org/ 10.1094/Phyto-77-473 Hiei Y, Ohta S, Komari T, Kumashiro T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 1994; 6:271-82; PMID:7920717; http://dx.doi.org/10.1046/j.1365313X.1994.6020271.x Huet H, Mahendra S, Wang J, Sivamani E, Ong CA, Chen L, de Kochko A, Beachy RN, Fauquet C. Near immunity to rice tungro spherical virus achieved in rice by a replicase-mediated resistance strategy. Phytopathology 1999; 89:1022-7; PMID:18944657; http://dx.doi.org/ 10.1094/PHYTO.1999.89.11.1022 Miki D, Shimamoto K. Simple RNAi vectors for stable and transient suppression of gene function in rice. Plant Cell Physiol 2004; 45:490-5; PMID:15111724; http://dx.doi.org/10.1093/pcp/pch048
Downloaded by [New York University] at 23:59 18 May 2015
RNA INTERFERENCE OF RICE TUNGRO SPHERICAL VIRUS
Shimizu T, Nakazono-Nagaoka E, Akita F, UeharaIchiki T, Omura T, Sasaya T. Immunity to Rice black streaked dwarf virus, a plant reovirus, can be achieved in rice plants by RNA silencing against the gene for the viroplasm component protein. Virus Res 2011; 160:400-3; PMID:21621568; http://dx.doi.org/10.1016/j.virusres.2011.05.011 Shimizu T, Nakazono-Nagaoka E, Akita F, Wei T, Sasaya T, Omura T, Uehara-Ichiki T. Hairpin RNA derived from the gene for Pns9, a viroplasm matrix protein of Rice gall dwarf virus, confers strong resistance to virus infection in transgenic rice plants. J Biotechnol 2012; 157:421-7; PMID:22212819; http://dx.doi.org/ 10.1016/j.jbiotec.2011.12.015 Shimizu T, Nakazono-Nagaoka E, Uehara-Ichiki T, Sasaya T, Omura T. Targeting specific genes for RNA interference is crucial to the development of strong resistance to rice stripe virus. Plant Biotechnol J 2011; 9:503-12; PMID:21040387; http://dx.doi.org/10.1111/ j.1467-7652.2010.00571.x Shimizu T, Ogamino T, Hiraguri A, Nakazono-Nagaoka E, Uehara-Ichiki T, Nakajima M, Akutsu K, Omura T, Sasaya T. Strong resistance against Rice grassy stunt virus is induced in transgenic rice plants expressing double-stranded RNA of the viral genes for nucleocapsid or movement proteins as targets for RNA interference.
53
Phytopathology 2013; 103:513-9; PMID:23190115; http://dx.doi.org/10.1094/PHYTO-07-12-0165-R Shimizu T, Yoshii M, Wei T, Hirochika H, Omura T. Silencing by RNAi of the gene for Pns12, a viroplasm matrix protein of Rice dwarf virus, results in strong resistance of transgenic rice plants to the virus. Plant Biotechnol J 2009; 7:24-32; PMID:18761654; http:// dx.doi.org/10.1111/j.1467-7652.2008.00366.x Sivamani E, Huet H, Shen P, Ong C, de Kochko A, Fauquet C, Beachy R. Rice plant (Oryza sativa L.) containing Rice tungro spherical virus (RTSV) coat protein transgenes are resistant to virus infection. Mol Breeding 1999; 5:177-85; http://dx.doi.org/ 10.1023/A:1009633816713 Tyagi H, Rajasubramaniam S, Rajam MV, Dasgupta I. RNA-interference in rice against Rice tungro bacilliform virus results in its decreased accumulation in inoculated rice plants. Transgenic Res 2008; 17:897904; PMID:18306054; http://dx.doi.org/10.1007/ s11248-008-9174-7 Verma V, Sharma S, Devi SV, Rajasubramaniam S, Dasgupta I. Delay in virus accumulation and low virus transmission from transgenic rice plants expressing Rice tungro spherical virus RNA. Virus Genes 2012; 45:350-9; PMID:22826155; http://dx.doi.org/10.1007/ s11262-012-0787-9
