b r i e f c o m m u n i c at i o n s
Crystal structure of the vitamin B3 transporter PnuC, a full-length SWEET homolog
npg
© 2014 Nature America, Inc. All rights reserved.
Michael Jaehme1,2, Albert Guskov1,2 & Dirk Jan Slotboom1 PnuC transporters catalyze cellular uptake of the NAD+ precursor nicotinamide riboside (NR) and belong to a large superfamily that includes the SWEET sugar transporters. We present a crystal structure of Neisseria mucosa PnuC, which adopts a highly symmetrical fold with 3 + 1 + 3 membrane topology not previously observed in any protein. The high symmetry of PnuC with a single NR bound in the center suggests a simple alternating-access translocation mechanism. Vitamin B3 is the common name for precursors of the universal cofactor nicotinamide adenine dinucleotide (NAD+), one of which is NR (Supplementary Fig. 1). In prokaryotes, the membrane transporter PnuC mediates the uptake of NR1–3. PnuCs use a facilitated-diffusion mechanism linked to metabolic trapping in the cytoplasm by the specific kinase NadR, which converts NR into nicotinamide mononucleotide (NMN) and NAD+ (ref. 4). The so-called ‘factor V–dependent’ Pasteurellaceae such as Haemophilus influenzae depend on NR acquisition via PnuC for virulence5,6. The PnuC family is related to the recently discovered eukaryotic SWEET sugar-transporter family (SLC50)7–11. SWEETs use a facilitated-diffusion mechanism to catalyze low-affinity sugar transport7 and are particularly abundant in plants, in which they allow, for instance, nectar secretion10. In humans, the SWEET transporter might represent the elusive glucose transporter of the basolateral membrane of enterocytes in the intestine9. To gain insight into the mechanism of transport by PnuC, we solved a 2.8-Å-resolution crystal structure of PnuC from N. mucosa (Fig. 1, Supplementary Figs. 2 and 3 and Supplementary Table 1). The protein with a calculated monomeric molar mass of 27.7 kDa assembles into a homotrimer both in detergent solution and in the crystals (Fig. 1a,c). There is a relatively small buried surface area between the protomers of about 1,000 Å2. Each protomer consists of eight membrane-spanning a-helices (transmembrane segments, TMs), which we numbered from –1 to 7 because the first segment is absent in many members of the PnuC (Fig. 1d and Supplementary Fig. 2) and all members of the SWEET families. Because TM –1 provides all the contacts on one side of the buried surface, the trimeric state is not likely to be conserved. Indeed, we found that PnuCs from Escherichia coli and from Paenibacillus sp. are monomeric in detergent solution (Supplementary Fig. 4). TMs 1, 2, 3, 5, 6 and 7 form a compact six-helix core containing the substrate-binding site, whereas TMs –1 and 4 are located peripherally (Fig. 1).
TMs 1, 2 and 3 are related to TMs 5, 6 and 7 by a pseudo–two-fold axis (r.m.s. deviation ~2 Å), which is tilted by ~15° relative to the three-fold axis that relates the three protomers (Figs. 1b,d and 2). Because this pseudo–two-fold axis is roughly perpendicular to the plane of the bilayer, TMs 1–3 and TMs 5–7 have a ‘parallel’ membrane orientation. The parallel domain organization is probably the result of gene duplication and fusion events8. In the PnuC family, the sequence similarity between the domains is low, but in the SWEET family the homology between TMs 1–3 and TMs 5–7 is evident from sequence similarity7,8,12. Moreover, the SWEET family also contains bacterial homologs that are homodimers of two subunits with only three TMs (the SemiSWEETS). Two recent crystal structures of SemiSWEETS revealed an overall fold that strongly resembles the six-helix bundle of PnuC (r.m.s. deviation ~2 Å)13 but is different in the connectivity between the helices. In PnuC, TM 4 seems to be present merely to allow a parallel organization of the two sets of three TMs that gives rise to a 3 + 1 + 3 topology. Unexpectedly, pseudo–two-fold axes in the plane of the membrane also relate parts of the six-helix core. Such symmetry axes lead to domains with inverted (instead of parallel) membrane orientation14,15. The combination of structurally related parallel and inverted domains gives the PnuC core unusually high (pseudo) symmetry. Within the six-helix core, two bundles of four TMs are present that have approximate dihedral (D2) point-group symmetry: TMs 1-2-5-6 and TMs 2-3-6-7 (Fig. 2). In the center of the six-helix core of each protomer, we found welldefined electron density representing a bound NR molecule (Fig. 3a and Supplementary Fig. 5). Numerous residues interact with the NR molecule and form a high-affinity site (Kd of 142 nM, as determined by isothermal titration calorimetry (ITC; Fig. 3b,c). The ITC analysis also revealed that more than 90% of the binding sites were already occupied at the onset of the experiment, a result consistent with the presence of NR in the crystals. Apparently, the substrate was copurified with the protein, because we did not add NR at any stage during the purification and crystallization. The affinity of PnuC for NR is much higher than the substrate affinity in other transporters that catalyze facilitated diffusion (such as the SWEET and GLUT families of sugar transporters). The high affinity probably leads to low transport rates, which may be an acceptable trade-off for a protein that transports scarce substrates needed in trace amounts. TM 6 provides all of the specific interactions with the nicotinamide moiety of NR via three residues (Trp182, Trp185 and Asn189) that constitute the highly conserved motif WxxWxxxN/D (Fig. 3b and Supplementary Fig. 2). The indole ring of Trp185 orients the nicotinamide ring via p-stacking, the carboxamide of Asn189 can form hydrogen bonds with the carboxamide of the substrate, and the indole ring of Trp182 forms an additional aromatic interaction with the nicotinamide moiety. Helices 1, 3 and 5 are the main contributors in interactions with the ribose moiety of NR (Fig. 3b). The carboxamides of Gln99 and Gln171 can form hydrogen bonds with the 2′- and 3′-OH groups and the ring O atom of the ribose. In addition,
1University
of Groningen, Groningen Biomolecular Sciences and Biotechnology Institute, Groningen, the Netherlands. 2These authors contributed equally to this work. Correspondence should be addressed to D.J.S. ([email protected]). Received 27 August; accepted 30 September; published online 7 October 2014; doi:10.1038/nsmb.2909
nature structural & molecular biology advance online publication
1
b r i e f c o m m u n i c at i o n s a
© 2014 Nature America, Inc. All rights reserved.
Detector reading LS (a.u.)
the conserved Cys53 and Met174 might form hydrogen bonds with the 2′-OH group of the ribose unit. Surprisingly, the positions of the NR molecule in PnuC and the weak extra electron density found in the crystals of SemiSWEET from Leptospira biflexa are different13. The electron density in SemiSWEET, which might represent a substrate molecule, is displaced by approximately 9 Å toward the periplasm compared to the location of the NR molecule in PnuC (distance calculated from the C1 of the ribose in NR). In PnuC, the equivalent space is occupied by side chains of Tyr214 and Asn91. Therefore, it is possible that the location of the substrate-binding sites is not conserved in the two proteins or that there are multiple binding sites per protein, along which the substrate can move. Alternatively, the weak electron density in the SemiSWEET crystals may not represent a substrate-binding site. The NR molecule is occluded in the PnuC structure (Fig. 3a), but the high symmetry of the PnuC core suggests how the substrate-binding site may become alternately accessible from the cytoplasm and periplasm16. On the cytoplasmic side, there are two pairs of symmetry-related residues that seal off the binding pocket (Fig. 3d). Val57 (TM 1) and Met174 (TM 5) form the inner layer of the seal, and the completely conserved Trp106 (TM 3) and Trp228 (TM 7) form the outer layer. The side chains of the tryptophans are located between the short loops connecting TMs 1-2 and TMs 5-6. A minor movement of these loops away from each other would allow the tryptophans to change conformation, thus providing accessibility to the substrate (Fig. 3d). Figure 2 Symmetry of the six-helix core of PnuC. Top left, schematic representation of the core viewed along the pseudo–two-fold axis that relates TMs 1-2-3 with TMs 5-6-7 (top view, with TMs –1 and 4 not shown). The two blue rectangles indicate the four-helix bundles that have approximate D2 point-group symmetry. The colors of the TMs are as in Figure 1d. Top right, secondary-structure cartoon showing the pseudo–two-fold symmetry (top view). Bottom left and right, two side views along pseudo–two-fold axes in the plane of the membrane. In each case, the four TMs that are symmetry related are colored, and the two TMs that are not symmetry related are in light gray. NR is shown in gray stick representation. The arrows at top left indicate the viewpoints of the bottom views, and the dashed lines indicate the pseudo–two-fold axes. Nin and Nout indicate cytoplasmic and periplasmic locations of the N terminus of the TM, respectively.
2
d
Molecular mass (Da)
c
npg
b
Figure 1 Structure of PnuC. (a) Surface and secondary-structure ribbon representation of the PnuC trimer viewed along the three-fold Periplasm axis (black triangle) perpendicular to the plane of the membrane. One protomer is colored in a range from blue (TM 1) to magenta (TM 7); TM –1 is colored in wheat. The substrate NR is shown in stick representation. (b) View from the plane of the membrane (90° rotated relative to a) of two subunits from the trimer. Cytoplasm Left protomer, secondary-structure ribbon representation as in a. Right protomer, surface representation colored according to the electrostatic surface potential. The three-fold axis (dashed line with arrowhead) perpendicular 3 + 1 + 3 Molecular mass 300,000 0.065 to the plane of the membrane (green lines) Complex 250,000 0.060 Protein and the pseudo–two-fold axis (dashed line 200,000 0.055 Detergent with circle head) within the left protomer –1 1 2 3 4 5 6 7 150,000 are indicated. (c) Static light scattering (SEC0.050 100,000 MALLS) analysis of PnuC. The chromatogram 0.045 50,000 from a size-exclusion experiment (black line) C 0.040 and the calculated molar masses of the protein 0 9 10 11 12 13 14 15 16 N (red, 86 kDa), the detergent micelle (DDM, Volume (ml) green, 146 kDa) and the protein-detergent micelle (blue, 232 kDa) are shown. Light scattering (LS) is shown in arbitrary units (a.u.). (d) Membrane topology of PnuC. The TMs are colored as in a and b. The gray boxes indicate the two parts of three TMs that are related by the pseudo–two-fold axis shown in b and result in the 3 + 1 + 3 topology.
On the periplasmic side, Tyr214 and Asn91 form the first layer of a thick and hydrophilic seal between the substrate-binding site and the periplasm. Symmetry-related helical hairpins TMs 2-3 and TMs 6-7 contribute most of the hydrophilic side chains to the periplasmic seal (Fig. 3e). A movement of these hairpins away from each other (analogous to the movement of the hairpins TMs 1-2 and TMs 5-6 on the cytoplasmic side, described above) would allow the substrate to enter into, or exit from, the binding pocket. The substrate may then be guided along TM 5, which provides a conserved ladder of serine and threonine residues capped on the periplasmic side by a universally conserved aspartate residue (Fig. 3e). A comparison of structures of PnuC and SemiSWEET from Vibrio sp. N418, which is in an open-outward conformation13, indeed revealed that a movement of hairpins TMs 2-3 and TMs 6-7 would lead to an opening of PnuC toward the periplasm. 2
Nin
3
Nout
Nout 1
5 Nout 7
6 Nin
Nout
2-3-6-7
Bundle
1-2-5-6
advance online publication nature structural & molecular biology
b r i e f c o m m u n i c at i o n s Figure 3 Nicotinamide riboside (NR) binding to Periplasm Time (min) PnuC. (a) Sliced-through surface representation TM2 10 20 30 40 50 0 TM6 N189 0.01 of PnuC. TMs are colored as in Figures 1 and 2, C53 and the substrate NR is shown in yellow stick W182 0 representation. The 5′-OH group of the ribose –0.01 W185 points upward into a cavity that extends toward –0.02 the periplasm. (b) Residues capable of forming Q99 hydrogen bonds (dashed lines) and aromatic –0.03 M174 Q171 TM3 1 µl/injection 3 µl/injection interactions with NR. (c) Binding of NR to TM7 –0.04 Cytoplasm PnuC, analyzed by ITC. Kd = 142 nM ± 96 nM TM1 TM7 0 s.d. (n = 4 independent experiments). TM5 (d) Cytoplasmic gate. The two layers of side chains blocking the cytoplasmic access to the W106 TM6 TM6 –2 M174 Y214 Y75 binding site are shown. Movement of the loops W228 TM3 between TMs 1-2 and TMs 5-6 away from each other (red arrows) would allow the cytoplasmic TM2 –4 V57 0 0.3 0.6 0.9 E87 N91 seal to be broken. (e) Periplasmic gate. Some T163 Molar ratio S167 TM2 of the side chains forming the thick hydrophilic D160 layer blocking periplasmic access to the binding TM3 TM1 TM5 site are shown. Movement of the loops between TM7 TMs 2-3 and TMs 6-7 away from each other (analogous to red arrows in d) would allow the periplasmic seal to be broken. A ladder of hydrophilic residues on one face of TM 5 could provide the access path (red dashed oval).
b
c
npg
© 2014 Nature America, Inc. All rights reserved.
d
NMN, which carries a phosphate group on the 5′-OH of the ribose (Supplementary Fig. 1) is not a substrate for wild-type PnuC transporters, but mutants of PnuC from Salmonella enterica serovar Typhimurium (equivalent to T163R and Y214H in the N. mucosa protein) are able to accept NMN as substrate2. The structure of PnuC provides an explanation for the altered substrate selectivity. Between the 5′-OH group of the ribose and the periplasmic seal, a cavity extends from the binding pocket (Supplementary Fig. 5). The positively charged side chains of the mutants point toward this cavity and may allow favorable interactions with the phosphate group of NMN. In conclusion, the structure of PnuC provides insight into the architecture of the superfamily of membrane transporters with 3 + 1 + 3 membrane topology. Because transport of NR by PnuC is essential in pathogenic bacteria such as H. influenzae, specific inhibitors of these proteins may have antibacterial activity5. The structural framework of PnuC from N. mucosa provides a basis to design such small-molecule inhibitors. In addition, the structure could be used to design toxic NR analogs that are selectively transported by PnuC and may specifically attenuate bacterial growth17. Pnu transporters can also be used in biotechnological production strains for the secretion of valuable vitamins18. Transporters with different substrate specificities (analogous to the PnuC mutants that accept NMN) could be designed on the basis of the structure presented here, to broaden the variety of substrates that can be exported. METHODS Methods and any associated references are available in the online version of the paper. Accession codes. Coordinates and structure factors have been deposited in the Protein Data Bank under accession code 4QTN. Note: Any Supplementary Information and Source Data files are available in the online version of the paper. ACKNOWLEDGMENTS We thank K. Luck for help with protein production and A.J.M. Driessen for use of his ITC machine. The research leading to these results received funding from the European Community’s Seventh Framework Programme (FP7/2007–2013) under BioStruct-X (to D.J.S. and A.G., grant agreement 283570). This work was funded by the Netherlands Organisation for Scientific Research (NWO) (NWO ECHO grant 711.011.001 and NWO Vici grant 865.11.001 to D.J.S.) and the European Research Council (ERC) (ERC Starting Grant 282083 to D.J.S.). The European Synchrotron
e
Integrated heat (kcal mol – of injectant
Released heat (µcal/s)
a
Radiation Facility (ESRF) and the Swiss Light Source (SLS) are acknowledged for beamline facilities. AUTHOR CONTRIBUTIONS All authors designed experiments, performed experiments, analyzed data and wrote the manuscript. COMPETING FINANCIAL INTERESTS The authors declare no competing financial interests. Reprints and permissions information is available online at http://www.nature.com/ reprints/index.html.
1. Kemmer, G. et al. NadN and e (P4) are essential for utilization of NAD and nicotinamide mononucleotide but not nicotinamide riboside in Haemophilus influenzae. J. Bacteriol. 183, 3974–3981 (2001). 2. Grose, J.H. et al. Assimilation of nicotinamide mononucleotide requires periplasmic AphA phosphatase in Salmonella enterica. J. Bacteriol. 187, 4521–4530 (2005). 3. Rodionov, D.A. et al. Transcriptional regulation of NAD metabolism in bacteria: genomic reconstruction of NiaR (YrxA) regulon. Nucleic Acids Res. 36, 2032–2046 (2008). 4. Merdanovic, M., Sauer, E. & Reidl, J. Coupling of NAD+ biosynthesis and nicotinamide ribosyl transport: characterization of NadR ribonucleotide kinase mutants of Haemophilus influenzae. J. Bacteriol. 187, 4410–4420 (2005). 5. Herbert, M. et al. Nicotinamide ribosyl uptake mutants in Haemophilus influenzae. Infect. Immun. 71, 5398–5401 (2003). 6. Gerlach, G. & Reidl, J. NAD+ utilization in Pasteurellaceae: simplification of a complex pathway. J. Bacteriol. 188, 6719–6727 (2006). 7. Chen, L.-Q. et al. Sugar transporters for intercellular exchange and nutrition of pathogens. Nature 468, 527–532 (2010). 8. Yee, D.C. et al. The transporter-opsin-G protein-coupled receptor (TOG) superfamily. FEBS J. 280, 5780–5800 (2013). 9. Wright, E.M. Glucose transport families SLC5 and SLC50. Mol. Aspects Med. 34, 183–196 (2013). 10. Lin, I.W. et al. Nectar secretion requires sucrose phosphate synthases and the sugar transporter SWEET9. Nature 508, 546–549 (2014). 11. Chen, L.-Q. et al. Sucrose efflux mediated by SWEET proteins as a key step for phloem transport. Science 335, 207–211 (2012). 12. Xuan, Y.H. et al. Functional role of oligomerization for bacterial and plant SWEET sugar transporter family. Proc. Natl. Acad. Sci. USA 110, E3685–E3694 (2013). 13. Xu, Y. et al. Structures of bacterial homologues of SWEET transporters in two distinct conformations. Nature doi:10.1038/nature13670 (3 September 2014). 14. von Heijne, G. Membrane-protein topology. Nat. Rev. Mol. Cell Biol. 7, 909–918 (2006). 15. Rapp, M., Granseth, E., Seppälä, S. & von Heijne, G. Identification and evolution of dual-topology membrane proteins. Nat. Struct. Mol. Biol. 13, 112–116 (2006). 16. Forrest, L.R. Structural biology: (pseudo-)symmetrical transport. Science 339, 399– 401 (2013). 17. Sauer, E., Merdanovic, M., Mortimer, A.P., Bringmann, G. & Reidl, J. PnuC and the utilization of the nicotinamide riboside analog 3-aminopyridine in Haemophilus influenzae. Antimicrob. Agents Chemother. 48, 4532–4541 (2004). 18. Hemberger, S. et al. RibM from Streptomyces davawensis is a riboflavin/roseoflavin transporter and may be useful for the optimization of riboflavin production strains. BMC Biotechnol. 11, 119 (2011).
nature structural & molecular biology advance online publication
3
ONLINE METHODS
npg
© 2014 Nature America, Inc. All rights reserved.
Cloning of pnuC. The gene encoding PnuC from N. mucosa was amplified from genomic DNA (DSM 4631, DSMZ Braunschweig, Germany), with forward primer AGATCCATGGGACAATATGGGATGGATTCT and reverse primer GCACTGAAGCTTTCAGTGGTGGTGGTGGTGGTGTTGTCCCGAATGCCGTTT, and cloned into a p2BAD vector19 via NcoI and HindIII restriction sites. For cloning into the vector pET21d (Merck, Darmstadt, Germany) pnuC was amplified from the p2BAD_pnuC vector with forward primer AGATCCATGGGATCATTGGCCTGGTGGAAA and reverse primer GCACTGAAGCTTTCAGTGGTGGTGGTGGTGGTG and cloned into the pET21d vector via NcoI and HindIII restriction sites. Protein production and purification. For the production of native PnuC from N. mucosa, the plasmid p2BAD_pnuC was transformed into E. coli MC1061 cells. Several colonies were used to inoculate LB medium for an overnight preculture cultivated at 37 °C with vigorous shaking. This culture was used to inoculate a main culture in 2xTY medium, which was grown at 37 °C until an OD600 of 0.6 was reached, at which time 0.04% (w/v) l-arabinose was added for expression induction, and cultivation was continued for 3 h. 1 h after induction, 0.2% glycerol was added. Cells were harvested by centrifugation (7,400g, 15 min, 4 °C) and disrupted with a Constant cell-disruption system. The lysate was clarified by centrifugation (5,250g, 30 min, 4 °C), and membranes were prepared by ultracentrifugation (185,000g, 100 min, 4 °C). Membranes were solubilized at a protein concentration of 5 mg/mL (determined with a Bradford assay) for 1 h at 4 °C in a buffer containing 50 mM Tris-HCl, pH 8, 150 mM NaCl, 10 mM imidazole, and 1% (w/v) DDM. Unsolubilized material was removed by ultracentrifugation (186,000g, 30 min, 4 °C), and the supernatant was incubated with Ni-Sepharose (GE Healthcare) equilibrated with buffer used for solubilization, for 2 h at 4 °C. The column was washed with 20 column volumes (CV) of a buffer containing 50 mM Tris-HCl, pH 8, 150 mM NaCl, 50 mM imidazole, and 1% n-octyl-b-d-glucoside (b-OG). PnuC was eluted stepwise, first with 2 × 5 CV of the wash buffer containing 100 mM imidazole and second with 2 × 5 CV of the wash buffer containing 500 mM imidazole. The first fraction of the second elution step was used for further purification via gel filtration. The sample was loaded on a Superdex 200 10/30 GL column preequilibrated with the wash buffer without imidazole. Protein-containing fractions were pooled and concentrated to 5.5–7 mg/mL with Vivaspin concentrators (Sartorius, 30,000 MWCO). For ITC and light-scattering analysis, the protein was purified identically, but b-OG was replaced by 0.05% n-dodecyl-b-d-maltoside (DDM). For the incorporation of selenomethionine (SeMet), PnuC was produced in chemically defined medium (cdm)20. For this purpose, the vector pET21d_pnuC was transformed into Bl21 (DE3) cells. Several colonies were used to inoculate 500 mL of cdm containing methionine. After incubation overnight at 37 °C with vigorous shaking, the cells were spun down (7,400g, 10 min, 25 °C) and resuspended in cdm without methionine in a volume yielding an OD600 of 0.15. The cells were grown at 37 °C until an OD600 of 0.5 was reached, and then 0.5 mM IPTG and 30 mg/L SeMet were added, and cultures were further incubated for 2 h. Protein purification was performed as described above with 1% b-OG as detergent. Multiangle laser light scattering coupled to differential refractive-index and UV-absorbance measurements. The oligomeric states of different PnuC homologs were determined by size-exclusion chromatography coupled to multiangle
doi:10.1038/nsmb.2909
laser light scattering and differential refractive-index measurement (SECMALLS). SEC-MALLS was performed as described previously21,22. To determine the molecular weight of the protein, the extinction coefficients were calculated with the ExPASy ProtParam tool. ITC. ITC experiments were conducted with an ITC200 calorimeter (MicroCal) at 25 °C. Nicotinamide riboside (Niagen TM, Chromadex) was dissolved in the buffer used for purification at a concentration of 100 µM (approximately 40 mL). The ligand solution was added in the indicated steps into the temperature-equilibrated ITC cell filled with ~250 mL of PnuC in the same buffer and at a concentration of 15–35 mM. The experiments were repeated four times. Data were analyzed with the ORIGIN-based software (MicroCal). Crystallization. The initial crystallization hits were obtained with the Crystal Former (Microlytic, Burlington, Massachusetts, USA) with MCSG (Microlytic) and Membrane Gold (Molecular Dimensions) screens. Larger crystals of PnuC were grown at 4 °C by the vapor-diffusion technique (hanging drop) by mixture of the protein and precipitants at a ratio of 1.5:1. Crystals of SeMet-substituted PnuC appeared in a buffer containing 100 mM succinic acid, pH 7, and 15% (v/v) PEG 3350 (MCSG-2 screen, Microlytic). Crystals were flash frozen in liquid nitrogen and subjected to X-ray analysis. Structure determination and refinement. Initial data characterization was done at EMBL beamlines P13 and P14 (Hamburg, Germany), where native data sets were collected with resolution from 4 to 3.2 Å. The first characterization of SeMet crystals was performed at ESRF beamline ID29 (Grenoble, France), but the anomalous signal was too low. The multiwavelength anomalous diffraction (MAD) data used for structure solution were collected at the X06DA (PXIII) beamline at SLS (Villigen, Switzerland) and processed with the XDS package23. The heavy atom search and initial phase determination were performed with AutoSol from the PHENIX package24. The initial partial model was built with AutoBuild25 and further extended manually in COOT26. Refinement was performed with Refmac27. All structure figures were generated with PyMOL (http://www.pymol. org/). The data and refinement statistics are listed in Supplementary Table 1. 19. Birkner, J.P., Poolman, B. & Koçer, A. Hydrophobic gating of mechanosensitive channel of large conductance evidenced by single-subunit resolution. Proc. Natl. Acad. Sci. USA 109, 12944–12949 (2012). 20. Berntsson, R.P.-A. et al. Selenomethionine incorporation in proteins expressed in Lactococcus lactis. Protein Sci. 18, 1121–1127 (2009). 21. Ter Beek, J., Duurkens, R.H., Erkens, G.B. & Slotboom, D.J. Quaternary structure and functional unit of energy coupling factor (ECF)-type transporters. J. Biol. Chem. 286, 5471–5475 (2011). 22. Slotboom, D.J., Duurkens, R.H., Olieman, K. & Erkens, G.B. Static light scattering to characterize membrane proteins in detergent solution. Methods 46, 73–82 (2008). 23. Kabsch, W. XDS. Acta Crystallogr. D Biol. Crystallogr. 66, 125–132 (2010). 24. Terwilliger, T.C. et al. Decision-making in structure solution using Bayesian estimates of map quality: the PHENIX AutoSol wizard. Acta Crystallogr. D Biol. Crystallogr. 65, 582–601 (2009). 25. Terwilliger, T.C. et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallogr. D Biol. Crystallogr. 64, 61–69 (2008). 26. Emsley, P., Lohkamp, B., Scott, W.G. & Cowtan, K. Features and development of Coot. Acta Crystallogr. D Biol. Crystallogr. 66, 486–501 (2010). 27. Murshudov, G.N. et al. REFMAC5 for the refinement of macromolecular crystal structures. Acta Crystallogr. D Biol. Crystallogr. 67, 355–367 (2011).
nature structural & molecular biology
Crystal structure of the vitamin B3 transporter PnuC, a full-length SWEET homolog
npg
© 2014 Nature America, Inc. All rights reserved.
Michael Jaehme1,2, Albert Guskov1,2 & Dirk Jan Slotboom1 PnuC transporters catalyze cellular uptake of the NAD+ precursor nicotinamide riboside (NR) and belong to a large superfamily that includes the SWEET sugar transporters. We present a crystal structure of Neisseria mucosa PnuC, which adopts a highly symmetrical fold with 3 + 1 + 3 membrane topology not previously observed in any protein. The high symmetry of PnuC with a single NR bound in the center suggests a simple alternating-access translocation mechanism. Vitamin B3 is the common name for precursors of the universal cofactor nicotinamide adenine dinucleotide (NAD+), one of which is NR (Supplementary Fig. 1). In prokaryotes, the membrane transporter PnuC mediates the uptake of NR1–3. PnuCs use a facilitated-diffusion mechanism linked to metabolic trapping in the cytoplasm by the specific kinase NadR, which converts NR into nicotinamide mononucleotide (NMN) and NAD+ (ref. 4). The so-called ‘factor V–dependent’ Pasteurellaceae such as Haemophilus influenzae depend on NR acquisition via PnuC for virulence5,6. The PnuC family is related to the recently discovered eukaryotic SWEET sugar-transporter family (SLC50)7–11. SWEETs use a facilitated-diffusion mechanism to catalyze low-affinity sugar transport7 and are particularly abundant in plants, in which they allow, for instance, nectar secretion10. In humans, the SWEET transporter might represent the elusive glucose transporter of the basolateral membrane of enterocytes in the intestine9. To gain insight into the mechanism of transport by PnuC, we solved a 2.8-Å-resolution crystal structure of PnuC from N. mucosa (Fig. 1, Supplementary Figs. 2 and 3 and Supplementary Table 1). The protein with a calculated monomeric molar mass of 27.7 kDa assembles into a homotrimer both in detergent solution and in the crystals (Fig. 1a,c). There is a relatively small buried surface area between the protomers of about 1,000 Å2. Each protomer consists of eight membrane-spanning a-helices (transmembrane segments, TMs), which we numbered from –1 to 7 because the first segment is absent in many members of the PnuC (Fig. 1d and Supplementary Fig. 2) and all members of the SWEET families. Because TM –1 provides all the contacts on one side of the buried surface, the trimeric state is not likely to be conserved. Indeed, we found that PnuCs from Escherichia coli and from Paenibacillus sp. are monomeric in detergent solution (Supplementary Fig. 4). TMs 1, 2, 3, 5, 6 and 7 form a compact six-helix core containing the substrate-binding site, whereas TMs –1 and 4 are located peripherally (Fig. 1).
TMs 1, 2 and 3 are related to TMs 5, 6 and 7 by a pseudo–two-fold axis (r.m.s. deviation ~2 Å), which is tilted by ~15° relative to the three-fold axis that relates the three protomers (Figs. 1b,d and 2). Because this pseudo–two-fold axis is roughly perpendicular to the plane of the bilayer, TMs 1–3 and TMs 5–7 have a ‘parallel’ membrane orientation. The parallel domain organization is probably the result of gene duplication and fusion events8. In the PnuC family, the sequence similarity between the domains is low, but in the SWEET family the homology between TMs 1–3 and TMs 5–7 is evident from sequence similarity7,8,12. Moreover, the SWEET family also contains bacterial homologs that are homodimers of two subunits with only three TMs (the SemiSWEETS). Two recent crystal structures of SemiSWEETS revealed an overall fold that strongly resembles the six-helix bundle of PnuC (r.m.s. deviation ~2 Å)13 but is different in the connectivity between the helices. In PnuC, TM 4 seems to be present merely to allow a parallel organization of the two sets of three TMs that gives rise to a 3 + 1 + 3 topology. Unexpectedly, pseudo–two-fold axes in the plane of the membrane also relate parts of the six-helix core. Such symmetry axes lead to domains with inverted (instead of parallel) membrane orientation14,15. The combination of structurally related parallel and inverted domains gives the PnuC core unusually high (pseudo) symmetry. Within the six-helix core, two bundles of four TMs are present that have approximate dihedral (D2) point-group symmetry: TMs 1-2-5-6 and TMs 2-3-6-7 (Fig. 2). In the center of the six-helix core of each protomer, we found welldefined electron density representing a bound NR molecule (Fig. 3a and Supplementary Fig. 5). Numerous residues interact with the NR molecule and form a high-affinity site (Kd of 142 nM, as determined by isothermal titration calorimetry (ITC; Fig. 3b,c). The ITC analysis also revealed that more than 90% of the binding sites were already occupied at the onset of the experiment, a result consistent with the presence of NR in the crystals. Apparently, the substrate was copurified with the protein, because we did not add NR at any stage during the purification and crystallization. The affinity of PnuC for NR is much higher than the substrate affinity in other transporters that catalyze facilitated diffusion (such as the SWEET and GLUT families of sugar transporters). The high affinity probably leads to low transport rates, which may be an acceptable trade-off for a protein that transports scarce substrates needed in trace amounts. TM 6 provides all of the specific interactions with the nicotinamide moiety of NR via three residues (Trp182, Trp185 and Asn189) that constitute the highly conserved motif WxxWxxxN/D (Fig. 3b and Supplementary Fig. 2). The indole ring of Trp185 orients the nicotinamide ring via p-stacking, the carboxamide of Asn189 can form hydrogen bonds with the carboxamide of the substrate, and the indole ring of Trp182 forms an additional aromatic interaction with the nicotinamide moiety. Helices 1, 3 and 5 are the main contributors in interactions with the ribose moiety of NR (Fig. 3b). The carboxamides of Gln99 and Gln171 can form hydrogen bonds with the 2′- and 3′-OH groups and the ring O atom of the ribose. In addition,
1University
of Groningen, Groningen Biomolecular Sciences and Biotechnology Institute, Groningen, the Netherlands. 2These authors contributed equally to this work. Correspondence should be addressed to D.J.S. ([email protected]). Received 27 August; accepted 30 September; published online 7 October 2014; doi:10.1038/nsmb.2909
nature structural & molecular biology advance online publication
1
b r i e f c o m m u n i c at i o n s a
© 2014 Nature America, Inc. All rights reserved.
Detector reading LS (a.u.)
the conserved Cys53 and Met174 might form hydrogen bonds with the 2′-OH group of the ribose unit. Surprisingly, the positions of the NR molecule in PnuC and the weak extra electron density found in the crystals of SemiSWEET from Leptospira biflexa are different13. The electron density in SemiSWEET, which might represent a substrate molecule, is displaced by approximately 9 Å toward the periplasm compared to the location of the NR molecule in PnuC (distance calculated from the C1 of the ribose in NR). In PnuC, the equivalent space is occupied by side chains of Tyr214 and Asn91. Therefore, it is possible that the location of the substrate-binding sites is not conserved in the two proteins or that there are multiple binding sites per protein, along which the substrate can move. Alternatively, the weak electron density in the SemiSWEET crystals may not represent a substrate-binding site. The NR molecule is occluded in the PnuC structure (Fig. 3a), but the high symmetry of the PnuC core suggests how the substrate-binding site may become alternately accessible from the cytoplasm and periplasm16. On the cytoplasmic side, there are two pairs of symmetry-related residues that seal off the binding pocket (Fig. 3d). Val57 (TM 1) and Met174 (TM 5) form the inner layer of the seal, and the completely conserved Trp106 (TM 3) and Trp228 (TM 7) form the outer layer. The side chains of the tryptophans are located between the short loops connecting TMs 1-2 and TMs 5-6. A minor movement of these loops away from each other would allow the tryptophans to change conformation, thus providing accessibility to the substrate (Fig. 3d). Figure 2 Symmetry of the six-helix core of PnuC. Top left, schematic representation of the core viewed along the pseudo–two-fold axis that relates TMs 1-2-3 with TMs 5-6-7 (top view, with TMs –1 and 4 not shown). The two blue rectangles indicate the four-helix bundles that have approximate D2 point-group symmetry. The colors of the TMs are as in Figure 1d. Top right, secondary-structure cartoon showing the pseudo–two-fold symmetry (top view). Bottom left and right, two side views along pseudo–two-fold axes in the plane of the membrane. In each case, the four TMs that are symmetry related are colored, and the two TMs that are not symmetry related are in light gray. NR is shown in gray stick representation. The arrows at top left indicate the viewpoints of the bottom views, and the dashed lines indicate the pseudo–two-fold axes. Nin and Nout indicate cytoplasmic and periplasmic locations of the N terminus of the TM, respectively.
2
d
Molecular mass (Da)
c
npg
b
Figure 1 Structure of PnuC. (a) Surface and secondary-structure ribbon representation of the PnuC trimer viewed along the three-fold Periplasm axis (black triangle) perpendicular to the plane of the membrane. One protomer is colored in a range from blue (TM 1) to magenta (TM 7); TM –1 is colored in wheat. The substrate NR is shown in stick representation. (b) View from the plane of the membrane (90° rotated relative to a) of two subunits from the trimer. Cytoplasm Left protomer, secondary-structure ribbon representation as in a. Right protomer, surface representation colored according to the electrostatic surface potential. The three-fold axis (dashed line with arrowhead) perpendicular 3 + 1 + 3 Molecular mass 300,000 0.065 to the plane of the membrane (green lines) Complex 250,000 0.060 Protein and the pseudo–two-fold axis (dashed line 200,000 0.055 Detergent with circle head) within the left protomer –1 1 2 3 4 5 6 7 150,000 are indicated. (c) Static light scattering (SEC0.050 100,000 MALLS) analysis of PnuC. The chromatogram 0.045 50,000 from a size-exclusion experiment (black line) C 0.040 and the calculated molar masses of the protein 0 9 10 11 12 13 14 15 16 N (red, 86 kDa), the detergent micelle (DDM, Volume (ml) green, 146 kDa) and the protein-detergent micelle (blue, 232 kDa) are shown. Light scattering (LS) is shown in arbitrary units (a.u.). (d) Membrane topology of PnuC. The TMs are colored as in a and b. The gray boxes indicate the two parts of three TMs that are related by the pseudo–two-fold axis shown in b and result in the 3 + 1 + 3 topology.
On the periplasmic side, Tyr214 and Asn91 form the first layer of a thick and hydrophilic seal between the substrate-binding site and the periplasm. Symmetry-related helical hairpins TMs 2-3 and TMs 6-7 contribute most of the hydrophilic side chains to the periplasmic seal (Fig. 3e). A movement of these hairpins away from each other (analogous to the movement of the hairpins TMs 1-2 and TMs 5-6 on the cytoplasmic side, described above) would allow the substrate to enter into, or exit from, the binding pocket. The substrate may then be guided along TM 5, which provides a conserved ladder of serine and threonine residues capped on the periplasmic side by a universally conserved aspartate residue (Fig. 3e). A comparison of structures of PnuC and SemiSWEET from Vibrio sp. N418, which is in an open-outward conformation13, indeed revealed that a movement of hairpins TMs 2-3 and TMs 6-7 would lead to an opening of PnuC toward the periplasm. 2
Nin
3
Nout
Nout 1
5 Nout 7
6 Nin
Nout
2-3-6-7
Bundle
1-2-5-6
advance online publication nature structural & molecular biology
b r i e f c o m m u n i c at i o n s Figure 3 Nicotinamide riboside (NR) binding to Periplasm Time (min) PnuC. (a) Sliced-through surface representation TM2 10 20 30 40 50 0 TM6 N189 0.01 of PnuC. TMs are colored as in Figures 1 and 2, C53 and the substrate NR is shown in yellow stick W182 0 representation. The 5′-OH group of the ribose –0.01 W185 points upward into a cavity that extends toward –0.02 the periplasm. (b) Residues capable of forming Q99 hydrogen bonds (dashed lines) and aromatic –0.03 M174 Q171 TM3 1 µl/injection 3 µl/injection interactions with NR. (c) Binding of NR to TM7 –0.04 Cytoplasm PnuC, analyzed by ITC. Kd = 142 nM ± 96 nM TM1 TM7 0 s.d. (n = 4 independent experiments). TM5 (d) Cytoplasmic gate. The two layers of side chains blocking the cytoplasmic access to the W106 TM6 TM6 –2 M174 Y214 Y75 binding site are shown. Movement of the loops W228 TM3 between TMs 1-2 and TMs 5-6 away from each other (red arrows) would allow the cytoplasmic TM2 –4 V57 0 0.3 0.6 0.9 E87 N91 seal to be broken. (e) Periplasmic gate. Some T163 Molar ratio S167 TM2 of the side chains forming the thick hydrophilic D160 layer blocking periplasmic access to the binding TM3 TM1 TM5 site are shown. Movement of the loops between TM7 TMs 2-3 and TMs 6-7 away from each other (analogous to red arrows in d) would allow the periplasmic seal to be broken. A ladder of hydrophilic residues on one face of TM 5 could provide the access path (red dashed oval).
b
c
npg
© 2014 Nature America, Inc. All rights reserved.
d
NMN, which carries a phosphate group on the 5′-OH of the ribose (Supplementary Fig. 1) is not a substrate for wild-type PnuC transporters, but mutants of PnuC from Salmonella enterica serovar Typhimurium (equivalent to T163R and Y214H in the N. mucosa protein) are able to accept NMN as substrate2. The structure of PnuC provides an explanation for the altered substrate selectivity. Between the 5′-OH group of the ribose and the periplasmic seal, a cavity extends from the binding pocket (Supplementary Fig. 5). The positively charged side chains of the mutants point toward this cavity and may allow favorable interactions with the phosphate group of NMN. In conclusion, the structure of PnuC provides insight into the architecture of the superfamily of membrane transporters with 3 + 1 + 3 membrane topology. Because transport of NR by PnuC is essential in pathogenic bacteria such as H. influenzae, specific inhibitors of these proteins may have antibacterial activity5. The structural framework of PnuC from N. mucosa provides a basis to design such small-molecule inhibitors. In addition, the structure could be used to design toxic NR analogs that are selectively transported by PnuC and may specifically attenuate bacterial growth17. Pnu transporters can also be used in biotechnological production strains for the secretion of valuable vitamins18. Transporters with different substrate specificities (analogous to the PnuC mutants that accept NMN) could be designed on the basis of the structure presented here, to broaden the variety of substrates that can be exported. METHODS Methods and any associated references are available in the online version of the paper. Accession codes. Coordinates and structure factors have been deposited in the Protein Data Bank under accession code 4QTN. Note: Any Supplementary Information and Source Data files are available in the online version of the paper. ACKNOWLEDGMENTS We thank K. Luck for help with protein production and A.J.M. Driessen for use of his ITC machine. The research leading to these results received funding from the European Community’s Seventh Framework Programme (FP7/2007–2013) under BioStruct-X (to D.J.S. and A.G., grant agreement 283570). This work was funded by the Netherlands Organisation for Scientific Research (NWO) (NWO ECHO grant 711.011.001 and NWO Vici grant 865.11.001 to D.J.S.) and the European Research Council (ERC) (ERC Starting Grant 282083 to D.J.S.). The European Synchrotron
e
Integrated heat (kcal mol – of injectant
Released heat (µcal/s)
a
Radiation Facility (ESRF) and the Swiss Light Source (SLS) are acknowledged for beamline facilities. AUTHOR CONTRIBUTIONS All authors designed experiments, performed experiments, analyzed data and wrote the manuscript. COMPETING FINANCIAL INTERESTS The authors declare no competing financial interests. Reprints and permissions information is available online at http://www.nature.com/ reprints/index.html.
1. Kemmer, G. et al. NadN and e (P4) are essential for utilization of NAD and nicotinamide mononucleotide but not nicotinamide riboside in Haemophilus influenzae. J. Bacteriol. 183, 3974–3981 (2001). 2. Grose, J.H. et al. Assimilation of nicotinamide mononucleotide requires periplasmic AphA phosphatase in Salmonella enterica. J. Bacteriol. 187, 4521–4530 (2005). 3. Rodionov, D.A. et al. Transcriptional regulation of NAD metabolism in bacteria: genomic reconstruction of NiaR (YrxA) regulon. Nucleic Acids Res. 36, 2032–2046 (2008). 4. Merdanovic, M., Sauer, E. & Reidl, J. Coupling of NAD+ biosynthesis and nicotinamide ribosyl transport: characterization of NadR ribonucleotide kinase mutants of Haemophilus influenzae. J. Bacteriol. 187, 4410–4420 (2005). 5. Herbert, M. et al. Nicotinamide ribosyl uptake mutants in Haemophilus influenzae. Infect. Immun. 71, 5398–5401 (2003). 6. Gerlach, G. & Reidl, J. NAD+ utilization in Pasteurellaceae: simplification of a complex pathway. J. Bacteriol. 188, 6719–6727 (2006). 7. Chen, L.-Q. et al. Sugar transporters for intercellular exchange and nutrition of pathogens. Nature 468, 527–532 (2010). 8. Yee, D.C. et al. The transporter-opsin-G protein-coupled receptor (TOG) superfamily. FEBS J. 280, 5780–5800 (2013). 9. Wright, E.M. Glucose transport families SLC5 and SLC50. Mol. Aspects Med. 34, 183–196 (2013). 10. Lin, I.W. et al. Nectar secretion requires sucrose phosphate synthases and the sugar transporter SWEET9. Nature 508, 546–549 (2014). 11. Chen, L.-Q. et al. Sucrose efflux mediated by SWEET proteins as a key step for phloem transport. Science 335, 207–211 (2012). 12. Xuan, Y.H. et al. Functional role of oligomerization for bacterial and plant SWEET sugar transporter family. Proc. Natl. Acad. Sci. USA 110, E3685–E3694 (2013). 13. Xu, Y. et al. Structures of bacterial homologues of SWEET transporters in two distinct conformations. Nature doi:10.1038/nature13670 (3 September 2014). 14. von Heijne, G. Membrane-protein topology. Nat. Rev. Mol. Cell Biol. 7, 909–918 (2006). 15. Rapp, M., Granseth, E., Seppälä, S. & von Heijne, G. Identification and evolution of dual-topology membrane proteins. Nat. Struct. Mol. Biol. 13, 112–116 (2006). 16. Forrest, L.R. Structural biology: (pseudo-)symmetrical transport. Science 339, 399– 401 (2013). 17. Sauer, E., Merdanovic, M., Mortimer, A.P., Bringmann, G. & Reidl, J. PnuC and the utilization of the nicotinamide riboside analog 3-aminopyridine in Haemophilus influenzae. Antimicrob. Agents Chemother. 48, 4532–4541 (2004). 18. Hemberger, S. et al. RibM from Streptomyces davawensis is a riboflavin/roseoflavin transporter and may be useful for the optimization of riboflavin production strains. BMC Biotechnol. 11, 119 (2011).
nature structural & molecular biology advance online publication
3
ONLINE METHODS
npg
© 2014 Nature America, Inc. All rights reserved.
Cloning of pnuC. The gene encoding PnuC from N. mucosa was amplified from genomic DNA (DSM 4631, DSMZ Braunschweig, Germany), with forward primer AGATCCATGGGACAATATGGGATGGATTCT and reverse primer GCACTGAAGCTTTCAGTGGTGGTGGTGGTGGTGTTGTCCCGAATGCCGTTT, and cloned into a p2BAD vector19 via NcoI and HindIII restriction sites. For cloning into the vector pET21d (Merck, Darmstadt, Germany) pnuC was amplified from the p2BAD_pnuC vector with forward primer AGATCCATGGGATCATTGGCCTGGTGGAAA and reverse primer GCACTGAAGCTTTCAGTGGTGGTGGTGGTGGTG and cloned into the pET21d vector via NcoI and HindIII restriction sites. Protein production and purification. For the production of native PnuC from N. mucosa, the plasmid p2BAD_pnuC was transformed into E. coli MC1061 cells. Several colonies were used to inoculate LB medium for an overnight preculture cultivated at 37 °C with vigorous shaking. This culture was used to inoculate a main culture in 2xTY medium, which was grown at 37 °C until an OD600 of 0.6 was reached, at which time 0.04% (w/v) l-arabinose was added for expression induction, and cultivation was continued for 3 h. 1 h after induction, 0.2% glycerol was added. Cells were harvested by centrifugation (7,400g, 15 min, 4 °C) and disrupted with a Constant cell-disruption system. The lysate was clarified by centrifugation (5,250g, 30 min, 4 °C), and membranes were prepared by ultracentrifugation (185,000g, 100 min, 4 °C). Membranes were solubilized at a protein concentration of 5 mg/mL (determined with a Bradford assay) for 1 h at 4 °C in a buffer containing 50 mM Tris-HCl, pH 8, 150 mM NaCl, 10 mM imidazole, and 1% (w/v) DDM. Unsolubilized material was removed by ultracentrifugation (186,000g, 30 min, 4 °C), and the supernatant was incubated with Ni-Sepharose (GE Healthcare) equilibrated with buffer used for solubilization, for 2 h at 4 °C. The column was washed with 20 column volumes (CV) of a buffer containing 50 mM Tris-HCl, pH 8, 150 mM NaCl, 50 mM imidazole, and 1% n-octyl-b-d-glucoside (b-OG). PnuC was eluted stepwise, first with 2 × 5 CV of the wash buffer containing 100 mM imidazole and second with 2 × 5 CV of the wash buffer containing 500 mM imidazole. The first fraction of the second elution step was used for further purification via gel filtration. The sample was loaded on a Superdex 200 10/30 GL column preequilibrated with the wash buffer without imidazole. Protein-containing fractions were pooled and concentrated to 5.5–7 mg/mL with Vivaspin concentrators (Sartorius, 30,000 MWCO). For ITC and light-scattering analysis, the protein was purified identically, but b-OG was replaced by 0.05% n-dodecyl-b-d-maltoside (DDM). For the incorporation of selenomethionine (SeMet), PnuC was produced in chemically defined medium (cdm)20. For this purpose, the vector pET21d_pnuC was transformed into Bl21 (DE3) cells. Several colonies were used to inoculate 500 mL of cdm containing methionine. After incubation overnight at 37 °C with vigorous shaking, the cells were spun down (7,400g, 10 min, 25 °C) and resuspended in cdm without methionine in a volume yielding an OD600 of 0.15. The cells were grown at 37 °C until an OD600 of 0.5 was reached, and then 0.5 mM IPTG and 30 mg/L SeMet were added, and cultures were further incubated for 2 h. Protein purification was performed as described above with 1% b-OG as detergent. Multiangle laser light scattering coupled to differential refractive-index and UV-absorbance measurements. The oligomeric states of different PnuC homologs were determined by size-exclusion chromatography coupled to multiangle
doi:10.1038/nsmb.2909
laser light scattering and differential refractive-index measurement (SECMALLS). SEC-MALLS was performed as described previously21,22. To determine the molecular weight of the protein, the extinction coefficients were calculated with the ExPASy ProtParam tool. ITC. ITC experiments were conducted with an ITC200 calorimeter (MicroCal) at 25 °C. Nicotinamide riboside (Niagen TM, Chromadex) was dissolved in the buffer used for purification at a concentration of 100 µM (approximately 40 mL). The ligand solution was added in the indicated steps into the temperature-equilibrated ITC cell filled with ~250 mL of PnuC in the same buffer and at a concentration of 15–35 mM. The experiments were repeated four times. Data were analyzed with the ORIGIN-based software (MicroCal). Crystallization. The initial crystallization hits were obtained with the Crystal Former (Microlytic, Burlington, Massachusetts, USA) with MCSG (Microlytic) and Membrane Gold (Molecular Dimensions) screens. Larger crystals of PnuC were grown at 4 °C by the vapor-diffusion technique (hanging drop) by mixture of the protein and precipitants at a ratio of 1.5:1. Crystals of SeMet-substituted PnuC appeared in a buffer containing 100 mM succinic acid, pH 7, and 15% (v/v) PEG 3350 (MCSG-2 screen, Microlytic). Crystals were flash frozen in liquid nitrogen and subjected to X-ray analysis. Structure determination and refinement. Initial data characterization was done at EMBL beamlines P13 and P14 (Hamburg, Germany), where native data sets were collected with resolution from 4 to 3.2 Å. The first characterization of SeMet crystals was performed at ESRF beamline ID29 (Grenoble, France), but the anomalous signal was too low. The multiwavelength anomalous diffraction (MAD) data used for structure solution were collected at the X06DA (PXIII) beamline at SLS (Villigen, Switzerland) and processed with the XDS package23. The heavy atom search and initial phase determination were performed with AutoSol from the PHENIX package24. The initial partial model was built with AutoBuild25 and further extended manually in COOT26. Refinement was performed with Refmac27. All structure figures were generated with PyMOL (http://www.pymol. org/). The data and refinement statistics are listed in Supplementary Table 1. 19. Birkner, J.P., Poolman, B. & Koçer, A. Hydrophobic gating of mechanosensitive channel of large conductance evidenced by single-subunit resolution. Proc. Natl. Acad. Sci. USA 109, 12944–12949 (2012). 20. Berntsson, R.P.-A. et al. Selenomethionine incorporation in proteins expressed in Lactococcus lactis. Protein Sci. 18, 1121–1127 (2009). 21. Ter Beek, J., Duurkens, R.H., Erkens, G.B. & Slotboom, D.J. Quaternary structure and functional unit of energy coupling factor (ECF)-type transporters. J. Biol. Chem. 286, 5471–5475 (2011). 22. Slotboom, D.J., Duurkens, R.H., Olieman, K. & Erkens, G.B. Static light scattering to characterize membrane proteins in detergent solution. Methods 46, 73–82 (2008). 23. Kabsch, W. XDS. Acta Crystallogr. D Biol. Crystallogr. 66, 125–132 (2010). 24. Terwilliger, T.C. et al. Decision-making in structure solution using Bayesian estimates of map quality: the PHENIX AutoSol wizard. Acta Crystallogr. D Biol. Crystallogr. 65, 582–601 (2009). 25. Terwilliger, T.C. et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallogr. D Biol. Crystallogr. 64, 61–69 (2008). 26. Emsley, P., Lohkamp, B., Scott, W.G. & Cowtan, K. Features and development of Coot. Acta Crystallogr. D Biol. Crystallogr. 66, 486–501 (2010). 27. Murshudov, G.N. et al. REFMAC5 for the refinement of macromolecular crystal structures. Acta Crystallogr. D Biol. Crystallogr. 67, 355–367 (2011).
nature structural & molecular biology
