mycoses
Diagnosis,Therapy and Prophylaxis of Fungal Diseases
Original article
Cryptococcus gattii VGII in a Plathymenia reticulata hollow in Cuiab a, Mato Grosso, Brazil rcia dos Santos Laze ra,2 Bodo Wanke,2 Luciana Trilles,2 Vale ria Dutra,3 Mariana Caselli Anzai,1 Ma 3 3 1 Daphine Ariadne Jesus de Paula, Luciano Nakazato, Doracilde Terumi Takahara, Walquirya Borges Simi1 and Rosane Christine Hahn1 1 Laboratorio de Micologia, Faculdade de Cie^ncias Medicas, Universidade Federal de Mato Grosso, Cuiaba, MT, Brazil, 2Laboratorio de Micologia, Instituto de Pesquisa Clınica Evandro Chagas – Fiocruz, Rio de Janeiro, RJ, Brazil and 3Laboratorio de Biologia Molecular Veterinaria, Faculdade de Agronomia e Medicina Veterinaria, Universidade Federal de Mato Grosso, Cuiaba, MT, Brazil
Summary
Little is known about the ecology of agents of cryptococcosis in Mato Grosso, without any data regarding to the sources of both agents in the environment. This study aimed to investigate Cryptococcus gattii and Cryptococcus neoformans associated with decay in tree hollows within the urban area of three different cities of Mato Grosso. Seventy-two environmental samples collected from 72 living trees in the cities of Cuiab a, V arzea Grande and Chapada dos Guimar~ aes were sampled and analysed. One tree (Plathymenia reticulata, Leguminosae) in the city of Cuiab a yielded 19 colonies identified as C. gattii molecular type VGII. The isolation of C. gattii VGII in the downtown city of Cuiab a is important because it fits in the Northern Macroregion, suggesting expanding and urbanisation of this genotype in different Brazilian cities.
Key words: C. gattii, VGII, P. reticulata, tree hollow, Cryptococcus sp., Brazil.
Introduction Cryptococcus neoformans and C. gattii may cause severe systemic infection and have been isolated from numerous environmental sources. While C. neoformans causes predominantly opportunistic disease, C. gattii occurs mainly in non-immunocompromised individuals. Both species are acquired through inhalation of viable spores and manifest mostly in the lungs and central nervous system, resulting in severe meningitis.1–3 For many years, C. neoformans has been repeatedly isolated from pigeon habitats in urban areas, while the rio de Micologia - Faculdade Correspondence: R. C. Hahn, PhD, Laborato de Ci^encias Medicas (FM), Universidade Federal de Mato Grosso – UFMT Av. Fernando Corr^ea da Costa, nº 2367, Bairro Boa Esperancßa, Cuiab a 78060-900, MT, Brazil. Tel./Fax: +55 (65) 3615-8809. E-mail: [email protected] Submitted for publication 10 October 2013 Revised 17 January 2014 Accepted for publication 20 January 2014
doi:10.1111/myc.12177
environmental source of C. gattii remained unknown. After the first isolation of C. gattii from Eucalyptus camaldulensis debris by Ellis and Pfeiffer [4] it was believed that its natural habitat is quite distinct from that of C. neoformans. However, after the outbreak by C. gattii (AFLP6/VGII) on Vancouver Island, Canada,5 this assumption had to be revised. In fact, at this outbreak, C. gattii has been isolated from samples of different tree species, soil, air and even from water.3,5,6 This outbreak was unique and this region is still considered endemic for C. gattii.7 In 2010, Springer and Chaturvedi [3] mapped the worldwide presence of C. gattii and verified that it has been isolated on all continents, in both tropical/subtropical and temperate regions. In Brazil, C. gattii and C. neoformans have been isolated on south, southeast, north and northeast regions from several different tree hollows, without preference for any plant species, even cohabiting a single tree hollow.8–11 However, in the central-western region, only the study by Souza et al. [12] report on the isolation of C. neoformans from eucalyptus trees in the city of Goi^ ania. Moreover, C. gattii has not yet been isolated from environmental sources in this region,
© 2014 Blackwell Verlag GmbH Mycoses, 2014, 57, 414–418
C. gattii VGII in P. reticulata Brazil
although cryptococosis by C. gattii have been previously reported in the states of Goi as, Mato Grosso and Mato Grosso do Sul, mostly in immunocompetent individuals, but also in HIV-infected patients.13–15 In the present study urban sources of C. neoformans and C. gattii associated with decay in tree hollows were investigated in Cuiab a, V arzea Grande and Chapada dos Guimar~ aes in the State of Mato Grosso (Fig. 1).
Materials and methods Between June 2009 and January 2011, 72 samples were obtained from 72 trees by scraping the inner decaying wood of their trunk hollows. Each hollow was sampled once. For homogenisation, 1 g of each sample was suspended in 50 ml of sterile physiological saline with 0.4 g l1 of chloramphenicol, shaken for 5 min and allowed to settle for 30 min. The supernatant was
aspirated and inoculated onto Niger Seed Agar (NSA) medium, 0.1 ml per plate, 10 plates per sample, incubated at room temperature and observed for 5 days.13 Brown colonies on NSA medium were identified by their thermotolerance at 37 °C, cycloheximide sensitivity and urease production. Canavanine–glycine–bromothymol blue medium (CGB) was used to identify the species of the isolates. For genomic DNA extraction, a glass beads protocol described previously by Del Poeta et al. [16] modified by Casali et al. [17] was used. Briefly, inoculum of strains was suspended in 0.5 ml TENTS (10 mmol l1 Tris, pH 7.5, 1 mmol l1 EDTA pH 8.0, 200 mmol l1 NaCl, 2% Triton, 1% SDS) containing glass beads and 0.5 ml of phenol:chloroform. The samples were vortexed and centrifuged for 10 min at 13 000 g. The aqueous phase was transferred to a new tube, precipitated with 20 ll of NaCl (5 mol l1) and 1 volume of 100% ethanol. The precipitated DNA was washed with 70% ethanol, and after dried resuspended in 100 ll of ultrapure water and stored at 20 °C until further processing for PCR. CGB-positive isolates were confirmed by using specific primers for C. gattii CNB 49A (50 -ATTGCGTCCATCCAACCGTTATC-30 ); CNB 49S (50 ATTGCGTCCAAGTGTTGTTG-30 ) resulting in amplification products of 448 pb.18,19 The molecular types were determined by restriction fragment length polymorphism (RFLP) analysis after amplification of the URA5 gene according to Meyer et al. [20] using the primers URA5 (50 -ATGT CCTCCCAAGCCCTCGACTCCG -30 ) and SJ01 (50 -TT AAGACCTCTGAACACCGTACTC -30 ). The molecular type of each isolate was assigned by comparison with the following reference strains: WM 148 (serotype A, AFLP1/VNI), WM 626 (serotype A, AFLP1A/VNII), WM 628 (serotype AD, AFLP2/VNIII), WM 629 (serotype D, AFLP3/VNIV), WM 179 (serotype B, AFLP4/ VGI), WM 178 (serotype B, AFLP6/VGII), WM 161 (serotype B, AFLP5/VGIII) and WM 779 (serotype C, AFLP7/VGIV).
Results
0
237,5
475
Kilometers
Figure 1 Map of the State of Mato Grosso, Brazil. The cities
where the tree hollows were sampled are highlighted: Chapada dos Guimar~ aes (red), Cuiab a (green) and V arzea Grande (blue).
© 2014 Blackwell Verlag GmbH Mycoses, 2014, 57, 414–418
The total number of samples collected was of 72, distributed by three cities, evaluated as follows: Chapada dos Guimar~ aes (n = 6), Cuiab a (n = 57) and V arzea Grande (n = 9), as shown in Table 1. One of four trees identified as Plathymenia reticulata (Leguminosae) was positive, located in the central region of Cuiab a, yielded 19 phenol-oxidase positive colonies (Fig. 2 and Fig. 3). All isolates were phenotypically identified as C. gattii, confirmed by PCR and,
415
M. C. Anzai et al.
Table 1 Tree species sampled by city.
Cities
Tree species
Number of samples collected
Number of positive samples
Chapada dos Guimar~ aes
Persea americana (Lauraceae) Pinus sp. (Pinaceae) Syzygium jambolanum (Myrtaceae) Tabebuia aurea (Bignoniaceae) Tabebuia sp. (Bignoniaceae) Anadenanthera colubrina (Leguminosae) Andira inermis (Leguminosae) Bahuinia sp. (Leguminosae) Cassia ferruginea (Leguminosae) Delonix regia (Leguminosae) Dipteryx alata (Leguminosae) Erythrina fusca (Leguminosae) Ficus benjamina (Moraceae) Ficus sp. (Moraceae) Guazuma ulmifolia (Sterculiaceae) Jacaranda cuspidifolia (Bignoniaceae) Licania tomentosa (Chrysobalanaceae) Mangifera indica (Anacardiaceae) Myracrodruon urundeva (Anacardiaceae) Psidium guajava (Myrtaceae) Plathymenia reticulata (Leguminoseae) Tabebuia ochracea (Bignoniaceae) Tabebuia sp. (Bignoniaceae) Cassia sp. (Leguminosae) Chorisia speciosa (Bombacaceae) Delonix regia (Leguminosae) Ficus sp. (Moraceae) Genipa americana (Rubiaceae) Mangifera indica (Anacardiaceae) Plathymenia reticulata (Leguminosae) Vitex cymosa (Lamiaceae) 26
1 1 1 1 2 4 1 2 3 2 1 1 3 5 3 3 7 5 1 4 4 3 5 1 1 1 1 1 2 1 1 72
– – – – – – – – – – – – – – – – – – – – 1 – – – – – – – – – – 1
Cuiab a
V arzea Grande
Total
the genotyping by URA5-RFLP identified all of them as the same VGII strain. The C. gatii VGII strains isolated were stored at the pathogenic fungi collection of IPEC/FIOCRUZ, under the numbers 477–494, as all the colonies proved to be from the same strain.
Discussion This finding is similar to that reported by Baltazar and Ribeiro [21] in the State of Espırito Santo, who reported two samples positive for C. gattii and another two for C. neoformans among 95 samples collected. However, these authors emphasised that C. gattii was isolated only from trees living in an environment with little human activity in a remnant of the Atlantic Forest, quite different from our finding in a tree located in an area with high anthropogenic activity. Besides, C. gattii serotype B, VGII was previously isolated from a Guettarda acreana tree in a wild island in the State of
416
Roraima, disclosing that the Amazon Rain Forest may harbour sources of this agent.22,23 All these findings reinforce that genotype VGII is able to adapt from wild habitats to urban places, as the isolate from P. reticulata (Leguminosae) in Cuiab a. Escand on et al. [24] in Colombia, observed that rainy, humid months with less sunlight hours and warm temperatures favoured the isolation of C. gattii serotype B. Although our study did not include a climatic analysis, it is worth to highlight that our positive sample was collected in June, a month with milder temperatures in the Brazilian central-west region. In Argentina, 489 samples collected in seven parks of Buenos Aires allowed the isolation of C. neoformans serotype A VNI from Eucalyptus spp., Phoenix sp. and Tipuana tipu and C. gattii serotype B VGI from Acacia visca, Cedrus deodar, Cupressus sempervirens, Eucalyptus spp., Tipuana tipu and Ulmus campestrus.25 The state of Mato Grosso has a typically continental climate, with two well-defined seasons, wet and dry.
© 2014 Blackwell Verlag GmbH Mycoses, 2014, 57, 414–418
C. gattii VGII in P. reticulata Brazil
Figure 2 Positive Plathymenia reticulata (Leguminosae) showing
a hollow on its trunk, in the city of Cuiab a-MT, Brazil.
Figure 3 Detail of the positive hollow in Plathymenia reticulata
(Leguminosae), in the city of Cuiab a-MT, Brazil.
The rainy season lasts from October to March and the dry season lasts from April to September. The mean annual temperature in the far north is 26 °C and in the far south it is 22 °C. The three cities studied occupy areas belonging to the Brazilian cerrado
© 2014 Blackwell Verlag GmbH Mycoses, 2014, 57, 414–418
(savannah), consisting of open woodlands, thick, short, contorted trees (8–12 m) and predominance of a, a trees of the legume family.26 In the city of Cuiab large number of trees native to the Cerrado can be observed, including P. reticulata, from which C. gattii VGII strains were isolated. Besides, a large number of several introduced, non-native species analysed were negative (Bahuinia sp., Licania tomentosa and Mangifera indica). In north-east Brazil, Lazera et al. [8] also isolated this genotype from a Licania tomentosa located downtown in the city of Teresina (PI), capital of the state of Piauı. Our result also reinforces that the colonisation of tree species by C. gattii might be distinct according to the analysed area, thus suggesting different regional patterns and steps of adaptation.8–11 Along the present study it was observed that the majority of the trees in the surveyed areas were young and in good health conditions, without holes in their trunks, what might have interfered in obtaining a greater quantity of samples exhibiting parameters consistent with those previously established for collection. According to Hussey [27] only older trees present hollows in their trunk. Considering the heterogeneity of the biomes (Amazon, Cerrado and Pantanal) in Mato Grosso, it is important to emphasise that this study evaluated sites associated with the Brazilian Cerrado. In the city of Belem, state of Para, Amazonia, Costa et al. [28] analysed seven samples from hollows of living trees and isolated C. gattii VGII and C. neoformans VNI from Senna siamea. It should be highlighted that the genotype C. gattii VGII is not unique to the Vancouver outbreak, it is also endemic in Northern Brazil, encompassing the Amazon rainforest (N region) and the semiarid area (NE region). In fact, genotype VGII is well adapted to the environment, associated with decaying wood in trees in both regions, behaving as a primary pathogen of human meningoencephalitis in native, normal hosts, attaining a prevalence of 20–30% in children and adolescents.29,30 The isolation of C. gattii genotype VGII from P. reticulata in an endemic tree of cerrado is groundbreaking, as it is the first environmental isolation in the state of Mato Grosso, and the first VGII isolation from centralwestern region of Brazil. It is also important because it fits in the Northern Brazilian region, as stated by Trilles et al.,29 suggesting expanding and urbanisation of this genotype in different Brazilian cities.
Acknowledgments This work was supported by CAPES and FAPEMAT.
417
M. C. Anzai et al.
References 1 2 3 4 5
6
7
8
9
10
11
12
13
14
15
16
418
Barnett JA. A history or research on yeasts 14: 1 medical yeasts part 2, Cryptococcus neoformans. Yeast 2010; 27: 875–904. Lin X, Heitman J. The biology of the Cryptococcus neoformans species complex. Annu Rev Microbiol 2006; 60: 69–105. Springer DJ, Chaturvedi V. Projecting global occurrence of Cryptococcus gattii. Emerg Infect Dis 2010; 16: 14–20. Ellis DH, Pfeiffer TJ. Natural habitat of Cryptococcus neoformans var. gattii. J Clin Microbiol 1990; 28: 1642–4. Galanis E, Macdougall L. Epidemiology of Cryptococcus gattii, British Columbia, Canada, 1999–2007. Emerg Infect Dis 2010; 16: 251–7. Kidd SE, Hagen F, Tscharke RL et al. A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Columbia, Canada). PNAS 2004; 101: 17258–63. Datta K, Bartlett KH, Baer R et al. Spread of Cryptococcus gattii into Pacific Northwest region of the United States. Emerg Infect Dis 2009; 15: 1185–91. Lazera MS, Cavalcanti MAS, Trilles L, Nishikawa MM, Wanke B. Cryptococcus neoformans var. gattii – evidence for a natural habitat related to decaying wood in a pottery tree hollow. Med Mycol 1998; 36: 119–22. Lazera MS, Pires FD, Camillo-Coura L et al. Natural habitat of Cryptococcus neoformans var. neoformans in decaying wood forming hollows in living trees. J Med Vet Mycol 1996; 34: 127–31. Lazera MS, Cavalcanti MAS, Londero AT, Trilles L, Nishikawa MM, Wanke B. Possible primary ecological niche of Cryptococcus neoformans. Med Mycol 2000; 38: 379–83. Lazera MS, Wanke B, Nishikawa MM. Isolation of both varieties of Cryptococcus neoformans from saprophytic sources in the city of Rio de Janeiro, Brazil. J Med Vet Mycol 1993; 31: 449–54. Souza LK, Souza Junior AH, Costa CR et al. Molecular typing and antifungal susceptibility of clinical and environmental Cryptococcus neoformans species complex isolates in Goiania, Brazil. Mycoses 2009; 53: 62–67. Fernandes OFL, Costa TR, Costa MR, Soares AJ, Pereira AJSC, Silva MRR. Cryptococcus neoformans isolados de pacientes com AIDS. Rev Soc Bras Med Trop 2000; 33: 75–78. Lindenberg ASC, Chang MR, Paniago AMM et al. Clinical and epidemiological features of 123 cases of cryptococcosis in Mato Grosso do Sul, Brazil. Rev Inst Med Trop Sao Paulo 2008; 50: 75–78. Ribeiro LC, Hahn RC, Favalessa OC, Tadano T, Fontes CJF. Micoses bito em pacientes com infeccßa ~o sist^emicas: fatores associados ao o pelo vırus da imunodefici^encia humana, Cuiab a, Estado de Mato Grosso, 2005–2008. Rev Soc Bras Med Trop 2009; 42: 698–705. Del Poeta MD, Toffaletti DL, Rude TH, Dykstra CC, Heitman J, Perfect JR. Topoisomerase I is essential in Cryptococcus neoformans: role in
17
18
19
20
21
22
23
24
25
26 27 28
29
30
pathobiology and as an antifungal target. Genetics 1999; 152: 167– 78. Casali AK, Goulart L, Rosa e Silva LK et al. Molecular typing of clinical and environmental Cryptococcus neoformans isolates in the Brazilian state Rio Grande do Sul. FEMS Yeast Res 2003; 3: 405–15. Aoki FH, Imai T, Tanaka R et al. New PCR primer pairs specific for Cryptococcus neoformans serotype A or B prepared on the basis of random amplified polymorphic DNA fingerprint pattern analyses. J Clin Microbiol 1999; 37: 315–20. Horta JA, Staats CC, Casali AK et al. Epidemiological aspects of clinical and environmental Cryptococcus neoformans isolates in the Brazilian state Rio Grande do Sul. Med Mycol 2002; 40: 1–7. Meyer W, Marszewska K, Amirmostofian M et al. Molecular typing of global isolates of Cryptococcus neoformans var. neoformans by PCR-fingerprinting and RAPD. A pilot study to standardize techniques on which to base a detailed epidemiological survey. Electrophoresis 1999; 20: 1790–9. Baltazar LM, Ribeiro MA. Primeiro isolamento ambiental de Cryptococcus gattii no estado do Espırito Santos. Rev Soc Bras Med Trop 2008; 41: 449–53. Fortes ST, Lazera MS, Nishikawa MM, Macedo RCL, Wanke B. First isolation of Cryptococcus neoformans var. gattii from a native jungle tree in the Brazilian Amazon rainforest. Mycoses 2001; 44: 137–40. Hagen F, Ceresini PC, Polacheck I et al. Ancient dispersal of the human fungal pathogen Cryptococcus gattii from the Amazon rainforest. PLoS ONE 2013; 8: 1–14. Escandon P, Granados E. Influence of climatic conditions on the isolation of members of the Cryptococcus neoformans species complex from trees in Colombia from 1992–2004. FEMS Yeast Res 2006; 6: 636–44. Refojo N, Perrotta D, Brudny R, Abrantes R, Hevia AI, Davel G. Isolation of Cryptococcus neoformans and Cryptococcus gattii from trunk hollows of living trees in Buenos Aires city, Argentina. Med Mycol 2009; 47: 177–84. Grosso M. Secretaria de Estado de Planejamento e Coordenacß~ao Geral. Cuiab a: Mato Grosso em n umeros, 2006. Hussey P. Tree hollows and wildlife. Information notes for the land for wildlife scheme in western Australia. Wildlife Notes 2005; 15: 1–2. Costa SPSE, Lazera MS, Santos WRA et al. First isolation of Cryptococcus gattii molecular type VGII and Cryptococcus neoformans molecular type VNI from environmental sources in the city of Belem, Par a, Brazil. Mem Inst Oswaldo Cruz 2009; 104: 662–4. Trilles L, Lazera MS, Wanke B et al. Regional pattern of the molecular types of Cryptococcus neoformans and Cryptococcus gattii in Brazil. Mem Inst Oswaldo Cruz 2008; 103: 455–62. Santos WR, Meyer W, Wanke B et al. Primary endemic Cryptococcosis gattii by molecular type VGII in the state of Par a, Brazil. Mem Inst Oswaldo Cruz 2008; 103: 813–8.
© 2014 Blackwell Verlag GmbH Mycoses, 2014, 57, 414–418
Diagnosis,Therapy and Prophylaxis of Fungal Diseases
Original article
Cryptococcus gattii VGII in a Plathymenia reticulata hollow in Cuiab a, Mato Grosso, Brazil rcia dos Santos Laze ra,2 Bodo Wanke,2 Luciana Trilles,2 Vale ria Dutra,3 Mariana Caselli Anzai,1 Ma 3 3 1 Daphine Ariadne Jesus de Paula, Luciano Nakazato, Doracilde Terumi Takahara, Walquirya Borges Simi1 and Rosane Christine Hahn1 1 Laboratorio de Micologia, Faculdade de Cie^ncias Medicas, Universidade Federal de Mato Grosso, Cuiaba, MT, Brazil, 2Laboratorio de Micologia, Instituto de Pesquisa Clınica Evandro Chagas – Fiocruz, Rio de Janeiro, RJ, Brazil and 3Laboratorio de Biologia Molecular Veterinaria, Faculdade de Agronomia e Medicina Veterinaria, Universidade Federal de Mato Grosso, Cuiaba, MT, Brazil
Summary
Little is known about the ecology of agents of cryptococcosis in Mato Grosso, without any data regarding to the sources of both agents in the environment. This study aimed to investigate Cryptococcus gattii and Cryptococcus neoformans associated with decay in tree hollows within the urban area of three different cities of Mato Grosso. Seventy-two environmental samples collected from 72 living trees in the cities of Cuiab a, V arzea Grande and Chapada dos Guimar~ aes were sampled and analysed. One tree (Plathymenia reticulata, Leguminosae) in the city of Cuiab a yielded 19 colonies identified as C. gattii molecular type VGII. The isolation of C. gattii VGII in the downtown city of Cuiab a is important because it fits in the Northern Macroregion, suggesting expanding and urbanisation of this genotype in different Brazilian cities.
Key words: C. gattii, VGII, P. reticulata, tree hollow, Cryptococcus sp., Brazil.
Introduction Cryptococcus neoformans and C. gattii may cause severe systemic infection and have been isolated from numerous environmental sources. While C. neoformans causes predominantly opportunistic disease, C. gattii occurs mainly in non-immunocompromised individuals. Both species are acquired through inhalation of viable spores and manifest mostly in the lungs and central nervous system, resulting in severe meningitis.1–3 For many years, C. neoformans has been repeatedly isolated from pigeon habitats in urban areas, while the rio de Micologia - Faculdade Correspondence: R. C. Hahn, PhD, Laborato de Ci^encias Medicas (FM), Universidade Federal de Mato Grosso – UFMT Av. Fernando Corr^ea da Costa, nº 2367, Bairro Boa Esperancßa, Cuiab a 78060-900, MT, Brazil. Tel./Fax: +55 (65) 3615-8809. E-mail: [email protected] Submitted for publication 10 October 2013 Revised 17 January 2014 Accepted for publication 20 January 2014
doi:10.1111/myc.12177
environmental source of C. gattii remained unknown. After the first isolation of C. gattii from Eucalyptus camaldulensis debris by Ellis and Pfeiffer [4] it was believed that its natural habitat is quite distinct from that of C. neoformans. However, after the outbreak by C. gattii (AFLP6/VGII) on Vancouver Island, Canada,5 this assumption had to be revised. In fact, at this outbreak, C. gattii has been isolated from samples of different tree species, soil, air and even from water.3,5,6 This outbreak was unique and this region is still considered endemic for C. gattii.7 In 2010, Springer and Chaturvedi [3] mapped the worldwide presence of C. gattii and verified that it has been isolated on all continents, in both tropical/subtropical and temperate regions. In Brazil, C. gattii and C. neoformans have been isolated on south, southeast, north and northeast regions from several different tree hollows, without preference for any plant species, even cohabiting a single tree hollow.8–11 However, in the central-western region, only the study by Souza et al. [12] report on the isolation of C. neoformans from eucalyptus trees in the city of Goi^ ania. Moreover, C. gattii has not yet been isolated from environmental sources in this region,
© 2014 Blackwell Verlag GmbH Mycoses, 2014, 57, 414–418
C. gattii VGII in P. reticulata Brazil
although cryptococosis by C. gattii have been previously reported in the states of Goi as, Mato Grosso and Mato Grosso do Sul, mostly in immunocompetent individuals, but also in HIV-infected patients.13–15 In the present study urban sources of C. neoformans and C. gattii associated with decay in tree hollows were investigated in Cuiab a, V arzea Grande and Chapada dos Guimar~ aes in the State of Mato Grosso (Fig. 1).
Materials and methods Between June 2009 and January 2011, 72 samples were obtained from 72 trees by scraping the inner decaying wood of their trunk hollows. Each hollow was sampled once. For homogenisation, 1 g of each sample was suspended in 50 ml of sterile physiological saline with 0.4 g l1 of chloramphenicol, shaken for 5 min and allowed to settle for 30 min. The supernatant was
aspirated and inoculated onto Niger Seed Agar (NSA) medium, 0.1 ml per plate, 10 plates per sample, incubated at room temperature and observed for 5 days.13 Brown colonies on NSA medium were identified by their thermotolerance at 37 °C, cycloheximide sensitivity and urease production. Canavanine–glycine–bromothymol blue medium (CGB) was used to identify the species of the isolates. For genomic DNA extraction, a glass beads protocol described previously by Del Poeta et al. [16] modified by Casali et al. [17] was used. Briefly, inoculum of strains was suspended in 0.5 ml TENTS (10 mmol l1 Tris, pH 7.5, 1 mmol l1 EDTA pH 8.0, 200 mmol l1 NaCl, 2% Triton, 1% SDS) containing glass beads and 0.5 ml of phenol:chloroform. The samples were vortexed and centrifuged for 10 min at 13 000 g. The aqueous phase was transferred to a new tube, precipitated with 20 ll of NaCl (5 mol l1) and 1 volume of 100% ethanol. The precipitated DNA was washed with 70% ethanol, and after dried resuspended in 100 ll of ultrapure water and stored at 20 °C until further processing for PCR. CGB-positive isolates were confirmed by using specific primers for C. gattii CNB 49A (50 -ATTGCGTCCATCCAACCGTTATC-30 ); CNB 49S (50 ATTGCGTCCAAGTGTTGTTG-30 ) resulting in amplification products of 448 pb.18,19 The molecular types were determined by restriction fragment length polymorphism (RFLP) analysis after amplification of the URA5 gene according to Meyer et al. [20] using the primers URA5 (50 -ATGT CCTCCCAAGCCCTCGACTCCG -30 ) and SJ01 (50 -TT AAGACCTCTGAACACCGTACTC -30 ). The molecular type of each isolate was assigned by comparison with the following reference strains: WM 148 (serotype A, AFLP1/VNI), WM 626 (serotype A, AFLP1A/VNII), WM 628 (serotype AD, AFLP2/VNIII), WM 629 (serotype D, AFLP3/VNIV), WM 179 (serotype B, AFLP4/ VGI), WM 178 (serotype B, AFLP6/VGII), WM 161 (serotype B, AFLP5/VGIII) and WM 779 (serotype C, AFLP7/VGIV).
Results
0
237,5
475
Kilometers
Figure 1 Map of the State of Mato Grosso, Brazil. The cities
where the tree hollows were sampled are highlighted: Chapada dos Guimar~ aes (red), Cuiab a (green) and V arzea Grande (blue).
© 2014 Blackwell Verlag GmbH Mycoses, 2014, 57, 414–418
The total number of samples collected was of 72, distributed by three cities, evaluated as follows: Chapada dos Guimar~ aes (n = 6), Cuiab a (n = 57) and V arzea Grande (n = 9), as shown in Table 1. One of four trees identified as Plathymenia reticulata (Leguminosae) was positive, located in the central region of Cuiab a, yielded 19 phenol-oxidase positive colonies (Fig. 2 and Fig. 3). All isolates were phenotypically identified as C. gattii, confirmed by PCR and,
415
M. C. Anzai et al.
Table 1 Tree species sampled by city.
Cities
Tree species
Number of samples collected
Number of positive samples
Chapada dos Guimar~ aes
Persea americana (Lauraceae) Pinus sp. (Pinaceae) Syzygium jambolanum (Myrtaceae) Tabebuia aurea (Bignoniaceae) Tabebuia sp. (Bignoniaceae) Anadenanthera colubrina (Leguminosae) Andira inermis (Leguminosae) Bahuinia sp. (Leguminosae) Cassia ferruginea (Leguminosae) Delonix regia (Leguminosae) Dipteryx alata (Leguminosae) Erythrina fusca (Leguminosae) Ficus benjamina (Moraceae) Ficus sp. (Moraceae) Guazuma ulmifolia (Sterculiaceae) Jacaranda cuspidifolia (Bignoniaceae) Licania tomentosa (Chrysobalanaceae) Mangifera indica (Anacardiaceae) Myracrodruon urundeva (Anacardiaceae) Psidium guajava (Myrtaceae) Plathymenia reticulata (Leguminoseae) Tabebuia ochracea (Bignoniaceae) Tabebuia sp. (Bignoniaceae) Cassia sp. (Leguminosae) Chorisia speciosa (Bombacaceae) Delonix regia (Leguminosae) Ficus sp. (Moraceae) Genipa americana (Rubiaceae) Mangifera indica (Anacardiaceae) Plathymenia reticulata (Leguminosae) Vitex cymosa (Lamiaceae) 26
1 1 1 1 2 4 1 2 3 2 1 1 3 5 3 3 7 5 1 4 4 3 5 1 1 1 1 1 2 1 1 72
– – – – – – – – – – – – – – – – – – – – 1 – – – – – – – – – – 1
Cuiab a
V arzea Grande
Total
the genotyping by URA5-RFLP identified all of them as the same VGII strain. The C. gatii VGII strains isolated were stored at the pathogenic fungi collection of IPEC/FIOCRUZ, under the numbers 477–494, as all the colonies proved to be from the same strain.
Discussion This finding is similar to that reported by Baltazar and Ribeiro [21] in the State of Espırito Santo, who reported two samples positive for C. gattii and another two for C. neoformans among 95 samples collected. However, these authors emphasised that C. gattii was isolated only from trees living in an environment with little human activity in a remnant of the Atlantic Forest, quite different from our finding in a tree located in an area with high anthropogenic activity. Besides, C. gattii serotype B, VGII was previously isolated from a Guettarda acreana tree in a wild island in the State of
416
Roraima, disclosing that the Amazon Rain Forest may harbour sources of this agent.22,23 All these findings reinforce that genotype VGII is able to adapt from wild habitats to urban places, as the isolate from P. reticulata (Leguminosae) in Cuiab a. Escand on et al. [24] in Colombia, observed that rainy, humid months with less sunlight hours and warm temperatures favoured the isolation of C. gattii serotype B. Although our study did not include a climatic analysis, it is worth to highlight that our positive sample was collected in June, a month with milder temperatures in the Brazilian central-west region. In Argentina, 489 samples collected in seven parks of Buenos Aires allowed the isolation of C. neoformans serotype A VNI from Eucalyptus spp., Phoenix sp. and Tipuana tipu and C. gattii serotype B VGI from Acacia visca, Cedrus deodar, Cupressus sempervirens, Eucalyptus spp., Tipuana tipu and Ulmus campestrus.25 The state of Mato Grosso has a typically continental climate, with two well-defined seasons, wet and dry.
© 2014 Blackwell Verlag GmbH Mycoses, 2014, 57, 414–418
C. gattii VGII in P. reticulata Brazil
Figure 2 Positive Plathymenia reticulata (Leguminosae) showing
a hollow on its trunk, in the city of Cuiab a-MT, Brazil.
Figure 3 Detail of the positive hollow in Plathymenia reticulata
(Leguminosae), in the city of Cuiab a-MT, Brazil.
The rainy season lasts from October to March and the dry season lasts from April to September. The mean annual temperature in the far north is 26 °C and in the far south it is 22 °C. The three cities studied occupy areas belonging to the Brazilian cerrado
© 2014 Blackwell Verlag GmbH Mycoses, 2014, 57, 414–418
(savannah), consisting of open woodlands, thick, short, contorted trees (8–12 m) and predominance of a, a trees of the legume family.26 In the city of Cuiab large number of trees native to the Cerrado can be observed, including P. reticulata, from which C. gattii VGII strains were isolated. Besides, a large number of several introduced, non-native species analysed were negative (Bahuinia sp., Licania tomentosa and Mangifera indica). In north-east Brazil, Lazera et al. [8] also isolated this genotype from a Licania tomentosa located downtown in the city of Teresina (PI), capital of the state of Piauı. Our result also reinforces that the colonisation of tree species by C. gattii might be distinct according to the analysed area, thus suggesting different regional patterns and steps of adaptation.8–11 Along the present study it was observed that the majority of the trees in the surveyed areas were young and in good health conditions, without holes in their trunks, what might have interfered in obtaining a greater quantity of samples exhibiting parameters consistent with those previously established for collection. According to Hussey [27] only older trees present hollows in their trunk. Considering the heterogeneity of the biomes (Amazon, Cerrado and Pantanal) in Mato Grosso, it is important to emphasise that this study evaluated sites associated with the Brazilian Cerrado. In the city of Belem, state of Para, Amazonia, Costa et al. [28] analysed seven samples from hollows of living trees and isolated C. gattii VGII and C. neoformans VNI from Senna siamea. It should be highlighted that the genotype C. gattii VGII is not unique to the Vancouver outbreak, it is also endemic in Northern Brazil, encompassing the Amazon rainforest (N region) and the semiarid area (NE region). In fact, genotype VGII is well adapted to the environment, associated with decaying wood in trees in both regions, behaving as a primary pathogen of human meningoencephalitis in native, normal hosts, attaining a prevalence of 20–30% in children and adolescents.29,30 The isolation of C. gattii genotype VGII from P. reticulata in an endemic tree of cerrado is groundbreaking, as it is the first environmental isolation in the state of Mato Grosso, and the first VGII isolation from centralwestern region of Brazil. It is also important because it fits in the Northern Brazilian region, as stated by Trilles et al.,29 suggesting expanding and urbanisation of this genotype in different Brazilian cities.
Acknowledgments This work was supported by CAPES and FAPEMAT.
417
M. C. Anzai et al.
References 1 2 3 4 5
6
7
8
9
10
11
12
13
14
15
16
418
Barnett JA. A history or research on yeasts 14: 1 medical yeasts part 2, Cryptococcus neoformans. Yeast 2010; 27: 875–904. Lin X, Heitman J. The biology of the Cryptococcus neoformans species complex. Annu Rev Microbiol 2006; 60: 69–105. Springer DJ, Chaturvedi V. Projecting global occurrence of Cryptococcus gattii. Emerg Infect Dis 2010; 16: 14–20. Ellis DH, Pfeiffer TJ. Natural habitat of Cryptococcus neoformans var. gattii. J Clin Microbiol 1990; 28: 1642–4. Galanis E, Macdougall L. Epidemiology of Cryptococcus gattii, British Columbia, Canada, 1999–2007. Emerg Infect Dis 2010; 16: 251–7. Kidd SE, Hagen F, Tscharke RL et al. A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Columbia, Canada). PNAS 2004; 101: 17258–63. Datta K, Bartlett KH, Baer R et al. Spread of Cryptococcus gattii into Pacific Northwest region of the United States. Emerg Infect Dis 2009; 15: 1185–91. Lazera MS, Cavalcanti MAS, Trilles L, Nishikawa MM, Wanke B. Cryptococcus neoformans var. gattii – evidence for a natural habitat related to decaying wood in a pottery tree hollow. Med Mycol 1998; 36: 119–22. Lazera MS, Pires FD, Camillo-Coura L et al. Natural habitat of Cryptococcus neoformans var. neoformans in decaying wood forming hollows in living trees. J Med Vet Mycol 1996; 34: 127–31. Lazera MS, Cavalcanti MAS, Londero AT, Trilles L, Nishikawa MM, Wanke B. Possible primary ecological niche of Cryptococcus neoformans. Med Mycol 2000; 38: 379–83. Lazera MS, Wanke B, Nishikawa MM. Isolation of both varieties of Cryptococcus neoformans from saprophytic sources in the city of Rio de Janeiro, Brazil. J Med Vet Mycol 1993; 31: 449–54. Souza LK, Souza Junior AH, Costa CR et al. Molecular typing and antifungal susceptibility of clinical and environmental Cryptococcus neoformans species complex isolates in Goiania, Brazil. Mycoses 2009; 53: 62–67. Fernandes OFL, Costa TR, Costa MR, Soares AJ, Pereira AJSC, Silva MRR. Cryptococcus neoformans isolados de pacientes com AIDS. Rev Soc Bras Med Trop 2000; 33: 75–78. Lindenberg ASC, Chang MR, Paniago AMM et al. Clinical and epidemiological features of 123 cases of cryptococcosis in Mato Grosso do Sul, Brazil. Rev Inst Med Trop Sao Paulo 2008; 50: 75–78. Ribeiro LC, Hahn RC, Favalessa OC, Tadano T, Fontes CJF. Micoses bito em pacientes com infeccßa ~o sist^emicas: fatores associados ao o pelo vırus da imunodefici^encia humana, Cuiab a, Estado de Mato Grosso, 2005–2008. Rev Soc Bras Med Trop 2009; 42: 698–705. Del Poeta MD, Toffaletti DL, Rude TH, Dykstra CC, Heitman J, Perfect JR. Topoisomerase I is essential in Cryptococcus neoformans: role in
17
18
19
20
21
22
23
24
25
26 27 28
29
30
pathobiology and as an antifungal target. Genetics 1999; 152: 167– 78. Casali AK, Goulart L, Rosa e Silva LK et al. Molecular typing of clinical and environmental Cryptococcus neoformans isolates in the Brazilian state Rio Grande do Sul. FEMS Yeast Res 2003; 3: 405–15. Aoki FH, Imai T, Tanaka R et al. New PCR primer pairs specific for Cryptococcus neoformans serotype A or B prepared on the basis of random amplified polymorphic DNA fingerprint pattern analyses. J Clin Microbiol 1999; 37: 315–20. Horta JA, Staats CC, Casali AK et al. Epidemiological aspects of clinical and environmental Cryptococcus neoformans isolates in the Brazilian state Rio Grande do Sul. Med Mycol 2002; 40: 1–7. Meyer W, Marszewska K, Amirmostofian M et al. Molecular typing of global isolates of Cryptococcus neoformans var. neoformans by PCR-fingerprinting and RAPD. A pilot study to standardize techniques on which to base a detailed epidemiological survey. Electrophoresis 1999; 20: 1790–9. Baltazar LM, Ribeiro MA. Primeiro isolamento ambiental de Cryptococcus gattii no estado do Espırito Santos. Rev Soc Bras Med Trop 2008; 41: 449–53. Fortes ST, Lazera MS, Nishikawa MM, Macedo RCL, Wanke B. First isolation of Cryptococcus neoformans var. gattii from a native jungle tree in the Brazilian Amazon rainforest. Mycoses 2001; 44: 137–40. Hagen F, Ceresini PC, Polacheck I et al. Ancient dispersal of the human fungal pathogen Cryptococcus gattii from the Amazon rainforest. PLoS ONE 2013; 8: 1–14. Escandon P, Granados E. Influence of climatic conditions on the isolation of members of the Cryptococcus neoformans species complex from trees in Colombia from 1992–2004. FEMS Yeast Res 2006; 6: 636–44. Refojo N, Perrotta D, Brudny R, Abrantes R, Hevia AI, Davel G. Isolation of Cryptococcus neoformans and Cryptococcus gattii from trunk hollows of living trees in Buenos Aires city, Argentina. Med Mycol 2009; 47: 177–84. Grosso M. Secretaria de Estado de Planejamento e Coordenacß~ao Geral. Cuiab a: Mato Grosso em n umeros, 2006. Hussey P. Tree hollows and wildlife. Information notes for the land for wildlife scheme in western Australia. Wildlife Notes 2005; 15: 1–2. Costa SPSE, Lazera MS, Santos WRA et al. First isolation of Cryptococcus gattii molecular type VGII and Cryptococcus neoformans molecular type VNI from environmental sources in the city of Belem, Par a, Brazil. Mem Inst Oswaldo Cruz 2009; 104: 662–4. Trilles L, Lazera MS, Wanke B et al. Regional pattern of the molecular types of Cryptococcus neoformans and Cryptococcus gattii in Brazil. Mem Inst Oswaldo Cruz 2008; 103: 455–62. Santos WR, Meyer W, Wanke B et al. Primary endemic Cryptococcosis gattii by molecular type VGII in the state of Par a, Brazil. Mem Inst Oswaldo Cruz 2008; 103: 813–8.
© 2014 Blackwell Verlag GmbH Mycoses, 2014, 57, 414–418
