Critical Role of Antimicrobial Peptide Cathelicidin for Controlling Helicobacter pylori Survival and Infection Lin Zhang, William K. K. Wu, Richard L. Gallo, Evandro F. Fang, Wei Hu, Thomas K. W. Ling, Jing Shen, Ruby L. Y. Chan, Lan Lu, Xiao M. Luo, Ming X. Li, Kam M. Chan, Jun Yu, Vincent W. S. Wong, Siew C. Ng, Sunny H. Wong, Francis K. L. Chan, Joseph J. Y. Sung, Matthew T. V. Chan and Chi H. Cho J Immunol published online 22 January 2016 http://www.jimmunol.org/content/early/2016/01/22/jimmun ol.1500021

Supplementary Material

http://www.jimmunol.org/content/suppl/2016/01/22/jimmunol.150002 1.DCSupplemental.html

Subscriptions

Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscriptions

Permissions Email Alerts

Submit copyright permission requests at: http://www.aai.org/ji/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/cgi/alerts/etoc

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 9650 Rockville Pike, Bethesda, MD 20814-3994. Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.

Downloaded from http://www.jimmunol.org/ at Albany College of Pharmacy and Health Sciences on January 22, 2016

This information is current as of January 22, 2016.

Published January 22, 2016, doi:10.4049/jimmunol.1500021 The Journal of Immunology

Critical Role of Antimicrobial Peptide Cathelicidin for Controlling Helicobacter pylori Survival and Infection

The antimicrobial peptide cathelicidin is critical for protection against different kinds of microbial infection. This study sought to elucidate the protective action of cathelicidin against Helicobacter pylori infection and its associated gastritis. Exogenous cathelicidin was found to inhibit H. pylori growth, destroy the bacteria biofilm, and induce morphological alterations in H. pylori membrane. Additionally, knockdown of endogenous cathelicidin in human gastric epithelial HFE-145 cells markedly increased the intracellular survival of H. pylori. Consistently, cathelicidin knockout mice exhibited stronger H. pylori colonization, higher expression of proinflammatory cytokines IL-6, IL-1b, and ICAM1, and lower expression of the anti-inflammatory cytokine IL10 in the gastric mucosa upon H. pylori infection. In wild-type mice, H. pylori infection also stimulated gastric epithelium-derived cathelicidin production. Importantly, pretreatment with bioengineered Lactococcus lactis that actively secretes cathelicidin significantly increased mucosal cathelicidin levels and reduced H. pylori infection and the associated inflammation. Moreover, cathelicidin strengthened the barrier function of gastric mucosa by stimulating mucus synthesis. Collectively, these findings indicate that cathelicidin plays a significant role as a potential natural antibiotic for H. pylori clearance and a therapeutic agent for chronic gastritis. The Journal of Immunology, 2016, 196: 000–000.

H

elicobacter pylori is an important pathogen that colonizes .50% of the world’s population and is associated with chronic gastritis, peptic ulcer, gastric cancer, and MALT lymphoma (1, 2). Despite that the prevalence of H. pylori *Institute of Digestive Diseases and State Key Laboratory of Digestive Diseases, Li Ka Shing Institute of Health Sciences, Faculty of Medicine, Chinese University of Hong Kong, Hong Kong, China; †Department of Medicine and Therapeutics, Faculty of Medicine, Chinese University of Hong Kong, Hong Kong, China; ‡CUHK Shenzhen Research Institute, Shenzhen 518057, China; xDepartment of Anesthesia and Intensive Care, Chinese University of Hong Kong, Hong Kong, China; {Division of Dermatology, University of California, San Diego, La Jolla, CA 92093; ‖Laboratory of Molecular Gerontology, National Institute on Aging, National Institutes of Health, Baltimore, MD 21224; #School of Biomedical Sciences, Faculty of Medicine, Chinese University of Hong Kong, Hong Kong, China; and **Department of Microbiology, Prince of Wales Hospital, Chinese University of Hong Kong, Hong Kong, China ORCIDs: 0000-0002-1401-7861 (R.L.G.); 0000-0003-0209-8032 (W.H.); 00000001-7583-9167 (T.K.W.L.); 0000-0002-2334-6544 (X.M.L.); 0000-0001-57293850 (M.X.L.); 0000-0001-5008-2153 (J.Y.); 0000-0003-2215-9410 (V.W.S.W.); 0000-0002-3354-9310 (S.H.W.); 0000-0001-7388-2436 (F.K.L.C.); 0000-00023574-7855 (M.T.V.C.). Received for publication January 6, 2015. Accepted for publication November 30, 2015. This work was supported by Research Fund for the Control of Infectious Diseases Grant 08070402 from the Food and Health Bureau of Hong Kong, National Natural Science Foundation of China Grant 81402014 and by Shenzhen Science and Technology Program JCYC20140905151710921. Address correspondence and reprint requests to Prof. William K. K. Wu or Dr. Lin Zhang, Department of Anesthesia and Intensive Care, Chinese University of Hong Kong, CUHK Shenzhen Research Institute, 2 Yuexing Road, Nanshan District, Shenzhen 518057, China (W.K.K.W.) or Department of Medicine and Therapeutics, Chinese University of Hong Kong, CUHK Shenzhen Research Institute, 2 Yuexing Road, Nanshan District, Shenzhen 518057, China (L.Z.). E-mail addresses: [email protected] (W.K.K.W.) or [email protected] (L.Z.) The online version of this article contains supplemental material. Abbreviations used in this article: BHI, brain heart infusion; PAS, periodic acid– Schiff; siRNA, small interfering RNA; SS1, Sydney strain 1. Copyright Ó 2016 by The American Association of Immunologists, Inc. 0022-1767/16/$30.00 www.jimmunol.org/cgi/doi/10.4049/jimmunol.1500021

infection is declining in many developed countries, it remains an important and endemic public health issue in East Asian countries (3), which accounts for ∼65–80% of gastric cancer (4). The standard triple therapy for H. pylori eradication usually consists of a $10-d treatment with a proton pump inhibitor, amoxicillin, and clarithromycin (5). Other antibiotics, such as metronidazole and levofloxacin, are also commonly used. However, the development of antibiotic resistance in H. pylori substantially hinders the treatment of H. pylori–associated disorders. Antimicrobial resistance in H. pylori is widespread. The prevalence of H. pylori resistance to clarithromycin, metronidazole, levofloxacin, and multiple antibiotics has reached an alarming rate of 21.5, 95.4, 20.6, and 25.5%, respectively, in southeast China, rendering effective eradication of H. pylori a unique therapeutic challenge (6, 7). It is evident that bacteria biofilm is an ancient and integral component of the prokaryotic life cycle, and it is a key factor for survival in diverse environments (8). It is critical not only for microbial survival in diverse environments, but also for successful infection by numerous pathogenic bacteria. As biofilm protects bacteria during infections in humans and allows bacterial survival in a hostile environment, inhibition of biofilm formation by novel therapeutics may prevent bacterial colonization (9). For H. pylori, resistance to conventional antimicrobial therapies has been attributed not only to its genetic variability, but also to its ability to form biofilm as a recalcitrant strategy (10). Several recent reports indicate that H. pylori forms biofilm both in vitro (11) and in vivo (12, 13). In this regard, antimicrobial peptides that target either the organization of the bacterial membrane bilayer or bacteria biofilm are promising therapeutic approaches for treating persistent bacterial infection (14). Cathelicidins are endogenous host defense peptides with a diverse range of antimicrobial activities, which provide the first-line

Downloaded from http://www.jimmunol.org/ at Albany College of Pharmacy and Health Sciences on January 22, 2016

Lin Zhang,*,†,‡ William K. K. Wu,*,‡,x Richard L. Gallo,{ Evandro F. Fang,‖ Wei Hu,# Thomas K. W. Ling,** Jing Shen,# Ruby L. Y. Chan,# Lan Lu,# Xiao M. Luo,# Ming X. Li,# Kam M. Chan,# Jun Yu,*,†,‡ Vincent W. S. Wong,*,† Siew C. Ng,*,† Sunny H. Wong,*,†,‡ Francis K. L. Chan,*,†,‡ Joseph J. Y. Sung,*,†,‡ Matthew T. V. Chan,x and Chi H. Cho#

2

CATHELICIDIN CONTROLS H. PYLORI SURVIVAL AND INFECTION

Materials and Methods Bacterial strains H. pylori standard strains Sydney strain 1 (SS1) and 10783 (clarithromycinresistant strain) were provided by the Department of Microbiology, Prince of Wales Hospital, Chinese University of Hong Kong. The two strains of H. pylori were initially grown on horse blood agar plates (Columbia blood agar base with Dent selective supplements; Oxoid, Basingstoke, U.K.) in anaerobic jar with a microaerophilic environment for 5 d at 37˚C. The bioengineered cathelicidin-secreting L. lactis was generated as previously described (24).

Peptides The synthetic mouse cathelicidin CRAMP (GLL RKG GEK IGE KLK KIG QKI KNF FQK LVP QPE Q) with purity 95% was purchased from AnaSpec (Fremont, CA). Human cathelicidin LL-37 (LLG DFF RKS KEK IGK EFK RIV QRI KDF LRN LVP RTE S) and shortened LL-37 (FKR IVQ RIK DFL RNL V) with purity of 95% were purchased from Invitrogen (Carlsbad, CA).

Antimicrobial and anti-biofilm assays H. pylori suspended in Brucella broth with 5% FBS was incubated under microaerophilic conditions at 37˚C in 96-well plates. Cultured 108 CFU H. pylori SS1 or 10783 per well were treated with 0.25 mg/ml clarithromycin, CRAMP, LL-37, or sLL-37. PBS was used as a negative control. After 48 h of shaking at 200 rpm at 37˚C, H. pylori growth was determined by the OD595 value of each well (25). For anti-biofilm assay, H. pylori SS1 (108 CFU) was incubated in 96-well microtiter plates or three-well chamber slides per well under microaerobic conditions for 3 d. Then the supernatants were aspirated and treated with LL-37 for 48 h. At the end of the incubation period, the resident biofilm was measured by crystal violet assay (26, 27) or BacLight Live/Dead stain visualized using confocal microscopy (28).

Scanning electron microscopy H. pylori SS1 cells (108 CFU) were treated with CRAMP, LL-37, or sLL37 for 24 h and then H. pylori was prefixed in a solution of 2.5% (v/v) glutaraldehyde with 0.1 M cacodylate buffer for 1 h and then washed with cacodylate buffer solution. After washing with PBS, the samples were postfixed in 2% (w/v) osmium tetroxide for 2 h and dehydrated with ethanol. All the samples were sputter coated (Emitech K 550) with gold palladium. Scanning electron microscopy (JEOL JSM6301F) was performed using secondary electrons (SE1) at 5 kV (29).

Cell culture and H. pylori intracellular survival assay Human gastric epithelial cell line HFE-145 was a gift from D. Smoot (Howard University, Washington, DC). The intracellular H. pylori was determined by gentamicin protection assay as previously described (30).

RNA interference The expression of LL-37 was lowered using predesigned target-specific small interfering RNA (siRNA) molecules purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Fifty picomoles gene-specific or control siRNA was transfected into cells at 40–60% confluence using jetPRIME transfection kit (Polyplus).

H. pylori infection mouse model and administration of bioengineered probiotics 129/SVJ wild-type (Cnlp+/+) and cathelicidin-knockout (Cnlp2/2) mice (10- to 13-wk-old male mice) were inoculated with either H. pylori SS1 or H. pylori 10783 (1 3 109 CFU/ml) suspended in sterile brain heart infusion (BHI) or a sterile BHI every other day for a total of three doses. All animal experiments used were performed under Laboratory Animals Ethics Committee approval. L. lactis transformed with control plasmid (N) and CRAMP-secreting L. lactis treated with inducer nisin for 3 h (N4I) were prepared as described previously (24). Cnlp2/2 and Cnlp+/+ mice were pretreated with 1010 CFU probiotics (N or N4I) for 2 wk before H. pylori challenge. These animals were continuously treated with these probiotics every other day for 2 mo.

Histopathology evaluation and immunofluorescence Histological sections of stomachs were evaluated and graded according to the updated Sydney classification (31). All sections were evaluated by two experienced pathologists who were blinded to the experimental grouping and had no knowledge of the experimental design. Tissue sections were deparaffinized, rehydrated, and rinsed in distilled water. Ag retrieval was done using a microwave oven with sodium citrate buffer (pH 6.0) for 5 min. The endogenous peroxidase activity was quenched in 3% H2O2 for 10 min. Immunofluorescence staining for H. pylori and CRAMP was performed using anti–H. pylori Ab (Abcam, Science Park West, Hong Kong, China) and anti-CRAMP Ab (Santa Cruz Biotechnology) as primary Abs. Alexa Fluor anti-goat 568 and Alexa Fluor anti-rat 488 (Invitrogen, Camarillo, CA) were used as secondary Abs. Additionally, DAPI was used to stain cell nuclei. Sections were evaluated with a laser confocal microscope (Olympus FV1000).

Circulating peripheral leukocyte analysis Two hundred microliters whole blood was collected from Cnlp+/+ and Cnlp2/2 mice using capillary filled with EDTA into 2 ml cold PBS with 15% EDTA. Cells were analyzed by a semiautomatic biochemical analyzer (MS-500A).

DNA, RNA extraction, and real-time PCR Mouse stomach genomic DNA was extracted by a DNA purification kit (Promega, San Luis Obispo, CA) according to the manufacturer’s instruction. Total RNA was isolated from mouse stomachs using TRIzol reagent (Life Technologies, Carlsbad, CA). Reverse transcription and realtime PCR measurement were performed using iQ SYBR Green Supermix (Bio-Rad, Hercules, CA) and a multicolor real-time PCR detection system (Bio-Rad), respectively (Table I). The results were analyzed using the comparative threshold cycle (CT) method.

Mucus thickness Mucus layer was visualized by periodic acid–Schiff (PAS) staining following formalin fixation. After deparaffinization and rehydration, tissue sections were oxidized in 1% (v/v) periodic acid, stained with Schiff’s reagent, and counterstained with Mayer’s hematoxylin. The mucus-containing cells were stained purple-red. The thickness of the mucus-secreting layer was measured perpendicularly to the mucosal surface from the edge of the epithelium to the outermost part of the mucus-secreting layer under microscopy at 3100 magnification. Results were expressed as the ratio of the thickness of the mucus-secreting layer to the thickness of the total mucosa. All analyses were performed blindly.

Determination of murine cathelicidin (CRAMP) levels For detection of anti-CRAMP, microtiter plates were coated with 1 mg/ml CRAMP (Innovagen) for 2 h at room temperature. Sera were diluted 1:500 and incubated for 90 min at room temperature. After several washing steps with PBS/0.05% Tween 20, bound anti-CRAMP was detected using 0.02 mg/ml HRP-conjugated goat anti-human IgG Ab (SouthernBiotech) and substrate solution (eBioscience). Detection was carried out with a Tecan Infinite F200 Pro microplate reader at 450 nm/620 nm.

Downloaded from http://www.jimmunol.org/ at Albany College of Pharmacy and Health Sciences on January 22, 2016

defense against infection by promoting rapid elimination of pathogens. They are protective against Gram-negative and/or Gram-positive bacteria (15, 16), fungi (17), parasites (18), and enveloped viruses (19–21). Notably, cathelicidins have been found to have anti-biofilm activities in various bacteria, including Pseudomonas aeruginosa (16), Burkholderia pseudomallei (22), Fusobacterium nucleatum (15), and Staphylococcus aureus (15, 23). However, it has not yet been demonstrated whether cathelicidins could prevent H. pylori biofilm formation or destruct the existing biofilm formed by the bacteria. Previously, we found that endogenous cathelicidin acts as a crucial host defense factor against H. pylori colonization by the use of cathelicidin-knockout (Cnlp2/2) mice (24). In the present study, we report that both endogenous and exogenous cathelicidin display obvious antimicrobial activity on normal and drugresistant H. pylori infection in vitro and in vivo. Additionally, in reducing bacteria viability, we found that cathelicidin could confer protection by disrupting H. pylori biofilm formation. We also demonstrate the feasibility of CRAMP supplementation by administration of bioengineered Lactococcus lactis that is protective against H. pylori colonization and the associated inflammation and mucus secretion impairment.

The Journal of Immunology

3

All data were expressed as the mean 6 SEM. To determine statistical significance between groups, comparisons were made using two-tailed t tests. Analyses of multiple groups were done by one-way ANOVA followed by the Tukey t test using GraphPad Prism version 4 (GraphPad Software, San Diego, CA). For all statistical tests, a p value ,0.05 was considered statistically significant.

elicidins could affect biofilm formation by H. pylori in vitro. Consistent with its antimicrobial activity, human cathelicidin LL-37 decreased and disrupted the biofilm formation in a dosedependent manner as determined by BacLight Live/Dead stain (Fig. 2A) and crystal violet assay (Fig. 2B). These findings supported that cathelicidin not only possesses bactericidal activity but also could disrupt biofilm.

Results

Endogenous cathelicidin deficiency promoted H. pylori colonization

Statistical analysis

Antimicrobial activity of exogenous cathelicidin against H. pylori in vitro

Anti-biofilm activity of cathelicidin against H. pylori SS1 in vitro Scanning electron microscopy analysis of gastric biopsies of H. pylori–infected patients demonstrated that the bacteria could form biofilm on the gastric mucosa epithelium (10). In this study, we investigated whether H. pylori could form biofilm in the stomachs of Cnlp+/+ and Cnlp2/2 mice. The scanning electron microscopy images showed that H. pylori SS1 successfully formed biofilm in both types of mouse stomachs compared with the noninfected mice (Supplemental Fig. 1). We next investigated whether cath-

Endogenous cathelicidin protected against H. pylori–induced inflammation To assess the potential role of cathelicidin in H. pylori–associated colonization, we infected Cnlp+/+ and Cnlp2/2 mice with H. pylori by oral gavage to induce gastritis. Three months after H. pylori SS1 inoculation, mice developed gastritis with altered mucosal architecture and neutrophil infiltration. Inflammation score grading was performed according to the updated Sydney classification. The results showed that the inflammation score was significantly higher in the H. pylori–infected Cnlp2/2 mice (p , 0.05) when compared with the H. pylori–infected Cnlp+/+ mice (Fig. 5A). To further determine the inflammatory response to H. pylori infection, gastric tissues were collected for evaluation of proinflammatory cytokine expression as determined by real time-PCR whereas the proportion of granulocytes in circulating peripheral leukocyte was measured in mice. Results showed that H. pylori infection induced a more prominent granulocyte expansion (Fig. 5B), and stronger induction of IL-6, IL-1b, and ICAM1 (Fig. 5C) in Cnlp2/2 mice than in Cnlp+/+ mice. In contrast, the anti-inflammatory cytokine IL-10 mRNA expression was much lower in H. pylori–infected Cnlp2/2 mice (Fig. 5C). Exogenous cathelicidin delivered to mouse stomachs by cathelicidin-secreting L. lactis Our laboratory previously bioengineered probiotic bacteria to actively secrete cathelicidin (33–35). In the present study, we

Table I. Primers used in this study Gene Name

Sense Primer (59→39)

Antisense Primer (59→39)

Hp16S rDNA GAPDH HdiR 8149 TNF-a IL-1b IL-6 ICAM IL-10 MUC1 LL-37 b-actin

TTTGTTAGAGAAGATAATGACGGTATCTAA C GCAGTGGCAAAGTGGAGATT CGTCCTTTGGGAGCAAAAGG CGATAACGCGAGCATAATAAACGGCT CGTGCTCCTCACCCACAC TCAGGCAGGCAGTATCACTCA ACAACCACGGCCTTCCCTACTT GTGGCGGGAAAGTTCCTG CCCTGGGTGAGAAGCTGAAG TCTACTCTGGTGCACAACGG TCGGATGCTAACCTCTACCG TCGCCATGGATGACGATA

CATAGGATT TCACACCTGACTGACTATC TCT CCATGGTGGTGAAGACA TGAAAGTGCTTCGTCTTCAACAAC CACGCTACGCTCAAGGGCTT GGGTTCATACCAGGGTTTGA GGAAGGTCCACGGGAAAGA GTGTAATTAAGCCTCCGACT CGTCTTGCAGGTCATCTTAGGAG CACTGCCTTGCTCTTATTTTCACA TTA TATCGAGAGGCTGCTTCC GGGTACAAGATTCCGCAAAA ATC ACA CCCTGGTGCCTA

Downloaded from http://www.jimmunol.org/ at Albany College of Pharmacy and Health Sciences on January 22, 2016

To examine the potential antimicrobial activity of different analogs of cathelicidin against H. pylori, bacterial viability was determined after exposure to a range of concentrations of CRAMP (mouse cathelicidin), LL-37 (human cathelicidin), and sLL-37 (a fragment of LL-37 corresponding to residues 17–32) in the culture media. All three forms of cathelicidin significantly inhibited H. pylori SS1 growth at the micromolar range of concentrations and were comparable to clarithromycin (0.33 mM), a standard drug for H. pylori eradication in humans (Fig. 1A). We further examined the antimicrobial activity of cathelicidins in clarithromycin-resistant H. pylori 10783, a strain derived from clinical isolate. As shown in Fig. 1B, clarithromycin could not inhibit the bacteria growth in a significant manner. In contrast, CRAMP, LL-37, and sLL-37 markedly inhibited H. pylori 10783 growth. The antimicrobial activity of cathelicidin against both drug-sensitive and -resistant strains of H. pylori occurred at concentrations that have been reported to inhibit the growth of other pathogenic bacteria by other investigators (21, 32). Cathelicidins are known to contain an amphipathic a-helical structure that is thought to aggregate and form pores on the bacterial membrane (16). Thus, we performed scanning electron microscopy to observe microscopic alterations in H. pylori SS1 in response to cathelicidin treatment. Herein, CRAMP, LL-37, and sLL-37 were shown to alter the normal morphology of H. pylori, which was characterized by shrinking of the flagella and pore formation on bacteria membranes (Fig. 1C), causing the loss of cell viability ultimately.

To address the relevance of endogenous cathelicidin in control of H. pylori SS1 colonization in gastric epithelial cells, we transfected HFE-145 cells with control or LL-37–specific siRNA followed by H. pylori infection. Results indicated that LL-37 knockdown significantly promoted the intracellular survival of H. pylori as determined by quantitative culture (Fig. 3Aa) and immunofluorescence staining for H. pylori (Fig. 3Ab, 3B). Moreover, it is noteworthy that this phenomenon was confirmed in Cnlp2/2 mice infected by SS1 or drug-resistant strain 10783 of H. pylori for 3 mo (Fig. 4A, 4B). We found that more H. pylori (SS1 or 10783) was being cultured by colony formation assay and stained in stomachs of Cnlp2/2 mice (Fig. 4C).

4

CATHELICIDIN CONTROLS H. PYLORI SURVIVAL AND INFECTION

determined whether CRAMP (mouse cathelicidin) could be delivered by the bioengineered L. lactis during H. pylori infection. In noninfected wild-type mice, there were low levels of CRAMP expression in gastric epithelial cells (Fig. 6B) whereas no immunoreactivity was observed in the Cnlp2/2 mice (Fig. 6B9). Upon H. pylori infection, we observed that CRAMP was upregulated in gastric epithelial cells (Fig. 6D). Again, no fluorescence signal was detected in the Cnlp2/2 mice (Fig. 6D9). Treatment with the control L. lactis did not alter the gastric mucosal expression of CRAMP in both types of mice (Fig. 6F, F9) whereas exogenous CRAMP could be successfully delivered by the CRAMP-secreting L. lactis to the gastric epithelium as shown by more intense fluorescence signal in the gastric mucosa in both Cnlp+/+ (Fig. 6H) and Cnlp2/2 (Fig. 6H9 mice. To quantify the amount of CRAMP

FIGURE 2. Effect of LL-37 on established H. pylori SS1 biofilm. (A) Representative confocal microscopy images demonstrate the formation of H. pylori biofilm in an eightwell chamber slide after shaking for 72 h anaerobically. The plane surface image of biofilm showed distinct architecture with green fluorescence. Posttreatment with LL-37 significantly decreased H. pylori biofilm formation dose-dependently. Original magnification 340. (B) H. pylori (108 CFU) was added to the 96-well microtiter plate for 72 h incubation with shaking. Biofilms were then exposed to different doses of LL-37 for 48 h. One percent crystal violet solution was added to the plate, and the amount of biofilm was measured by absorbance at OD590 at the end of incubation. LL-37 exhibited an inhibitory action on H. pylori biofilm formation in vitro. Each column represents the mean 6 SEM, n = 5. **p , 0.01, ***p , 0.001 compared with untreated control group.

produced by cathelicidin-secreting L. lactis, we performed CRAMP ELISA assay for mouse stomachs in different treatment groups. Results showed that 1 3 1010 CFU CRAMP-transformed L. lactis with 3 h nisin induction could produce 378.521 pg/ml CRAMP peptide in the supernatant of L. lactis culture medium. We also found that the concentrations of CRAMP were lower in the stomachs of control (102.65 6 5.38 pg/ml) and uninduced L. lactis– inoculated (115.84 6 19.42 pg/ml) wild-type mice chronically infected with H. pylori when compared with the uninfected mice (152.87 6 1.78 pg/ml). Inoculation of cathelicidin-secreting L. lactis (140.65 6 15.99 pg/ml) returned the cathelicidin levels nearly back to those of uninfected mice. In contrast, CRAMP was undetectable in all groups of Cnlp2/2 mice except those inoculated with cathelicidin-secreting L. lactis (99.94 6 20.76 pg/ml).

Downloaded from http://www.jimmunol.org/ at Albany College of Pharmacy and Health Sciences on January 22, 2016

FIGURE 1. Inhibitory action of clarithromycin (CLR), CRAMP, LL-37, or sLL-37 on the growth of (A) H. pylori SS1 and (B) 10783. H. pylori (108 CFU) treated with CLR (0.33mM), CRAMP, LL-37, or sLL-37 were grown in Brucella broth with 5% FBS. All cultures were incubated in a microaerophilic environment at 37˚C with shaking (200 rpm). Bacterial growth (OD595) was measured after 48 h. Each column represents the mean 6 SEM, n = 5. *p , 0.05, **p , 0.01 compared with 108 CFU H. pylori (black bar). (C) Characterization of the antimicrobial action of cathelicidins by scanning electron microscopy. Assessment of the H. pylori SS1 cell morphology by a scanning electron microscopy after addition of CRAMP, LL-37, and sLL-37 treatment for 24 h is shown. Shrunken flagella and pore formation are indicated by solid and dotted arrows, respectively. The scale bars in the upper, middle, and lower panels correspond to 5, 2, and 1 mm, respectively.

The Journal of Immunology

5

These results indicated our present regimen could deliver exogenous CRAMP to mouse stomachs and boost CRAMP expression level back to normal (Fig. 7). Exogenous cathelicidin reduced H. pylori colonization and its associated inflammation The effect of exogenous cathelicidin on H. pylori colonization was measured by determining the levels of H. pylori–specific 16S rDNA in Cnlp2/2 mice. After administration of cathelicidinsecreting L. lactis, the level of H. pylori 16S rDNA was significantly decreased (p , 0.05) in the Cnlp2/2 mice (Fig. 8A). To further determine the anti-inflammatory activity of cathelicidinsecreting L. lactis during H. pylori infection, Cnlp2/2 mice gastric tissues were collected for evaluation of proinflammatory cytokine expression by real time-PCR. Results showed that the mRNA expressions of proinflammatory cytokines IL-6, IL-1b, and ICAM1 were markedly elevated by H. pylori infection in Cnlp2/2 mice, in which cathelicidin-secreting L. lactis significantly reduced their mRNA expression nearly back to the basal levels (Fig. 8B). Exogenous cathelicidin reversed H. pylori infection–induced impairment of mucus secretion and mucin gene expression The mucus-secreting layer visualized by PAS staining and the ratio of mucus-secreting layer to mucosal thickness were evaluated. As shown by the PAS staining, the thickness of the mucus-secreting layer in both wild-type and Cnlp2/2 mice was clearly reduced during chronic H. pylori infection (Fig. 9A). The mucus-containing

cells were drastically depleted in the H. pylori–infected Cnlp+/+ and Cnlp2/2 mice in the gastric corpus as well as the antrum. Such reduction could be reversed by pretreatment with cathelicidinsecreting L. lactis (Fig. 9B). The gastric MUC1 gene expression was also monitored and compared among groups using real-time PCR. As shown in Fig. 9C, MUC1 expression decreased markedly during inflammation in both H. pylori–infected Cnlp+/+ and Cnlp2/2 mice, in which cathelicidin supplement by administration of cathelicidin-secreting L. lactis significantly reversed such downregulation. In the present study, the Muc1 expression and mucus layer thickness in the stomachs of Cnlp2/2 mice were the same as those of Cnlp+/+ mice. This observation indicated that cathelicidin might be required for inducible but not constitutive expression of mucin. It may partially explain why cathelicidin gene knockout had no effect on mucin expression. From these results, the thickness of the mucus-secreting layer seems not to be relevant for the protection of Cnlp+/+ mice from the colonization of H. pylori in the stomach by cathelicidin.

Discussion As occurrence of infection with multidrug-resistant H. pylori is increasing, research into the mechanism by which antimicrobial peptides regulate innate immune responses represents an important direction in formulating novel therapeutic intervention for H. pylori infection. As a prominent member of host defense peptides, cathelicidin controls the fate of many extracellular (36) and intracellular microbes (37). However, our understanding regarding the cathelicidin-related molecular processes on H. pylori

Downloaded from http://www.jimmunol.org/ at Albany College of Pharmacy and Health Sciences on January 22, 2016

FIGURE 3. Endogenous cathelicidin controlled H. pylori SS1 survival in gastric epithelial cells. (Aa) HFE-145 cells were first transfected with nonspecific siRNA (Csi) or siRNA specific for LL-37 (LL-37si) for 48 h and then infected with H. pylori (multiplicity of infection of 100:1) for 24 h. Cells were washed and then treated with 100 mg/ml gentamicin for 2 h to kill extracellular bacteria. Thereafter, intracellular bacteria were harvested and assayed for viability based on the number of CFU. The CFU data shown represent the mean 6 SEM of three individual experiments (**p , 0.01 for the Csi versus LL-37si group). (Ab) Quantitative data show the number of H. pylori per cells. Data are means 6 SEM, with each experiment including at least seven random fields using confocal microscopy. Quantitative data show the ratio of H. pylori per cells. **p , 0.01 for the Csi versus LL-37si group. (Ac) HFE-145 cells were transfected for 48 h with control (Csi) or LL-37–directed siRNA (LL-37si). Total RNA was extracted from cells. The mRNA expression was determined using quantitative RT-PCR analysis. The columns show the means 6 SD of the mRNA levels from three independent replicates. Real-time PCR was performed in duplicate. ***p , 0.01 versus the Csi group. (B) The cells were fixed, and intracellular H. pylori was immunostained with anti– H. pylori Ab, followed by the addition of Alexa Fluor 568 mouse anti-rabbit IgG (red). The nuclei were stained with DAPI (blue). Scale bars, 20 mm.

6

CATHELICIDIN CONTROLS H. PYLORI SURVIVAL AND INFECTION

infection is still primitive. Hence, we sought to uncover the actions and possible mechanisms of cathelicidin in controlling H. pylori survival and its associated gastritis.

Advanced physiochemical techniques revealed that human cathelicidin, LL-37, uses a toroidal pore carpet-like mechanism commonly used by other cationic antimicrobial peptides to form

FIGURE 5. Endogenous CRAMP protected against H. pylori SS1–induced inflammation. (A) The inflammation score was evaluated in the Cnlp+/+ and Cnlp2/2 mice infected with H. pylori for 3 mo. Each column represents the mean 6 SEM. There were eight animals in each group. *p , 0.05. (B) Proportion of granulocytes in circulating peripheral leukocyte. Each column represents the mean 6 SEM. There were eight animals in each group. **p , 0.01. (C) mRNA levels for inflammatory cytokines in gastric mucosae with or without H. pylori infection in mice, determined by realtime PCR. b-Actin was used as the internal standard. Each column represents the mean 6 SEM. There were eight animals in each group. **p , 0.01 in Cnlp2/2 mice versus corresponding Cnlp+/+ mice.

Downloaded from http://www.jimmunol.org/ at Albany College of Pharmacy and Health Sciences on January 22, 2016

FIGURE 4. Endogenous cathelicidin (CRAMP) reduced H. pylori colonization in mouse stomachs. (A) Cnlp+/+ and Cnlp2/2 mice were infected by H. pylori (SS1 or 10783) or BHI for 1 mo and received distilled water every other day for 2 mo. Representative immunofluorescence images of four independent replicates are shown. Scale bars, 10 mm. Stomach sections were stained with DAPI to visualize the nuclei (blue) and with H. pylori Ab to detect H. pylori in the gastric epithelium (red). (B) Graph shows the number of H. pylori SS1 or 10783 observed per field under microscope. Each column represents the mean 6 SEM. There were six animals in each group. *p , 0.05, **p , 0.01 in Cnlp2/2 mice versus corresponding Cnlp+/+ mice. (C) H. pylori SS1 and 10783 colonization levels were determined by colony-forming assay. Data shown represent means 6 SEM of six independent samples. There were six animals in each group. *p , 0.05 versus Cnlp+/+ mice.

The Journal of Immunology

7

pores and cause severe leakage on biological membranes (38). Importantly, LL-37 has been shown to inhibit H. pylori growth in vitro with unknown mechanism (39). In the present study, we identified that CRAMP, LL-37, and sLL-37 affected normal as well as drug-resistant H. pylori growth, similar to previous observation against Burkholderia thailandensis (40). Scanning electron microscopy also clearly indicated pore formation on the membrane of H. pylori. Furthermore, disruption of H. pylori flagella may be another mechanism underlying the antimicrobial activities of cathelicidin, which warrants further investigation. The reliance of H. pylori on biofilm formation for persistent infection has been confirmed in both human gastric mucosa (41) and glass surface in vitro (42). However, the importance of exopolysaccharide matix on Cnlp+/+ and Cnlp2/2 mice stomach homeostasis and the indirect effect of such matrix on H. pylori colonization are still unknown. Thus, we investigated H. pylori biofilm formation in stomach mucosa from both cathelicidin

FIGURE 7. The amount of CRAMP supplemented by CRAMP-encoding L. lactis to mouse stomachs. The concentrations of CRAMP secreted by CRAMP-encoding L. lactis were measured in normal and H. pylori– induced gastritis in Cnlp+/+ and Cnlp2/2 mice. Data shown represent means 6 SEM of six independent samples. There were six animals in each group. ***p , 0.001 versus BC group in Cnlp+/+ mice; ^p , 0.05, ^^p , 0.01 versus N4I group in Cnlp+/+ mice.

knockout and wild-type mice by scanning electron microscopy. The results indicated that biofilm existed in mouse stomachs after H. pylori infection and that more exopolysaccharide matrices were deposited by H. pylori in the Cnlp2/2 gastric surface when compared with Cnlp+/+ mice. In line with our findings, extracellular polysaccharide has been confirmed to promote biofilm in P. aeruginosa (43). Furthermore, we showed evidence of the destruction of H. pylori biofilm formation by LL-37 using in vitro crystal violet assay. Based on the previous antimicrobial findings, we propose that the action of cathelicidin on H. pylori survival in vitro may be attributed to their abilities to form pores on the membrane, weakening the movement of flagella and impairing H. pylori biofilm formation. It has been demonstrated that H. pylori, with the help of urease and flagella, must quickly migrate from the gastric lumen (pH 1–2), through the mucus layer (pH 4–7), to the gastric epithelial surface (pH 7) to maintain survival (44). In the present antimicrobial and anti-biofilm assays, H. pylori were cultured in Brucella broth with 5% FBS (pH 6) under microaerophilic conditions at 37˚C. This culture condition should be similar to the in vivo microenvironments, and this condition has been widely used in H. pylori in vitro experiments (11, 45, 46). To verify whether endogenous cathelicidin could play a role in the clearance of normal and drug-resistant H. pylori, cathelicidin mRNA level was determined in human gastric epithelial cells (Supplemental Fig. 2) and the protein level was determined in mouse stomachs after H. pylori infection (Fig. 9). H. pylori in contact with human gastric epithelial cells resulted in rapid production of cathelicidin, with maximum level detected at 1 h after stimulation. The initial increase was followed by a rapid decrease of the transcript levels, and, after infection for 24 h, the level of cathelicidin mRNA was back to normal (Supplemental Fig. 2). Similar to the in vitro findings, mouse cathelicidin in stomach was found to be substantially increased in the wild-type mice after infection with H. pylori SS1 for 24 h in our previous study (24). This rapid induction hinted at the importance of cathelicidin as the first line of mucosal defense against bacterial infection in the stomach. Indeed, in cathelicidin-deficient (Cnlp2/2) mice or cathelicidin-silenced (transfected with LL-37 siRNA) gastric

Downloaded from http://www.jimmunol.org/ at Albany College of Pharmacy and Health Sciences on January 22, 2016

FIGURE 6. Immunofluorescence staining of CRAMP in the stomach. Sections were stained with DAPI (A, C, E, G, A9, C9, E9, and G9) and CRAMP Ab (B, D, F, H, B9, D9, F9, and H9). Original magnification 340. The CRAMP-secreting L. lactis successfully delivered exogenous CRAMP to the gastric epithelium (N4I) in the Cnlp+/+ (H) and Cnlp2/2 (H9) mice. There was no staining of endogenous CRAMP in CRAMP-deficient mice (B9, D9, and F9).

8

CATHELICIDIN CONTROLS H. PYLORI SURVIVAL AND INFECTION

epithelial cells, the antimicrobial properties of the gastric epithelium were substantially compromised during either normal or drug-resistant H. pylori infection. These results indicate that absence of endogenous cathelicidin could aggravate both normal and drug-resistant H. pylori colonization. Cathelicidin is a modulator of mucosal inflammatory cell infiltration (47). Concordantly, our data indicate that cathelicidin could alleviate H. pylori–associated inflammation. To substantiate this anti-inflammatory function, we evaluated the extent of gastritis by histological measurement and cytokine expression in gastric tissues of cathelicidin-deficient mice (Cnlp2/2) and their normal counterparts (Cnlp+/+) after 3 mo of H. pylori infection. Histological examination showed that Cnlp2/2 mice had much higher inflammation scores in the gastric mucosa and much more

granulocytes in the circulation than did the wild-type mice. Similarly, there was more IL-6, IL-1b,and ICAM1 mRNA expression in the stomachs of cathelicidin-deficient mice after H. pylori challenges. Whether the alleviation of inflammation is caused by reduced bacterial load, however, warrants further investigation. Previous studies have shown that the probiotic L. lactis could colonize the gastric epithelium (48–50). Using the nisin-inducible system, we have also shown that cathelicidin-encoding vector could be successfully transformed into L. lactis (24, 35) and produce 378.521 pg/ml CRAMP peptide in the supernatant of L. lactis culture medium determined by a CRAMP ELISA kit. Previously, we identified the adherence and colonization of bioengineered L. lactis in the gastric epithelia of Cnlp2/2 mice by immunohistochemical staining (24, 35). In the present study, we

Downloaded from http://www.jimmunol.org/ at Albany College of Pharmacy and Health Sciences on January 22, 2016

FIGURE 8. Exogenous CRAMP reduced H. pylori SS1 colonization and its associated inflammation. (A) H. pylori 16S rDNA gene expression was determined by PCR and standardized against the expression of GAPDH in stomachs. Each column represents the mean 6 SEM. There were eight animals in each group. (B) mRNA levels for cytokines TNF-a (Ba), IL-6 (Bb), IL-1b (Bc), and ICAM (Bd) in Cnlp2/2 mouse stomachs were quantitatively analyzed by real-time PCR. Each column represents the mean 6 SEM. There were eight animals in each group. *p , 0.05, **p , 0.01.

The Journal of Immunology

9

performed conventional PCR to measure bioengineered L. lactis in mouse stomachs. Results showed that both control L. lactis and CRAMP-secreting L. lactis could be detected in mouse stomachs as least 2 mo after administration (Supplemental Fig. 3). To determine the levels of CRAMP produced by bioengineered L. lactis, we performed a CRAMP ELISA assay for mouse stomachs in different treatment groups. We found that cathelicidin-secreting L. lactis could supplement cathelicidin in H. pylori–infected mice (Fig. 9). The present data combined with previous findings suggest that this novel gene delivery approach could effectively deliver exogenous cathelicidin to the gastric epithelium and thereby reduce H. pylori survival and H. pylori–associated gastric inflammation. Epithelial cells lining on mucosal surfaces function as protective barriers against infectious pathogens (51, 52). Mucins play a pivotal role in mucosal barrier and they are secreted to the apical surface of epithelial cells in lungs, stomach, intestines, eyes, and several other organs (53). Increasing evidence also shows that abnormal mucus secretion is a pathogenic hallmark of gastritis (54) and gastric cancer (55, 56). The function of mucins is to protect the body from infection by binding pathogens to oligosaccharides, preventing them from reaching the cell surface (57). To this end, the gastric epithelial cells secrete a mucus layer, which contains glycocalyx and mucin 1 (58). Our previous study has shown that exogenous cathelicidin could regulate mucin expression during experimental colitis (33, 59). During infection

with H. pylori, the rate of mucin turnover and the levels of mucin 1 were reduced (54, 53). When H. pylori colonizes in this mucus niche, the decreased turnover may produce a more stable and favorable microenvironment for the bacteria by impairing their clearance by mucus flow (58). In humans, polymorphisms in the MUC1 allele, which result in the short form of this mucin, are associated with an increased susceptibility to gastric cancer and H. pylori–induced gastritis (53, 55). Previous study also showed that deficiency in mucin 1 facilitates a significant increase in H. pylori colonization as well as greater TNF-a and keratinocyte chemoattractant mRNA levels (51, 54). In line with the previous reports (53, 54, 60, 61), H. pylori infection reduced the thickness of the stomach mucus-secreting layer in the present study. Both Cnlp+/+ and Cnlp2/2 mice showed a significant reduction of the thickness of the mucus layer after gastritis induction, and, more importantly, cathelicidin supplementation by bioengineered L. lactis preserved the mucus-secreting layer. Results from real-time PCR suggest that cathelicidin may stimulate mucus synthesis in the gastric mucosa by upregulating the mRNA expression of MUC1. Consistently, a finding from a recent MUC1 knockout mouse model has confirmed that disruption in mucus synthesis could exacerbate experimental gastritis induced by H. pylori (55). This work has uncovered the previously unappreciated role of cathelicidin in host defense against H. pylori infection. In this regard, cathelicidin could be regarded as a potential natural antibiotic for promoting the clearance of H. pylori. Our cathelicidin-

Downloaded from http://www.jimmunol.org/ at Albany College of Pharmacy and Health Sciences on January 22, 2016

FIGURE 9. Exogenous CRAMP reversed the impaired mucus secretion and mucin gene expression affected by H. pylori SS1 infection. (A) Representative micrographs of PAS staining in stomach corpus and antrum of Cnlp+/+ and Cnlp2/2 mice. Original magnification 3100. (B) Effects of CRAMP supplement on the mucus-secreting layer and mucin expression in Cnlp+/+ and Cnlp2/2 mice. The length of the mucus-secreting layer and the total mucosal thickness were measured in normal and H. pylori–induced gastritis in Cnlp+/+ and Cnlp2/2 mice. Results were calculated by determining the length of the mucus-secreting layer over the total mucosal thickness. Each column represents the mean 6 SEM. There were eight animals in each group. (C) MUC1 gene expression was determined by real-time PCR and standardized against the expression of b-actin. Each column represents the mean 6 SEM. There were eight animals in each group. **p , 0.01.

10

CATHELICIDIN CONTROLS H. PYLORI SURVIVAL AND INFECTION

secreting L. lactis therapy could not only provide a new mechanistic insight into the role of cathelicidin in pathogen infection, but it also represents a novel therapeutic approach to combat infectious diseases, especially those caused by antibiotic-resistant bacteria. By understanding and harnessing the protective mechanisms of cathelicidin against H. pylori infection together with the application of our novel peptide delivery strategy, cathelicidinsecreting probiotics could be effective therapeutic agents for the treatment of H. pylori infection and its associated gastritis in humans.

We thank the Core Facility of the School of Biomedical Sciences of Chinese University of Hong Kong for expert technical help in SEM and confocal imaging.

Disclosures The authors have no financial conflicts of interest.

References 1. Marshall, B. J., and J. R. Warren. 1984. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet 321: 1311–1315. 2. Suerbaum, S., and C. Josenhans. 2007. Helicobacter pylori evolution and phenotypic diversification in a changing host. Nat. Rev. Microbiol. 5: 441–452. 3. Arnold, M., H. E. Karim-Kos, J. W. Coebergh, G. Byrnes, A. Antilla, J. Ferlay, A. G. Renehan, D. Forman, and I. Soerjomataram. 2015. Recent trends in incidence of five common cancers in 26 European countries since 1988: analysis of the European Cancer Observatory. Eur. J. Cancer 51: 1164–1187. 4. Helicobacter and Cancer Collaborative Group. 2001. Gastric cancer and Helicobacter pylori: a combined analysis of 12 case control studies nested within prospective cohorts. Gut 49: 347–353. 5. Wu, W., Y. Yang, and G. Sun. 2012. Recent insights into antibiotic resistance in Helicobacter pylori eradication. Gastroenterol. Res. Pract. 2012: 723183. 6. Su, P., Y. Li, H. Li, J. Zhang, L. Lin, Q. Wang, F. Guo, Z. Ji, J. Mao, W. Tang, et al. 2013. Antibiotic resistance of Helicobacter pylori isolated in the southeast coastal region of China. Helicobacter 18: 274–279. 7. Gerrits, M. M., A. H. van Vliet, E. J. Kuipers, and J. G. Kusters. 2006. Helicobacter pylori and antimicrobial resistance: molecular mechanisms and clinical implications. Lancet Infect. Dis. 6: 699–709. 8. Hall-Stoodley, L., J. W. Costerton, and P. Stoodley. 2004. Bacterial biofilms: from the natural environment to infectious diseases. Nat. Rev. Microbiol. 2: 95– 108. 9. Vandamme, D., B. Landuyt, W. Luyten, and L. Schoofs. 2012. A comprehensive summary of LL-37, the factotum human cathelicidin peptide. Cell. Immunol. 280: 22–35. 10. Cammarota, G., M. Sanguinetti, A. Gallo, and B. Posteraro. 2012. Review article: biofilm formation by Helicobacter pylori as a target for eradication of resistant infection. Aliment. Pharmacol. Ther. 36: 222–230. 11. Yonezawa, H., T. Osaki, S. Kurata, C. Zaman, T. Hanawa, and S. Kamiya. 2010. Assessment of in vitro biofilm formation by Helicobacter pylori. J. Gastroenterol. Hepatol. 25(Suppl. 1): S90–S94. 12. Carron, M. A., V. R. Tran, C. Sugawa, and J. M. Coticchia. 2006. Identification of Helicobacter pylori biofilms in human gastric mucosa. J. Gastrointest. Surg. 10: 712–717. 13. Coticchia, J. M., C. Sugawa, V. R. Tran, J. Gurrola, E. Kowalski, and M. A. Carron. 2006. Presence and density of Helicobacter pylori biofilms in human gastric mucosa in patients with peptic ulcer disease. J. Gastrointest. Surg. 10: 883–889. 14. Hurdle, J. G., A. J. O’Neill, I. Chopra, and R. E. Lee. 2011. Targeting bacterial membrane function: an underexploited mechanism for treating persistent infections. Nat. Rev. Microbiol. 9: 62–75. 15. Gursoy, U. K., M. Po¨lla¨nen, E. Ko¨no¨nen, and V. J. Uitto. 2012. A novel organotypic dento-epithelial culture model: effect of Fusobacterium nucleatum biofilm on B-defensin-2, -3, and LL-37 expression. J. Periodontol. 83: 242–247. 16. Nagant, C., B. Pitts, K. Nazmi, M. Vandenbranden, J. G. Bolscher, P. S. Stewart, and J. P. Dehaye. 2012. Identification of peptides derived from the human antimicrobial peptide LL-37 active against biofilms formed by Pseudomonas aeruginosa using a library of truncated fragments. Antimicrob. Agents Chemother. 56: 5698–5708. 17. Lo´pez-Garcı´a, B., P. H. Lee, K. Yamasaki, and R. L. Gallo. 2005. Anti-fungal activity of cathelicidins and their potential role in Candida albicans skin infection. J. Invest. Dermatol. 125: 108–115. 18. Cobo, E. R., C. He, K. Hirata, G. Hwang, U. Tran, L. Eckmann, R. L. Gallo, and S. L. Reed. 2012. Entamoeba histolytica induces intestinal cathelicidins but is resistant to cathelicidin-mediated killing. Infect. Immun. 80: 143–149. 19. Crack, L. R., L. Jones, G. N. Malavige, V. Patel, and G. S. Ogg. 2012. Human antimicrobial peptides LL-37 and human b-defensin-2 reduce viral replication in keratinocytes infected with varicella zoster virus. Clin. Exp. Dermatol. 37: 534– 543.

Downloaded from http://www.jimmunol.org/ at Albany College of Pharmacy and Health Sciences on January 22, 2016

Acknowledgments

20. Wang, G., K. M. Watson, and R. W. Buckheit, Jr. 2008. Anti-human immunodeficiency virus type 1 activities of antimicrobial peptides derived from human and bovine cathelicidins. Antimicrob. Agents Chemother. 52: 3438–3440. 21. Wong, J. H., A. Legowska, K. Rolka, T. B. Ng, M. Hui, C. H. Cho, W. W. Lam, S. W. Au, O. W. Gu, and D. C. Wan. 2011. Effects of cathelicidin and its fragments on three key enzymes of HIV-1. Peptides 32: 1117–1122. 22. Kanthawong, S., J. G. Bolscher, E. C. Veerman, J. van Marle, H. J. de Soet, K. Nazmi, S. Wongratanacheewin, and S. Taweechaisupapong. 2012. Antimicrobial and antibiofilm activity of LL-37 and its truncated variants against Burkholderia pseudomallei. Int. J. Antimicrob. Agents 39: 39–44. 23. Dean, S. N., B. M. Bishop, and M. L. van Hoek. 2011. Natural and synthetic cathelicidin peptides with anti-microbial and anti-biofilm activity against Staphylococcus aureus. BMC Microbiol. 11: 114. 24. Zhang, L., J. Yu, C. C. Wong, T. K. Ling, Z. J. Li, K. M. Chan, S. X. Ren, J. Shen, R. L. Chan, C. C. Lee, et al. 2013. Cathelicidin protects against Helicobacter pylori colonization and the associated gastritis in mice. Gene Ther. 20: 751–760. 25. Bals, R., X. Wang, M. Zasloff, and J. M. Wilson. 1998. The peptide antibiotic LL-37/hCAP-18 is expressed in epithelia of the human lung where it has broad antimicrobial activity at the airway surface. Proc. Natl. Acad. Sci. USA 95: 9541–9546. 26. Djordjevic, D., M. Wiedmann, and L. A. McLandsborough. 2002. Microtiter plate assay for assessment of Listeria monocytogenes biofilm formation. Appl. Environ. Microbiol. 68: 2950–2958. 27. Latorre, A. A., J. A. Van Kessel, J. S. Karns, M. J. Zurakowski, A. K. Pradhan, K. J. Boor, E. Adolph, S. Sukhnanand, and Y. H. Schukken. 2011. Increased in vitro adherence and on-farm persistence of predominant and persistent Listeria monocytogenes strains in the milking system. Appl. Environ. Microbiol. 77: 3676–3684. 28. Jurcisek, J. A., A. C. Dickson, M. E. Bruggeman, and L. O. Bakaletz. 2011. In vitro biofilm formation in an 8-well chamber slide. J. Vis. Exp. 2011: pii: 2481. 29. Stoffel, M. H., A. E. Friess, A. Burnens, A. Schmassmann, and R. Neiger. 2000. Distinction of gastric Helicobacter spp. in humans and domestic pets by scanning electron microscopy. Helicobacter 5: 232–239. 30. Su, B., S. Johansson, M. Fa¨llman, M. Patarroyo, M. Granstro¨m, and S. Normark. 1999. Signal transduction-mediated adherence and entry of Helicobacter pylori into cultured cells. Gastroenterology 117: 595–604. 31. Dixon, M. F., R. M. Genta, J. H. Yardley, and P. Correa. 1996. Classification and grading of gastritis. The updated Sydney system. International Workshop on the Histopathology of Gastritis, Houston 1994. Am. J. Surg. Pathol. 20: 1161–1181. 32. Strempel, N., A. Neidig, M. Nusser, R. Geffers, J. Vieillard, O. Lesouhaitier, G. Brenner-Weiss, and J. Overhage. 2013. Human host defense peptide LL-37 stimulates virulence factor production and adaptive resistance in Pseudomonas aeruginosa. PLoS One 8: e82240. doi:10.1371/journal.pone.0082240 33. Tai, E. K., W. K. Wu, X. J. Wang, H. P. Wong, L. Yu, Z. J. Li, C. W. Lee, C. C. Wong, J. Yu, J. J. Sung, et al. 2013. Intrarectal administration of mCRAMP-encoding plasmid reverses exacerbated colitis in Cnlp2/2 mice. Gene Ther. 20: 187–193. 34. Tai, E. K., W. K. Wu, H. P. Wong, E. K. Lam, L. Yu, and C. H. Cho. 2007. A new role for cathelicidin in ulcerative colitis in mice. Exp. Biol. Med. (Maywood) 232: 799–808. 35. Wong, C. C., L. Zhang, Z. J. Li, W. K. Wu, S. X. Ren, Y. C. Chen, T. B. Ng, and C. H. Cho. 2012. Protective effects of cathelicidin-encoding Lactococcus lactis in murine ulcerative colitis. J. Gastroenterol. Hepatol. 27: 1205–1212. 36. Zelezetsky, I., A. Pontillo, L. Puzzi, N. Antcheva, L. Segat, S. Pacor, S. Crovella, and A. Tossi. 2006. Evolution of the primate cathelicidin. Correlation between structural variations and antimicrobial activity. J. Biol. Chem. 281: 19861– 19871. 37. Yuk, J. M., D. M. Shin, H. M. Lee, C. S. Yang, H. S. Jin, K. K. Kim, Z. W. Lee, S. H. Lee, J. M. Kim, and E. K. Jo. 2009. Vitamin D3 induces autophagy in human monocytes/macrophages via cathelicidin. Cell Host Microbe 6: 231–243. 38. Thennarasu, S., A. Tan, R. Penumatchu, C. E. Shelburne, D. L. Heyl, and A. Ramamoorthy. 2010. Antimicrobial and membrane disrupting activities of a peptide derived from the human cathelicidin antimicrobial peptide LL37. Biophys. J. 98: 248–257. 39. Hase, K., M. Murakami, M. Iimura, S. P. Cole, Y. Horibe, T. Ohtake, M. Obonyo, R. L. Gallo, L. Eckmann, and M. F. Kagnoff. 2003. Expression of LL-37 by human gastric epithelial cells as a potential host defense mechanism against Helicobacter pylori. Gastroenterology 125: 1613–1625. 40. Kanthawong, S., J. G. Bolscher, E. C. Veerman, J. van Marle, K. Nazmi, S. Wongratanacheewin, and S. Taweechaisupapong. 2010. Antimicrobial activities of LL-37 and its truncated variants against Burkholderia thailandensis. Int. J. Antimicrob. Agents 36: 447–452. 41. Souto, R., and A. P. Colombo. 2008. Detection of Helicobacter pylori by polymerase chain reaction in the subgingival biofilm and saliva of non-dyspeptic periodontal patients. J. Periodontol. 79: 97–103. 42. Yang, F. L., A. M. Hassanbhai, H. Y. Chen, Z. Y. Huang, T. L. Lin, S. H. Wu, and B. Ho. 2011. Proteomannans in biofilm of Helicobacter pylori ATCC 43504. Helicobacter 16: 89–98. 43. Irie, Y., B. R. Borlee, J. R. O’Connor, P. J. Hill, C. S. Harwood, D. J. Wozniak, and M. R. Parsek. 2012. Self-produced exopolysaccharide is a signal that stimulates biofilm formation in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 109: 20632–20636. 44. Salama, N. R., M. L. Hartung, and A. M€uller. 2013. Life in the human stomach: persistence strategies of the bacterial pathogen Helicobacter pylori. Nat. Rev. Microbiol. 11: 385–399.

The Journal of Immunology

54. McGuckin, M. A., A. L. Every, C. D. Skene, S. K. Linden, Y. T. Chionh, A. Swierczak, J. McAuley, S. Harbour, M. Kaparakis, R. Ferrero, and P. Sutton. 2007. Muc1 mucin limits both Helicobacter pylori colonization of the murine gastric mucosa and associated gastritis. Gastroenterology 133: 1210–1218. 55. Carvalho, F., R. Seruca, L. David, A. Amorim, M. Seixas, E. Bennett, H. Clausen, and M. Sobrinho-Simo˜es. 1997. MUC1 gene polymorphism and gastric cancer–an epidemiological study. Glycoconj. J. 14: 107–111. 56. Babu, S. D., V. Jayanthi, N. Devaraj, C. A. Reis, and H. Devaraj. 2006. Expression profile of mucins (MUC2, MUC5AC and MUC6) in Helicobacter pylori infected pre-neoplastic and neoplastic human gastric epithelium. Mol. Cancer 5: 10. 57. Tarang, S., S. Kumar, and S. K. Batra. 2012. Mucins and Toll-like receptors: kith and kin in infection and cancer. Cancer Lett. 321: 110–119. 58. Navabi, N., M. E. Johansson, S. Raghavan, and S. K. Linde´n. 2013. Helicobacter pylori infection impairs the mucin production rate and turnover in the murine gastric mucosa. Infect. Immun. 81: 829–837. 59. Tai, E. K., H. P. Wong, E. K. Lam, W. K. Wu, L. Yu, M. W. Koo, and C. H. Cho. 2008. Cathelicidin stimulates colonic mucus synthesis by up-regulating MUC1 and MUC2 expression through a mitogen-activated protein kinase pathway. J. Cell. Biochem. 104: 251–258. 60. Ko, G. H., S. M. Kang, Y. K. Kim, J. H. Lee, C. K. Park, H. S. Youn, S. C. Baik, M. J. Cho, W. K. Lee, and K. H. Rhee. 1999. Invasiveness of Helicobacter pylori into human gastric mucosa. Helicobacter 4: 77–81. 61. Klaamas, K., O. Kurtenkov, S. von Mensdorff-Pouilly, L. Shljapnikova, L. Miljukhina, V. Brjalin, and A. Lipping. 2007. Impact of Helicobacter pylori infection on the humoral immune response to MUC1 peptide in patients with chronic gastric diseases and gastric cancer. Immunol. Invest. 36: 371– 386.

Downloaded from http://www.jimmunol.org/ at Albany College of Pharmacy and Health Sciences on January 22, 2016

45. Jime´nez-Soto, L. F., S. Rohrer, U. Jain, C. Ertl, X. Sewald, and R. Haas. 2012. Effects of cholesterol on Helicobacter pylori growth and virulence properties in vitro. Helicobacter 17: 133–139. 46. Saito, N., K. Konishi, F. Sato, M. Kato, H. Takeda, T. Sugiyama, and M. Asaka. 2003. Plural transformation-processes from spiral to coccoid Helicobacter pylori and its viability. J. Infect. 46: 49–55. 47. Yamasaki, K., A. Di Nardo, A. Bardan, M. Murakami, T. Ohtake, A. Coda, R. A. Dorschner, C. Bonnart, P. Descargues, A. Hovnanian, et al. 2007. Increased serine protease activity and cathelicidin promotes skin inflammation in rosacea. Nat. Med. 13: 975–980. 48. Mannam, P., K. F. Jones, and B. L. Geller. 2004. Mucosal vaccine made from live, recombinant Lactococcus lactis protects mice against pharyngeal infection with Streptococcus pyogenes. Infect. Immun. 72: 3444–3450. 49. Ravnikar, M., B. Strukelj, N. Obermajer, M. Lunder, and A. Berlec. 2010. Engineered lactic acid bacterium Lactococcus lactis capable of binding antibodies and tumor necrosis factor a. Appl. Environ. Microbiol. 76: 6928–6932. 50. Watson, D., R. D. Sleator, C. Hill, and C. G. Gahan. 2008. Enhancing bile tolerance improves survival and persistence of Bifidobacterium and Lactococcus in the murine gastrointestinal tract. BMC Microbiol. 8: 176. 51. Guang, W., H. Ding, S. J. Czinn, K. C. Kim, T. G. Blanchard, and E. P. Lillehoj. 2010. Muc1 cell surface mucin attenuates epithelial inflammation in response to a common mucosal pathogen. J. Biol. Chem. 285: 20547–20557. 52. Hollingsworth, M. A., and B. J. Swanson. 2004. Mucins in cancer: protection and control of the cell surface. Nat. Rev. Cancer 4: 45–60. 53. Vinall, L. E., M. King, M. Novelli, C. A. Green, G. Daniels, J. Hilkens, M. Sarner, and D. M. Swallow. 2002. Altered expression and allelic association of the hypervariable membrane mucin MUC1 in Helicobacter pylori gastritis. Gastroenterology 123: 41–49.

11