Lan et al.: Journal of AOAC International Vol. 98, No. 1, 2015  1

AGRICULTURAL MATERIALS

Crop Plant Genotyping by Real-Time PCR Analysis of Crude Extracts of Seeds Yang Lan, Cheng-En Wang, and Chuan-Fang Wu1

Sichuan University, Key Laboratory of Bioresources and Ecoenvironment (Ministry of Education), College of Life Sciences, Chengdu 610064, People’s Republic of China Zhong-Yu Liu and Chun-Fang Gao1 Institute of Anal-Colorectal Surgery, The 150th Central Hospital of Chinese PLA, Luoyang 471031, People’s Republic of China

Development of agricultural biotechnology requires rapid and convenient methods for crop plant genotyping. Real-time PCR is sensitive and reliable, and has been a routine technique in plant research. However, its application is limited by the cumbersome DNA template preparation procedures. We tested three PCR master mixes for direct amplification of crude seed DNA extracts without extensive purification. One mix had higher resistance to plant-derived PCR inhibitors and was shown to be applicable to various important crop plants. Furthermore, this method is capable of detecting single-copy genes from 2 mg pieces of seeds repetitively. Meanwhile, melting curve analysis could detect amplicons directly without electrophoresis manipulations. Taken together, this direct real-time PCR method provides a rapid and convenient tool for seed genotypic screening in crop plants.

P

CR has numerous applications in agricultural biotechnology, including plant diversity analysis, molecular breeding, and genetic engineering. PCR-based detection of seed DNA allows genotypic screening before germination and has been utilized in marker-assisted selection (MAS; 1), detection of genetically modified organisms (GMOs), and seed purity testing (2). The main advantage of PCR is that it requires a low copy number of template for amplification and is a rapid method, as with the time required for reaction setup and thermal cycling being less than 4 h. The major rate-limiting step for the PCR analysis in plant research is to prepare high purity DNA template. Plant tissues contain high levels of proteins, polysaccharides, and polyphenolic components that inhibit PCR amplification. The cetyltrimethylammonium bromide (CTAB)- and sodium dodecyl sulfate (SDS)-based methods are most commonly used for plant DNA purification (3–6). CTAB and SDS are used to release DNA and form complexes with proteins and polysaccharides. Then, in most cases, the lysates are further purified by organic solvents extraction. In addition, modifications for different plant materials are often required, such as addition of protease K, N-phenacylthiazolium bromide,

Received May 18, 2014. Accepted by AH September 3, 2014. 1 Corresponding authors’ e-mail: [email protected] and [email protected] DOI: 10.5740/jaoacint.14-104

and polyvinylpyrrolidone for samples containing high levels of proteins, polysaccharides, and polyphenolic components, respectively. For some challenging samples, commercial kits are still required to purify DNA template for real-time PCR (7). Overall, these procedures are time-consuming and labor-intensive especially when dealing with a large number of samples. In order to avoid these procedures, several methods and commercial kits have been developed for direct PCR using crude plant DNA extract as template; however, they mainly used end point PCR (8–10). The requirement of gel electrophoresis analysis of PCR amplicons after amplification limits their applications. In addition, these manipulations also have the potential to increase the frequency of contamination. The melting curve analysis of real-time PCR enables rapid detection of amplicons without electrophoresis analysis. In order to take the advantage of real-time PCR, we introduced a direct real-time PCR method to amplify crude seed DNA directly without extensive purification. Three realtime PCR master mixes were tested with crude seed DNA extracts prepared by a plant direct PCR kit. An effective mix was found with high resistance to plant-derived PCR inhibitors and capable of detecting single-copy genes of various important crop plants repetitively. This method eliminates both prior DNA purification and subsequent gel electrophoresis analysis of PCR amplicons, which provides a rapid and convenient method for MAS, GM seed detection, and seed purity testing. Materials and Methods Crop Seeds and PCR Primers Dry seeds of six important crop plants, bread wheat (Triticum aestivum), cotton (Gossypium hirsutum), maize (Zea mays), rape (Brassica napus), rice (Oryza sativa), and soybean (Glycine max), were obtained from Sichuan Agricultural University. Primers used for all target genes are listed in Table 1. tRNA-Leu is a highly conserved chloroplast gene among all of these six plants and was amplified by the same primer pair. Other genes are known single-copy nuclear genes for each plant. DNA Extraction and Purification Crude seed DNA extracts were prepared from 1 to 10 mg pieces of seeds using the Plant Seed Direct PCR Kit (Foregene, Chengdu, China; www.foregene.com/en/) according to the manufacturer’s instructions. Briefly, small pieces of seeds were cut and weighed on an electronic balance. Pieces of dry seeds

2  Lan et al.: Journal of AOAC International Vol. 98, No. 1, 2015 Table  1.  Primers used for seed direct real-time PCR Genes

Crops

Primers (5' to 3') F: CGAAATCGGTAGACGCTACG

tRNA-Leu

F: TTCCATTGAGTCTCTGCACCT Wx012

Bread wheat Maize

PE3-PEPcase

Rape

SPS

Rice

135 13 121 14

F: TTGCGCCTGAACGGATAT R: CGGTTGATCTTTTCGGGATG

Soybean

102 12

F: CCAGTTCTTGGAGCCGCTTGA R: AAGGGCCAGTCCAAATGCAGA

Lectin

Variable

F: CGTCGTTTCCCATCTCTTCCTCC R: CCACTCCGAGACCCTCAGTC

81 15

F: CCTCCTCGGGAAAGTTACAA R: GGGCATAGAAGGTGAAGTT

Amplicon, bp

11

R: GTCGCGGGAACAGAGGTGT R: GGTGTTCCTCCATTGCGAAA

Adh1

Reference

162 16

Three real-time PCR master mixes, SsoFast EvaGreen Supermix (Bio-Rad Laboratories, Inc., Hercules, CA), PrimeScript RT Master Mix (TaKaRa, Dalian, China), and SYBR Green I Real Time PCR Mix (Foregene), were tested. The real-time PCR assay was performed with the iCycler iQ5 Real-Time PCR Detection System (Bio-Rad). The PCR reactions

were carried out with a final concentration of 1× Real-time PCR master mix, 0.4 μM of each gene specific primer, 5 μL of crude DNA extract, and double distilled water to a total volume of 20 μL. PCR conditions were as follows: initial denaturation of DNA for 5 min at 95°C followed by 40 cycles of denaturation for 20 s at 95°C, annealing for 10 s at 60°C, and extension for 20 s at 72°C. Melting curve analyses were carried out between 65 and 95°C with a plate read every 0.5°C and a dwell time of 10 s. The threshold values of amplification plots and the melting peaks of PCR amplicons were determined automatically by the Bio-Rad iQ5 Optical System Software (2.1 Standard Edition). All PCR reactions were run in triplicate and each experiment was performed using at least three individual seeds. One amplicon of each gene was randomly selected and verified by agarose gel electrophoresis. These PCR amplicons were then sequenced by Invitrogen (Shanghai, China) and

Figure  1.  Validation of real-time PCR master mixes for seed direct real-time PCR. Three mixes from different suppliers were used to amplify maize chloroplast gene tRNA-Leu. (A) The crude DNA prepared by a plant direct PCR kit was detected successfully by the Foregene mix, but not the other two mixes. (B) The TaKaRa and Bio-Rad mixes detected the purified DNA as effectively as the Foregene mix. NTC = no template control. One representative plot of three replicates in a single experiment was shown, and the experiments were performed three times with three individual seeds.

Figure  2.  Seed direct real-time PCR is applicable to various crop plants. Crude DNA extracts prepared from 10 mg pieces of seeds were used to amplify tRNA-Leu, a highly conserved gene in plants, with same primer pair. (A) All six plants DNA were detected effectively. (B) The amplicons were detected by distinct peaks in the melting curve. NTC = no template control. One representative plot of three replicates in a single experiment was shown, and the experiments were performed three times with three individual seeds.

were soaked in 50 μL Buffer SP1 in the Plant Seed Direct PCR Kit and boiled at 95°C for 10 min. Then, an equal volume of Buffer SP2 in the kit was added and mixed by pipetting. After a brief centrifugation, the crude DNA extracts were used as PCR templates directly. Maize DNA was purified from 10 mg ground seeds using Plant DNA Isolation Kit (Foregene) according to the manufacturer’s instructions. Real-Time PCR

Lan et al.: Journal of AOAC International Vol. 98, No. 1, 2015  3

Figure  3.  Single-copy genes were detected using crude seed DNA extracts. (A) Single-copy genes of five crops were detected using crude seed DNA extracts prepared from 2 mg pieces of seeds. (B) The amplicons were detected by distinct peaks in the melting curve. NTC = no template control. One representative plot of three replicates in a single experiment was shown, and the experiments were performed three times with three individual seeds.

confirmed by the Basic Local Alignment Search Tool (BLAST) against the National Center for Biotechnology Information (NCBI) reference genomic sequences database of corresponding plants using the BLASTN program. Results and Discussion Three real-time PCR master mixes from different suppliers were tested with crude seed DNA extract prepared using the Plant Seed Direct PCR Kit (Foregene) from 10 mg pieces of maize seed. tRNA-Leu, a highly conserved chloroplast gene among plants, was detected successfully by the Foregene mix (Figure 1A). Unfortunately, reactions using the other two mixes failed to generate typical amplification plots above the background fluorescent signals. To explore the reason for their failure, purified maize DNA was used as template, and the

buffers in the direct PCR kit (equal volume of SP1 and SP2) were also added in the reactions. As shown in Figure 1B, these two mixes detected the purified DNA as effectively as the Foregene mix. These results indicated that the failure of these two mixes was mainly caused by inhibitors released from the maize seeds when crude DNA extract was used as a template, and the Foregene mix was more resistant to these seed-derived PCR inhibitors. To investigate whether the Foregene mix is applicable to other crop plants, crude DNA extract was prepared from 10 mg seed pieces of another five crop plants by the direct PCR kit and were used to amplify tRNA-Leu with the same primer pair. All tRNA-Leu genes were amplified successfully (Figure 2A), and the amplicons were detected by distinct peaks in the melting curve directly (Figure 2B). To determine its ability to detect single-copy genes, crude DNA extracts prepared from 10 to 1 mg pieces of maize seed were used to amplify a single-copy nuclear gene Adh1. Crude DNA extract prepared from as little as 1 mg pieces of seed was detected. However, seed samples less than 2 mg are not easily handled and are difficult for accurate weighing. Therefore, four other crop DNA extracts were prepared from 2 mg pieces of seeds and used to amplify their single-copy genes. As shown in Figure 3, all five single-copy genes were detected. One amplicon of each gene was randomly selected, sequenced, and confirmed by BLAST against NCBI databases. To assess the repeatability, 20 individual seeds of these five crops were used to detect their single-copy genes. All individual seeds DNA were detected and the threshold cycles (Ct), means, and SDs are shown in Table 2. To assess the PCR efficiencies, crude DNA extracts prepared from 10 mg pieces of seeds were serially diluted twofold in the kit buffers, and standard curves of all 11 genes were established using Foregene mix. The PCR efficiencies and correlation 2 coefficients (R ) were calculated and are listed in Table 2. The PCR efficiencies varied greatly from 53 to 215%, which suggested the presence of different types and concentrations of inhibitors. An efficiency 110%. As in the case of cotton seeds which contain polyphenolic compounds that bind to and denature Taq DNA polymerase (17), the Ct value of the undiluted DNA extract for tRNA-Leu gene was even higher than that of fourfold diluted extract, and the PCR efficiency was 215% (Figure  4). After exclusion of the undiluted crude DNA extract from the standard curve, the PCR efficiency was improved to 123% because the inhibitors were diluted below their inhibitory effect (18, 19). Because of the presence of PCR inhibitors, this method is more suitable for qualitative assays, and the amount of crude DNA extract used for PCR reaction should be titrated prior to large-scale analysis. Conclusions In order to facilitate rapid genotypic screening of crop seed, we demonstrated a seed direct real-time PCR method which allows detection of a single-copy gene from crude seed DNA extract directly without extensive DNA purification. In addition, the amplicons could be detected by melting curve analysis after amplification instead of gel electrophoresis analysis. Therefore, the time required for seed genotyping was greatly reduced. This method is applicable to various crop seeds without modifications and single-copy genes could be detected by using as little as 2 mg pieces of seed. These results indicate that this method could provide a rapid and convenient tool for seed genotypic screening in crop plants. Acknowledgments The authors thank Yucheng Tong, Sichuan Agricultural University, Ya’an, People’s Republic of China, for providing seeds and technical support.

  (1) Gao, S., Martinez, C., Skinner, D.J., Krivanek, A.F., Crouch, J.H., & Xu, Y. (2008) Mol. Breed. 22, 477–494. http://dx.doi. org/10.1007/s11032-008-9192-4   (2) Akiyama, H., Sakata, K., Kondo, K., Tanaka, A., Liu, M.S., Oguchi, T., Furui, S., Kitta, K., Hino, A., & Teshima, R. (2008) J. Agric. Food Chem. 56, 1977–1983. http://dx.doi.org/10.1021/ jf0727239   (3) Porebski, S., Bailey, L.G., & Baum, B.R. (1997) Plant Mol. Biol. Rep. 15, 8–15. http://dx.doi.org/10.1007/BF02772108   (4) Kim, C.S., Lee, C.H., Shin, J.S., Chung, Y.S., & Hyung, N.I. (1997) Nucleic Acids Res. 25, 1085–1086. http://dx.doi. org/10.1093/nar/25.5.1085   (5) Chunwongse, J., Martin, G.B., & Tanksley, S.D. (1993) Theor. Appl. Genet. 86, 694–698. http://dx.doi.org/10.1007/ BF00222658   (6) Kang, H.W., Cho, Y.G., Yoon, U.H., & Eun, M.Y. (1998) Plant Mol. Biol. Rep. 16, 90. http://dx.doi. org/10.1023/A:1007418606098   (7) Corbisier, P., Broothaerts, W., Gioria, S., Schimmel, H., Burns, M., Baoutina, A., Emslie, K.R., Furui, S., Kurosawa, Y., Holden, M.J., Kim, H.H., Lee, Y.M., Kawaharasaki, M., Sin, D., & Wang, J. (2007) J. Agric. Food Chem. 55, 3249–3257. http:// dx.doi.org/10.1021/jf062931l   (8) Hwang, H., Bae, S.C., Lee, S., Lee, Y.H., & Chang, A. (2013) Plant Breed. Biotechnol. 1, 290–297. http://dx.doi.org/10.9787/ PBB.2013.1.3.290   (9) Chum, P.Y., Haimes, J.D., Andre, C.P., Kuusisto, P.K., & Kelley, M.L. (2012) J. Vis. Exp. 67, e3844 (10) Bellstedt, D.U., Pirie, M.D., Visser, J.C., de Villiers, M.J., & Gehrke, B. (2010) Am. J. Bot. 97, e65–68 (11) Taberlet, P., Gielly, L., Pautou, G., & Bouvet, J. (1991) Plant Mol. Biol. 17, 1105–1109. http://dx.doi.org/10.1007/ BF00037152 (12) Iida, M., Yamashiro, S., Yamakawa, H., Hayakawa, K., Kuribara, H., Kodama, T., Furui, S., Akiyama, H., Maitani, T., & Hino, A. (2005) J. Agric. Food Chem. 53, 6294–6300. http:// dx.doi.org/10.1021/jf0505731 (13) Hernandez, M., Duplan, M.N., Berthier, G., Vaitilingom, M., Hauser, W., Freyer, R., Pla, M., & Bertheau, Y. (2004) J. Agric. Food Chem. 52, 4632–4637. http://dx.doi.org/10.1021/ jf049789d (14) Sheng, L., Wen, W., Zhao, X., Cui, J., & Zhu, S. (2007) Chin. J. Oil Crop Sci. 29, 253–256 (15) Ding, J., Jia, J., Yang, L., Wen, H., Zhang, C., Liu, W., & Zhang, D. (2004) J. Agric. Food Chem. 52, 3372–3377. http://dx.doi. org/10.1021/jf049915d (16) Ao, J., Li, Q., Gao, X., Yu, Y., Li, L., & Zhang, M. (2011) Food Control 22, 1617–1623. http://dx.doi.org/10.1016/j. foodcont.2011.03.018 (17) Wilson, I.G. (1997) Appl. Environ. Microbiol. 63, 3741–3751 (18) Ramakers, C., Ruijter, J.M., Deprez, R.H., & Moorman, A.F. (2003) Neurosci. Lett. 339, 62–66. http://dx.doi.org/10.1016/ S0304-3940(02)01423-4 (19) Liu, W., & Saint, D.A. (2002) Anal. Biochem. 302, 52–59. http://dx.doi.org/10.1006/abio.2001.5530

Copyright of Journal of AOAC International is the property of AOAC International and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.