Food Microbiology 56 (2016) 21e28

Contents lists available at ScienceDirect

Food Microbiology journal homepage: www.elsevier.com/locate/fm

Short communication

Culture dependent and independent genomic identification of Alicyclobacillus species in contaminated commercial fruit juices Babasola Adewunmi Osopale a, b, c, Cornelia Regina Witthuhn b, Jacobus Albertyn b, Folarin Anthony Oguntoyinbo a, * a b c

Department of Microbiology, University of Lagos, Akoka, Lagos, Nigeria Department of Microbial, Biochemical and Food Biotechnology, University of the Free State, Bloemfontein, South Africa Department of Biosciences and Biotechnology, Babcock University, Ilishan- Remo, Nigeria

a r t i c l e i n f o

a b s t r a c t

Article history: Received 24 July 2015 Received in revised form 24 November 2015 Accepted 25 November 2015 Available online 17 December 2015

Alicyclobacillus is a genus of thermo-acidophilic, endospore-forming, bacteria species which occasionally cause spoilage of heat-processed fruit juices by producing guaiacol taint. In this study, Alicyclobacillus contamination of commercial fruit juices in West Africa was investigated using culture-dependent and -independent approaches. Firstly, a total of 225 fruit juice products from Ghana (n ¼ 39) and Nigeria (n ¼ 186) were enriched with yeastestarcheglucose (YSG) broth (pH 3.7) following heat shock at 80  C for 10 min. Alicyclobacillus was detected in 11.6% (26) of samples. Isolates were identified to the genus taxonomic level by genus-specific PCR which targeted the squalene-hopene-cyclase (shc) gene followed by analysis of the almost-complete 16S ribosomal RNA (rRNA) gene sequences that identified 16 Alicyclobacillus acidoterrestris, 7 Alicyclobacillus acidocaldarius and 3 Alicyclobacillus genomic species 1 (Alicyclobacillus sp. 1). Whole-genome fingerprinting using PCR-RAPD primers Ba-10, F-61 and F-64 grouped the 16 A. acidoterrestris isolates into two genetic clusters. Furthermore, high performance liquid chromatographic (HPLC) analyses revealed the activity of vanillic-acid decarboxylase (vdc) in all A. acidoterrestris isolates due to guaiacol production from vanillic-acid. Lastly, species-specific PCR-DGGE targeting the 16S rRNA gene clearly discriminated between the guaiacol-producing A. acidoterrestris and the non-spoilage A. acidocaldarius group. Information provided by this study is fundamental to the development of effective strategies for the improvement of quality and shelf-life of processed tropical fruit juices in W. Africa. © 2015 Elsevier Ltd. All rights reserved.

Keywords: Tropical fruit juices Alicyclobacillus Genome fingerprinting

1. Introduction Food industries generally employ different physical, chemical or a combination of both methods in the control of spoilage and pathogenic microorganisms in food products. Industrial food processing uses pasteurization to guarantee food quality and safety by destroying vegetative cells without much lethal effects on endospores previously assumed to be of very limited safety consequence in acidified foods such as fruit juice. The emergence of Alicyclobacillus species as spoilage microorganisms that can survive pasteurization has posed serious challenge to the quality issues in the fruit juice industry.

* Corresponding author. Department of Microbiology, Faculty of Science, University of Lagos, Akoka, Lagos, Nigeria. E-mail address: [email protected] (F.A. Oguntoyinbo). http://dx.doi.org/10.1016/j.fm.2015.11.014 0740-0020/© 2015 Elsevier Ltd. All rights reserved.

Alicyclobacillus species are thermo-acidophilic, endosporeforming bacteria with distinct u-alicyclic fatty acids in their cell membranes (Wisotzkey et al., 1992). Due to the heat and acid tolerance of their endospores, Alicylobacillus spp. are capable of evading fruit juice pasteurization and subsequently germinating in the acidic fruit juices (Chang and Kang, 2004; Walker and Phillips, 2008; Durak et al., 2010). In fact pasteurization is believed to stimulate germination of Alicyclobacillus endospores (Gouws et al., 2005; Groenewald et al., 2008). Alicyclobacillus induced spoilage of fruit juices is usually devoid of spoilage attributes such as turbidity, heavy sediments, gas production or package swelling (Brown, 1995; Walls and Chuyate, 1998; Danyluk et al., 2011). Usually, spoilage is evidenced by phenolic or medicinal off flavours caused by guaiacol or the halophenols (Pettipher et al., 1997; Splittstoesser et al., 1998; Walls and Chuyate, 1998; Jensen and Whitfield, 2003; Chang and Kang, 2004; Bevilacqua et al., 2008). Guaiacol is a product of the non-oxidative decarboxylation of vanillic acid and the vanillic-acid

22

B.A. Osopale et al. / Food Microbiology 56 (2016) 21e28

decarboxylase (vdc) complex involved in this reaction has been identified in Alicyclobacillus and other taint producing microor
ganisms (Crawford and Olson, 1978; Chow et al., 1999; AlvarezRodr
Igue et al., 2003; Niwa and Kawamoto, 2003; Witthuhn et al., 2012). Several studies have reported the occurrence of Alicyclobacillus spp. in fruit juices and other acidic food products, ingredients and processing environments, indicating that the problem of Alicyclobacillus contamination is widespread (Splittstoesser et al., 1994; Yamazaki et al., 1996; Eiora et al., 1999; Jensen, 2000; Goto et al., 2008; Groenewald et al., 2009; Zhang et al., 2013). Many reports have also identified Alicyclobacillus acidoterrestris as the predominant spoilage Alicyclobacillus species due to its high occurrence in spoiled products, fruit juice processing environments, and its ability to produce taints in fruit juices (Goto et al., 2002; Matsubara et al., 2002; Chen et al., 2006; Walker and Phillips, 2008; Groenewald et al., 2009; Durak et al., 2010; Wang et al., 2010; Danyluk et al., 2011). Consequently, A. acidoterrestris is recognised as the target species for quality control in the fruit juice industry (Yamazaki et al., 1997; Goto et al., 2008). Other Alicyclobacillus relevant to the fruit juice industry include Alicyclobacillus acidiphilus, Alicyclobacillus herbarius, Alicyclobacillus pomorum and Alicyclobacillus genomic species 2 (Matsubara et al., 2002; Goto et al., 2002, 2003; Chen et al., 2006), however these species are rarely encountered (Niwa, 2004; Goto et al., 2008). Although Alicyclobacillus contamination of fruit juices and related materials have been widely studied and reported in many parts of the world, there is dearth of information about genetic diversity of Alicyclobacillus in West Africa and their spoilage potential during food processing. Previous studies have reported variations in the phenotypic characteristics and sensitivity of A. acidoterrestris strains to chemical treatments. For example, Goto et al. (2008) reported that the guaiacol production varied among strains of A. acidoterrestris isolated in Japan while Yamazaki et al. (2000) reported that the MIC of nisin against A. acidoterrestris varied among strains isolated from different geographical sources, highlighting the importance of considering diverse strains during the design of control strategies against A. acidoterrestris isolates. With the rapid growth of small and large scalefruit juice industry in W. Africa, it is important that product quality and shelflife are consistent in order to boost consumer confidence and prevent economic loss to manufacturers and retailers. As Alicyclobacillus spp. may impact negatively on the shelf-life of processed fruit juices, this study was conducted to identify the predominant Alicyclobacillus species in locally processed fruit juices in W. Africa, aimed at understanding of diverse strains of Alicyclobacillus as to facilitate development of strategy that can aid shelf-life improvement and mitigation of economic losses to fruit juice manufacturers in W. Africa.

glucose 1 g, distilled water - 1 L, pH 4.0 adjusted with 1 M hydrochloric acid) at 45  C for 48 h and streaked on YSG agar. Cultures of non-Alicyclobacillus strains were grown in 10 ml of either nutrient (Oxoid, Hampshire, England) or MRS broth (SigmaeAldrich, Steinheim, Switzerland) overnight at 37  C and streaked on appropriate agar. Working stock of cultures were maintained by biweekly transfer unto appropriate fresh agar and stored at 4  C throughout study.

2. Materials and methods

2.3.3. 16S rRNA gene sequencing Isolates positive to the genus-specific PCRs were identified by 16S rDNA sequencing. DNA was amplified with primers 27f and 1492r (Edwards et al., 1989; Eden et al., 1991; Weisburg et al., 1991) and the amplicons were sequenced with the BigDye terminator v3.1 cycle sequencing Kit (Applied Biosystems, USA) according to manufacturer's instructions. Forward and reverse sequences were aligned in Geneious 6.0.3 and identified using the BLAST algorithm (Altschul et al., 1990) to compare with existing DNA sequences in the NCBI/GenBank database (www.ncbi.nlm.nih.gov). DNA sequences were deposited in Genbank through BankIt.

2.1. Fruit juice samples and bacteria strains A total of 225 fruit juice products manufactured in Ghana (n ¼ 39) and Nigeria (n ¼ 186) were purchased from retailers between October 2012 and July 2014. The samples comprised single fruit juices and fruit juice blends (Table 1). The pH and soluble-solid contents (0Brix values) of the samples were determined with pH meter (Eutech instruments, USA) and refractometer (NSG Precision cells, USA) respectively. Cultures of A. acidoterrestris DSM 3922T and Alicyclobacillus acidocaldarius DSM 446T were obtained from the Department of Microbial, Biochemical and Food biochemistry, University of the Free State, South Africa. The strains were grown in 10 ml YSG broth (yeast extract 2 g, starch soluble - 2 g, D (þ)

2.2. Isolation of Alicyclobacillus from fruit juices Approximately 25 ml of fruit juices was suspended in 225 ml YSG broth (pH 3.7) in 500 ml Erlenmeyer flasks and the suspension was heat shocked at 80  C for 10 min (Pettipher et al., 1997). Samples were incubated aerobically at 45  C for 5 d. Turbid samples were streaked on YSG agar (pH 3.7) and incubated at 45  C for 5 d. Isolated colonies were picked and re-streaked until pure cultures were obtained. Stock cultures of isolates were prepared in YSG broth plus 30% (v/v) glycerol and stored at 80  C. Working stocks of isolates were maintained as described above. 2.3. Identification and typing of isolates 2.3.1. Genomic DNA extraction Isolates were grown in 10 ml YSG broth (pH 4) at 45  C for 24 h. Genomic DNA was isolated using a modified method of Than (2006). Cells were harvested by centrifugation at 16000 g for 1 min and pellets were suspended in 1 ml of 2 saline-sodium citrate (SSC) buffer (pH 7) followed by heating at 99  C for 10 min. The pellets were washed in 1 ml of RNase -TE buffer and added to equal volume (200 ml) of 0.2e0.5 mm glass beads (SigmaeAldrich, St. Louis, USA), chloroform (Merck, Modderfontein, South-Africa) and RNAse-TE buffer. The mixture was vortex for 10 min followed by centrifugation at 10 000 g for 10 min. The DNA supernatant was transferred to new microfuge tubes, stored at 20  C until used as template for PCR. 2.3.2. Genus-specific PCR For initial screening of isolates, genomic DNA was PCR amplified using primers Ali-Squalfw and Ali-Squalrev (Huch et al., 2010) which amplified a 275 base pairs (bp) segment of the shc gene. The PCR components included 2 U Taq polymerase (KAPA biosystems, USA), 1 reaction buffer, 2 mM Magnesium Chloride (KAPA biosystems, USA), 3.92% (v/v) dimethyl sulfoxide (Merck, USA), 1 mM primer {Integrated DNA technologies (IDT), South-Africa}, 1.5 mM deoxynucleotide solution mix (Thermo Fisher Scientific, USA), 0.2e1 ml DNA template and ultrapure water (Merck-Millipore, USA). Thermal cycling for this PCR and subsequent PCRs are described in Table 2.

2.3.4. Randomly amplified polymorphic DNA (RAPD) analysis Isolates identified as A. acidoterrestris were strain-typed according to the method of Yamazaki et al. (1997), using RAPD

B.A. Osopale et al. / Food Microbiology 56 (2016) 21e28

23

Table 1 Primers and PCR conditions used in the study. Primers

Sequence (50 e30 )

Product size (bp)

Thermal cycling

AliSqualfw AliSqualrev

TACTGGTGGGGGCCGCTWYTG CCGCCCTSGYTCTGAATGAA

275

94 oC for 3 min 1x 94 oC for 45 s 30x 55 oC for 30 s 72 oC for 30 s 72 oC for 2 min 1x

27f 1492r

AGAGTTTGATYMTGGCTCAG GGTTACCTTGTTACGACTT

1465

94 oC for 3 min 1x 94 oC for 45 s 55 oC for 1 min 30x 72 oC for 1 min 72 oC for 5 min 1x

Ba-10 F-61 F-64

AACGCGCAAC CCTGTGATGGGC GCCGCGCCAGTA

RAPD

94 oC for 3 min 1x 94 oC for 45 s 36a / 39b/ 46c oC for 45 s 72 oC for 2 min 72 oC for 10 min 1 x

Alif-GC AliR AliF

a

CGCCCGCCG CGCCCCGCGCCCGTC CCGCCGCCCCCGCCCG GCGAAGAAGGCCTTCGGGTTG TTATTGGGTTTCCTTCGGCACTG GCGAAGAAGGCCTTCGGGTTG

474

30x

94 oC for 3 min 1x 94 oC for 30 s 60 oC for 30 s 20x 72 oC for 30 s 72 oC for 30 s 1x

- Primer BA-10, b- Primer F-61, c-primer F-64, X-number of PCR cycles.

Table 2 Prevalence of Alicyclobacillus spp. in the different categories of W. African fruit juices surveyed. Fruit juice

Origin

No. of samples tested

No. of Alicyclobacillus positive samples (% positive)

Orange

Ghana Nigeria Ghana Nigeria Ghana Nigeria Ghana Ghana Ghana Nigeria Nigeria Nigeria Nigeria Nigeria Nigeria Nigeria Nigeria Nigeria

4 82 14 55 12 3 6 1 2 2 3 5 3 5 2 1 23 2 225

0 6 0 7 0 0 0 0 0 1 2 2 2 3 1 0 0 2 26

Pineapple Apple Tropical Passion Juice blenda Lemonade PineappleeCoconut OrangeePineapple OrangeePeach Guava Mango Blackcurrant Peach Total a

(0) (7.3) (0) (12.7) (0) (0) (0) (0) (0) (0) (66.7) (40) (66.7) (60) (50) (0) (0) (100) (11.5)

Fruit juice blends comprising more than 2 fruit types.

primers Ba-10, F-61 or F-64. RAPD fragments were analysed by electrophoresis (90 V for 1 h) on 1.5% agarose gels (Seakem® LE, USA) stained with 5 mg ml1 ethidium bromide (SigmaeAldrich, Germany), using the O'GeneRuler™ DNA ladder (Fermentas, USA) as molecular weight standard. Gel images were captured under ultraviolet (UV) illumination in a Bio-RAD Chemidoc XRS (BioRad laboratories, USA) and banding patterns were analysed by visual comparison. A. acidoterrestris DSM 3922T and A. acidocaldarius DSM 446T served as reference strains.

2.4. Guaiacol production by A. acidoterrestris strains The vdc activity in the isolates identified as A. aciodterrestris was measured by guaiacol production from vanillic acid (VA). One millilitre of 20 h-old cultures of test strains was inoculated into 150 ml YSG broth supplemented with 100 mg L1 VA (SigmaeAldrich, USA). Samples were incubated aerobically at 45  C and analysed for guaiacol production after 24 h. One-hundred and fifty millitres of sterile YSG broth supplemented with 100 mg L1 VA served as precursor control sample (without A. acidoterrestris) while 150 ml of YSG broth inoculated with A. acidoterrestris DSM

24

B.A. Osopale et al. / Food Microbiology 56 (2016) 21e28

3922T cells served as A. acidoterrestris control sample (without precursor). For analyses, 1 ml of sample was withdrawn and centrifuged twice at 10 000 g for 10 min. Five-hundred microlitres of supernatant was collected in sterile 1.5 ml centrifuged tubes (Eppendorf, Germany) and when not analysed immediately, samples were stored at 20  C until analysis. Guaiacol was detected in the samples by HPLC according to the method of Witthuhn et al. (2012), using HPLC Discovery HS C18 column (Sigma-Adrich, USA) and UV detection at 272 nm. Guaiacol and VA concentrations were measured by peak area determination using the Shimadzu LC solution calibration curve. The experiments were conducted in duplicate independently. 2.5. Alicyclobacillus-specific PCR-DGGE analysis (Primer design, PCR and DGGE) The 16S rRNA gene sequences of seven Alicyclobacillus spp. and nine closely related genera were retrieved from GenBank (http:// www.ncbi.nlm.nih.gov/) and aligned in Clustalx version 1.83. The alignment included DNA sequences of A. acidoterrestris (AB042057), A. acidocaldarius (AB059670), Alicyclobacillus cycloheptanicus (AB042059), Alicyclobacillus herbarius (AB042055), Alicyclobacillus hesperidum (AB059678), Alicyclobacillus acidophilus (AB059677), Alicyclobacillus sp. (AB059668), Aneurinibacillus migulanus (AB680889), Paenibacillus macerans (HM24663), Sulfobacillus acidophilus (AB089842), Bacillus subtilis (AB042061), Arthrobacter globiformis (AB089841), Krypidia tusciae (AB042062), Clostridium elmenteitii (AJ271453), Geobacillus subterraneus (AF276307) and Bacillus thermoleovorans (M77488). The alignment was examined for Alicyclobacillus unique sequences bordering a region of high interspecies variation. Two primers were identified within the consensus sequence, at positions 433e453 and 885e907, flanking an amplicon of 474 bp. A 40 bp GC-clamp was attached to the 5’ end of the forward primer for enhanced DGGE separation (Sheffield et al., 1989; Muzyer et al., 1993). The specificity of primers was tested in silico in geneious 6.0.3 and experimentally confirmed by PCR amplification of the DNA extracted from Alicyclobacillus and non-Alicyclobacillus species. Primers AliF (forward), AliF-GC and AliR (reverse) were commercially synthesized by IDT, South-Africa. Genomic DNA extracted from A. acidoterrestris 3922T, A. acidocaldarius 446T and Alicyclobacillus genomic species 1 ULAG28, and eleven Alicyclobacillus-positive fruit juices were amplified with primers AliF-GC and AliR. DGGE separation of amplicons was conducted in a BioRad DCode™ Universal Mutation Detection System (Bio-Rad Laboratories, USA). 20 ml of sample [15 ml PCR product plus 5 mL orange loading dye (Thermo Scientific)] was loaded onto 7% acrylamide/bis-acrylamide gels containing a 40e65% urea-formamide denaturant gradient. DGGE was run at constant 100 V for 16.30 h. Thereafter gels were stained with 10 mg ml1 ethidium bromide and photographed under ultraviolet illumination in a Bio-RAD gel dock. The AliF-GC/AliR amplicons of individual Alicyclobacillus species were loaded on DGGE gels and used as reference markers for DGGE identification of Alicyclobacillus contaminants in fruit juices. In addition to the individual Alicyclobacillus markers, a DNA ladder comprising the three Alicyclobacillus species was loaded on one side of the gel to facilitate band-to-band comparison. The ladder was established by mixing equal volume (0.2 ml) of the genomic DNA of the three Alicyclobacillus spp. followed by PCR amplification with primers AliF-GC and AliR. Dominant DNA bands were excised from DGGE gel, eluted in 2 distilled water, re-amplified with primers AliF and AliR and identified by DNA sequencing as described above. DGGE analysis of fruit juices was conducted in duplicate, starting from DNA extraction through

DGGE separation. 3. Results 3.1. Isolation and identification A total of 225 fruit juice samples produced in Ghana and Nigeria were analysed for Alicyclobacillus contamination. Of these, Alicyclobacillus was detected in 26 (11.6%) samples. The positive juice samples included orange, guava, pineapple, peach, lemonade and fruit juice blends (Table 1). Alicyclobacillus was not detected in the apple, tropical, mango, blackcurrant or passion juice products. Also, all Alicyclobacillus-positive samples originated from Nigeria and a zero occurrence was observed among fruit juices samples from Ghana. A total of 26 presumptive Alicyclobacillus isolates were subjected to genus-specific PCR targeting the shc gene. This produced a 275 bp fragment which was identical in size to that reported for A. acidoterrestris DSM 3922T, A. acidoterrestris DSM 2498, A. acidiphilus DSM 14558T and A. acidocaldarius DSM 446T by Huch et al. (2010) (data not shown). All isolates positive to the genus specific PCR were subsequently identified by DNA sequence analysis of the 16S rRNA gene (Table 3). The comparison between the obtained DNA sequences and the nucleotide sequences in GenBank identified 16 isolates as close relatives (99e100% homology) of A. acidoterrestris, seven as A. acidocaldarius (99% homology) and three as Alicyclobacillus sp. 1 (100% homology) (Table 3). The DNA sequence data were deposited in GenBank under the following accessions; KF880694, KF880695, KF880696, KF880697, KF880698, KF880699, KF880700, KF880701, KF880702, KF880703, KF880704, KF880705, KF880706, KF880707, KF880708, KF880709, KF880711, KF880713. 3.2. RAPD fingerprinting Genotypic diversity among the 16 isolates identified as A. acidoterrestris was confirmed by RAPD-PCR, which grouped the isolates into two genotypic clusters (Fig. 1). The three RAPD primers clearly distinguished isolates ULAG8 and ULAG9 from the other 14 A. acidoterrestris isolates and the type strain A. acidoterrestris DSM 3922T. Also the banding pattern of A. acidocaldarius DSM 446T was distinct from those of all A. acidoterrestris strains (Fig. 1). 3.3. Guaiacol production by A. acidoterrestris strains The vdc activity in A. acidoterretris isolates was assayed by measuring guaiacol production in YSG broth supplemented with VA and inoculated with A. acidoterrestris strains. The guaiacol concentrations detected after 24 h incubation of different A. acidoterrestris strains in YSG-VA broth ranged from 29.06 to 36.9 mg L1 (SD 0.18e5.0), (Fig. 2). Additionally, VA concentrations ranging from 1.150 to 6.585 mg L1 were observed in the samples after 24 h incubation, indicating reduction in initial VA concentrations. Guaiacol was not detected in the VA and A. acidoterrestris control samples. 3.4. Primer specificity and DGGE analysis In silico primer specificity test in geneious 6.0.3 showed that primers AliF and AliR produced PCR products only when the primer-pair were annealed to DNA sequences of Alicyclobacillus species (data not shown). Experimentally, Alicyclobacillus species produced PCR products of the expected size with primers AliF and AliR whereas the non-Alicyclobacillus species, as expected, showed no signals of the expected fragment size.

B.A. Osopale et al. / Food Microbiology 56 (2016) 21e28

25

Table 3 Identities of isolates based on 16S rRNA gene sequence analysis. Isolate

Source (Juice type)

Sequence length

Closest GenBank relative

Similarity (%)

GenBank Accession no

ULAG1 ULAG2 ULAG3 ULAG4 ULAG5 ULAG6 ULAG7 ULAG8 ULAG9 ULAG10 ULAG11 ULAG12 ULAG13 ULAG18 ULAG19 ULAG20 ULAG23 ULAG31 ULAG32 ULAG33 ULAG36 ULAG37 ULAG38 ULAG28 ULAG34 ULAG35

Lemonade Orange Orange Lemonade PineappleeCoconut Peach 5 fruits blend Orange Orange Peach OrangeePineapple Pineapple Pineapple Pineapple Pineapple PineappleeCoconut OrangeePineapple Pineapple OrangeePeach Pineapple Orange Pineapple Guava Orange OrangeePeach OrangeePeach

1409 1408 1057 1408 1418 1408 1373 1202 1415 1422 1408 1374 1404 1409 1332 1293 1053 1009 1083 1098 1383 1086 1081 1411 1010 1310

A. acidoterrestris A. acidoterrestris A. acidoterrestris A. acidoterrestris A. acidoterrestris A. acidoterrestris A. acidoterrestris A. acidoterrestris A. acidoterrestris A. acidoterrestris A. acidoterrestris A. acidoterrestris A. acidoterrestris A. acidoterrestris A. acidoterrestris A. acidoterrestris A. acidocaldarius A. acidocaldarius A. acidocaldarius A. acidocaldarius A. acidocaldarius A. acidocaldarius A. acidocaldarius Alicyclobacillus sp. 1 Alicyclobacillus sp. 1 Alicyclobacillus sp. 1

100 100 100 100 100 100 100 99 99 100 100 100 100 100 100 100 99 99 99 99 99 99 99 100 100 100

KF880704 KF880694 NA KF880697 KF880698 KF880701 KF880702 NA KF880707 KF880709 KF880711 NA KF880713 NA NA NA KF880699 KF880695 KF880696 KF880700 KF880703 KF880705 KF880706 KF880708 NA NA

NA- Not available.

DGGE analyses of the AliF-GC/AliR amplicons of individual Alicyclobacillus species is shown in Fig. 3. The three Alicyclobacillus species displayed different electrophoretic mobility on DGGE gel therefore making discrimination among them possible. Each Alicyclobacillus sp. also had a corresponding band in the molecular ladder loaded on the DGGE gel (Fig. 3). Subsequently, the DGGE fingerprints of the three Alicyclobacillus species were used as markers for DGGE analysis of 11 confirmed Alicyclobacillus-positive fruit juices. By comparing query DGGE bands with Alicyclobacillus species DGGE markers, A. acidoterrestris, A. acidocaldarius and Alicyclobacillus sp. were detected and identified in the 11 fruit juices analysed by DGGE. The position of A. acidoterrestris on the DGGE gel was distinct from that of A. acidocaldarius and this permitted clear discrimination between the common spoilage and non spoilage Alicyclobacillus spp. detected in the Nigerian fruit juices. DNA sequencing confirmed identity-match between dominant DNA bands in the sample lanes and the corresponding reference Alicyclobacillus band. DNA sequencing also confirmed that the identity of the DGGE band detected in each fruit juice sample was the same as the Alicyclobacillus species isolated from the particular fruit juice. 4. Discussion Alicyclobacillus species constitute a quality challenge to the fruit juice industry due to their ability to evade fruit juice pasteurization and subsequently cause product spoilage especially in tropical ambient temperature. In this study Alicyclobacillus contamination of commercial fruit juices in W. Africa was investigated. Alicyclobacillus was detected in 11.6% of the total samples analysed (n ¼ 225), representing 14% of the Nigerian fruit juice products tested. The positive fruit juice types included orange, pineapple, lemonade, peach, guava, and fruit juice blends. The pH of the positive juice samples ranged from 2.8 to 4.08 (data not shown), indicating a suitable environment for Alicyclobacillus germination (Goto et al., 2007; Walker and Phillips, 2008). Surprisingly, Alicyclobacillus was not detected in any of the apple juice products tested both from Ghana and Nigeria. This is contrary to the report of

previous studies which identified apple juice as highly susceptible to Alicyclobacillus contamination (Cerny et al., 1984; Chang and Kang, 2004; Chen et al., 2006; Durak et al., 2010; Oteiza et al., 2011). The results of DNA sequence analyses revealed three Alicyclobacillus contaminants in Nigerian fruit juices as A. acidoterrestris, A. acidocaldarius and Alicyclobacillus species 1. Similarly to studies conducted elsewhere, A. acidoterrestris was the most commonly encountered species (Goto et al., 2007; Durak et al., 2010; Danyluk et al., 2011; Zhang et al., 2013). A. acidoterrestris is currently regarded as the target Alicyclobacillus species in the fruit juice industry due to its heat resistance, ability to produce taints and high occurrence in spoiled products, raw materials and processing environments (Yamazaki et al., 1997; Chang and Kang, 2004; Walker and Phillips, 2008; Maldonado et al., 2013). A. acidocaldarius has also been isolated previously from spoiled fruit juices, fruit orchard, raw materials and fruit processing environments (Gouws et al., 2005; Groenwald et al., 2008, 2009; Danyluk et al., 2011). However, there are conflicting reports on the ability of this species to produce guaiacol and cause product spoilage (Niwa, 2004; Gouws et al., 2005; Goto et al., 2007). Nevertheless the occurrence of A. acidoterrestris in fruit juice products suggests soil contamination of production processes, since the microorganism is soil-borne and maybe introduced into production line through contaminated fruit surfaces and production areas (Chang and Kang, 2004). Alicyclobacillus species 1 was described as a putative species of Alicyclobacillus which belongs to the A. acidocaldarius group (Albuquerque et al., 2000; Goto et al., 2007). Although this bacterium is not known to produce guaiacol (Goto et al., 2007), its occurrence in juice products also suggests soil contamination as the organism was initially isolated from soil materials (Albuquerque et al., 2000). The presence of A. acidocaldarius and Alicyclobacillus genomic species in fruit juices highlights the need for adherence to good manufacturing practices by manufacturers of fruit juice products. Confirmation of genotypic diversity using RAPD-PCR grouped the 16 isolates identified as A. acidoterrestris into two genotypic clusters. This is similar to the observation of Yamazaki et al. (1997)

26

B.A. Osopale et al. / Food Microbiology 56 (2016) 21e28

Fig. 1. RAPD fingerprints of A. acidoterrestis isolates obtained from Nigerian fruit juices, using primer Ba-10 (A), F-61 (B) and F-64 (C). Lanes: M O'GeneRuler™ DNA ladder mix; 1A. acidoterrestris DSM 3922T; 2- ULAG1; 3- ULAG2; 4- ULAG3; 5- ULAG4; 6- ULAG5; 7- ULAG6; 8-ULAG7; 9-ULAG10; 10-ULAG11; 11-ULAG12; 12-ULAG13; 13-ULAG18; 14-ULAG19; 15-ULAG20; 16-ULAG8; 17-ULAG9; 18- A. acidocaldarius DSM 446T.

Fig. 2. Guaiacol concentrations detected after 24 h incubation of YSG-VA samples inoculated with A. acidoterrestris DSM 3922T and A. acidoterrestris strains isolated from Nigerian fruit juice. Data represents the mean of duplicate independent experiments and vertical bars denote standard deviations.

which reported the existence of two RAPD types among

A. acidoterrestris isolates obtained from various environmental and food samples in Japan. The occurrence of genotypic diversity among A. acidoterrestris strains may imply variation in their sensitivity to physical or chemical treatments. For example Yamazaki et al. (2000) reported that the minimum inhibitory concentration of nisin varied among different A. acidoterrestris strains tested. Bevilacqua et al. (2014) reported similar observation when lysozyme was tested against different strains of A. acidoterrestris. Further research is required to establish the phenotypic implication of the RAPD diversity observed among the A. acidoterrestris strains reported in this study especially in relation to the inactivation of the isolates. Alicyclobacillus induced spoilage of fruit juices is attributable to the presence of guaiacol or the halophenols (2, 6-dibromophenol and 2, 6-dichlorophenol) which cause medicinal off-flavours in the fruit juice products (Pettipher et al., 1997; Jensen and Whitfield, 2003). Guaiacol-producing Alicyclobacillus spp. includes A. acidoterrestris, A. aciciphilus, A. herbarius and Alicyclobacillus genomic species 2 (Goto et al., 2007). However, A. acidoterrestris was the only guaiacol-producing species isolated in this study. HPLC analysis revealed that all the 16 isolates identified as A. acidoterrestris could produce guaiacol from vanillic acid,

B.A. Osopale et al. / Food Microbiology 56 (2016) 21e28

27

Acknowledgements The authors thank the European Union and the Polytechnic of Namibia for the award of INTRA-ACP STREAM Mobility fellowship to BAO the IFS support for FAO. We also thank Prof. Esta Van Heerden and Elizabeth Ojo for assistance with DGGE analysis. The leave of absence granted BAO by Babcock University, Ilishan-Remo, Nigeria that facilitated his collaboration with University of the Free State, South Africa is gratefully acknowledged. References

Fig. 3. DGGE separation of PCR amplicons of Alicyclobacillus spp. generated using primers AliF-GC and AliR. Lanes: A e A. acidoterrestris; B e Alicyclobacillus genomic species 1; C e A. acidocaldarius; M molecular ladder composed of (from top to bottom) a e A. acidoterrestris, b e Alicyclobacillus genomic species 1, c e A. acidocaldarius. Bands: a e A. acidoterrestris; b- Alicyclobacillus genomic species 1; c e A. acidocaldarius. Osopale et al.

indicating their capacity to cause product spoilage. The concentration of guaiacol detected in each A. acidoterrestris sample was also greater than the 0.002 mg L1 threshold for smelling guaiacol in orange, apple, noncarbonated drinks and other materials as reported by Pettipher et al. (1997) and Orr and Beuchat (2000). In order to ensure that manufacturers of fruit juices and related products avoid unnecessary application of extreme measures for inactivation of Alicyclobacillus spores in their products which may adversely affect the organoleptic quality of products, it is necessary to differentiate guaiacol producing and non-guaiacol producing Alicyclobacillus spp. to confirm spoilage potential of the Alicyclobacillus contaminant (Chang and Kang, 2004). In this study, a simple PCR-DGGE method was used to differentiate between guaiacol producing A. acidoterrestris and non-spoilage A. acidocaldarius and Alicyclobacillus genomic sp. 1. Taxon-specific PCR-DGGE protocols have been previously used successfully to identify microbes of medical, environmental and industrial importance (Salles et al., 2002; Fontana et al., 2005; Yergeau et al., 2005; Mavragani et al., 2011). The procedure described herein was based on the migration of unknown DGGE fragments to corresponding positions with known Alicyclobacillus spp. markers on DGGE gel. The method was also sensitive in detecting Alicyclobacillus spp. in naturally contaminated pineapple, guava, orange and mixed fruit drinks such as orangeepeach and pineappleecoconut drinks. The Alicyclobacillus-specific PCR-DGGE method described in this study may therefore serve as alternative to culture-based methods for the detection of Alicyclobacillus spp. and differentiation of A. acidoterrestris from A. acidocaldarius which are the two most commonly encountered Alicyclobacillus species in fruit juice products (Gouws et al., 2005; Goto et al., 2006; Durak et al., 2010; Danyluk et al., 2011). In conclusion this is the first report on the isolation of Alicyclobacillus in West Africa, a confirmation that the problem of Alicyclobacillus contamination is widespread and global. The results revealed three Alicyclobacillus spp. that are present in Nigerian fruit juices with the A. acidoterrestris isolates showing potential to cause product spoilage. Information provided by this study is fundamental to the development of effective strategies for the improvement of quality and shelf-life of processed fruit juices in W. Africa.

Albuquerque, L., Rainey, F.A., Chung, A.P., Sunna, A., Nobre, M.F., Grote, R., Antranikian, G., da Costa, M.S., 2000. Alicyclobacillus hesperidum sp. nov. and a ~o Miguel in the Azores. Int. J. related genomic species from solfataric soils of Sa Syst. Evol. Microbiol. 50, 451e457. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403e410.

Igue, M.L., Belloch, C., Villa, M., Uruburu, F., Larriba, G., Coque, J., 2003. Alvarez-Rodr Degradation of vanillic acid and production of guaiacol by microorganisms isolated from cork samples. FEMS Microbiol. Lett. 220, 49e55. Bevilacqua, A., Ciuffreda, E., Sinigaglia, M., Corbo, M.R., 2014. Effects of lysozyme on Alicyclobacillus acidoterrestris under laboratory conditions. Int. J. Food Sci Tech. 49, 224e229. Bevilacqua, A., Sinigaglia, M., Corbo, M.R., 2008. Alicyclobacillus acidoterrestris: new methods for inhibiting spore germination. Int. J. Food Microbiol. 125, 103e110. Brown, K.L., 1995. New microbiological spoilage challenges in aseptics: Alicyclobacillus acidoterrestris spoilage in aseptically packaged fruit juices. In: Ohlsson, T. (Ed.), Proceedings of the International Symposium Advances in Aseptic Processing and Packaging Technologies. The Swedish Institute for Food Research, Gteborg, Sweden. Cerny, G., Hennlich, W., Porolla, K., 1984. Spoilage of fruit juices by bacilli: isolation and characterization of the spoiling microorganisms. Z. für Lebensm. -Forschung A 179, 224e227. Chang, S., Kang, D., 2004. Alicyclobacillus spp. in fruit juice industry: history, characteristics and current isolation/detection procedures. Cri. Rev. Microbiol. 30, 55e74. Chen, S., Tang, Q., Zhang, X., Zhao, G., Hu, X., Liao, X., Chen, F., Wu, J., Xiang, H., 2006. Isolation and characterization of thermo-acidophilic endospore-forming bacteria from the concentrated apple juice-processing environment. Food Microbiol. 23, 439e445. Chow, K.T., Pope, M.K., Davies, J., 1999. Characterization of a vanillic acid nonoxidative decarboxylation gene cluster from Streptomyces sp. D7. Microbiology 145, 2393e2403. Crawford, R.L., Olson, P.P., 1978. Microbial catabolism of vanillate: decarboxylation to guaiacol. Appl. Environ. Microbiol. 36 (4), 539e543. Danyluk, M.D., Friedrich, L.M., Jouquand, C., Goodrich-Schneider, R., Parish, M.E., Rouseff, R., 2011. Prevalence, concentration, spoilage, and mitigation of Alicyclobacillus spp. in tropical and subtropical fruit juice concentrate. Food Microbiol. 28, 472e477. Durak, M.Z., Churey, J.J., Danyluk, M.D., Worobo, R.W., 2010. Identification and haplotype distribution of Alicyclobacillus spp. from different juices and beverages. Int. J. Food Microbiol. 142, 286e291. Eden, P.A., Schmidt, T.M., Blakemore, R.P., Pace, N.R., 1991. Phylogenetic analysis of Aquaspirillum magnetotacticum using polymerase chain reaction-amplified 16S rRNA-specific DNA. Int. J. Syst. Bacteriol. 41, 324e325. €cker, H., Emde, M., Bo €ttger, E.C., 1989. Isolation and direct Edwards, U., Rogall, T., Blo complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. Nucleic Acids Res. 17, 7843e7853. Eiora, M.N., Junqueira, V.C., Schmidt, F.L., 1999. Alicyclobacillus in orange juice: occurrence and heat resistance of spores. J. Food Prot. 62, 883e886. Fontana, C., Vignoloa, G., Cocconcelli, P.S., 2005. PCReDGGE analysis for the identification of microbial populations from Argentinean dry fermented sausages. J. Microbiol. Methods 63, 253e263. Goto, K., Nishibori, A., Wasada, Y., Furuhata, K., Fukuyama, M., Hara, M., 2008. Identification of thermo-acidophilic bacteria isolated from the soil of several Japanese fruit orchards. Lett. Appl. Microbiol. 46, 289e294. Goto, K., Mochida, K., Asahara, M., Suzuki, M., Kasai, H., Yokota, A., 2003. Alicyclobacillus pomorum sp. nov., a novel thermo-acidophilic, endospore-forming bacterium that does not possess u-alicyclic fatty acids, and emended description of the genus Alicyclobacillus. J. Syst. Evol. Microbiol. 53, 1537e1544. Goto, K., Mochida, K., Kato, Y., Asahara, M., Ozawa, C., Kasai, H., Yokota, A., 2006. Diversity of Alicyclobacillus isolated from fruit juices and their raw materials and emended description of Alicyclobacillus acidocaldarius. Microbiol. Cult. Collect. 22, 1e14. Goto, K., Tanaka, T., Yamamoto, R., Susuki, T., Tokuda, H., 2007. Characteristics of Alicyclobacillus. In: Alicyclobacillus: Thermophilic Acidophilic Bacilli. Springer, Japan, pp. 9e48. Goto, K., Tanimoto, Y., Tamura, T., Mochida, K., Arai, D., Asahara, M., Suzuki, M., Tanaka, H., Inagaki, K., 2002. Identification of thermoacidophilic bacteria and a new Alicyclobacillus genomic species isolated from acidic environments in

28

B.A. Osopale et al. / Food Microbiology 56 (2016) 21e28

Japan. Extremophiles 6, 333e340. Gouws, P.A., Gie, L., Pretorius, A., Dhansay, N., 2005. Isolation and identification of Alicyclobacillus acidocaldarius by 16S rDNA from mango juice and concentrate. Int. J. Food Sci. Technol. 40, 789e792. Groenewald, W.H., Gouws, P.A., Witthuhn, R.C., 2009. Isolation, identification and typification of Alicyclobacillus acidoterrestris and Alicyclobacillus acidocaldarius strains from orchard soil and the fruit processing environment in South Africa. Food Microbiol. 26, 71e76. Groenewald, W.H., Gouws, P.A., Witthuhn, R.C., 2008. Isolation and identification of species of Alicyclobacillus from orchard soil in the Western Cape, South Africa. Extremophiles 12, 159e163. €cker, J., Saskia, V., Hanak, A., Gr€ Huch, M., Müller, A., Strohha af, V., Stahl, M., Franz, C.M.A.P., 2010. Use of UV-C treatment for the inactivation of microorganisms. Fruit Process. 196e201. Jensen, N., Whitfield, F.B., 2003. Role of Alicyclobacillus acidoterrestris in the development of a disinfectant taint in shelf-stable fruit juice. Lett. Appl. Microbiol. 36, 9. Jensen, N., 2000. Alicyclobacillus in Australia. Food Aust. 52, 282e285. Maldonado, C.M., Aban, M.P., Navarro, R.A., 2013. Chemicals and lemon essential oil effect on Alicyclobacillus acidoterrestris viability. Bra. J. Microbiol. 44 (4), 1133e1137. Matsubara, H., Goto, k., Matsumura, T., Mochida, K., Iwaki, M., Niwa, M., Yamasato, k, 2002. Alicyclobacillus acidiphilus sp. nov., a novel thermo-acidophilic, u-alicyclic fatty acidcontaining bacterium isolated from acidic beverages. Int. J. Syst. Evol. Microbiol. 52, 1681e1685. Mavragani, D., Hamel, C., Vujanovic, V., 2011. Species-specific PCR-DGGE markers to distinguish Pyrenophora species associated to cereal seeds. Fungal Biol. 115, 169e175. Muzyer, G., De Waal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbial populations by denaturaing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59, 695e700. Niwa, M., Kawamoto, A., 2003. Development of a rapid detection method of A. acidoterrestris, hazardous bacteria to acidic beverage. Fruit Process. 13, 102e107. Niwa, M., 2004. Control of Hazardous Bacteria in Acidic Beverages by Using a Guaiacol Detection Kit (Peroxidase Method) [WWW document]. http://www. cosmobio.co.jp/export_e/products/kits/products_KYO_20050412/Guaiakol_ detection_kit_reference.pdf, 29 January 2007. Orr, R.V., Beuchat, L.R., 2000. Efficiency of disinfectants in killing spores of Alicyclobacillus acidoterrestris and performance of media for supporting colony development by survivors. J. Food Prot. 63, 1117e1122. Oteiza, J.M., Ares, G., Sant'Ana, S.A., Soto, S., Giannuzzi, L., 2011. Use of multivariate approach to ass the incidence of Alicyclobacillus spp. in concentrate fruit juices marketed in Argentina: results of a 14-year survey. Int. J. Food Microbiol. 151, 229e234. Pettipher, G.L., Osmundson, M.E., Murphy, J.M., 1997. Methods for the detection and

enumeration of Alicyclobacillus acidoterrestris and investigation of growth and production of taint in fruit juice and fruit juice-containing drinks. Lett. Appl. Microbiol. 24, 185e189. Salles, J.F., De Souza, F.A., van Elsas, J.D., 2002. Molecular method to assess the diversity of Burkholderia species in environmental samples. Appl. Environ. Microbiol. 68, 1595e1603. Sheffield, V.C., Cox, D.R., Lerman, L.S., Myers, R.M., 1989. Attachment of 40-base-pair G þC-rich sequence (GC-clamp) to genomic DNA fragments by the polymerase chain reaction results in improved detection of single-base changes. Proc. Nat. Acad. Sci. U. S. A. 86, 232e236. Splittstoesser, D.F., Churey, J.J., Lee, C.Y., 1994. Growth characteristics of aciduric sporeforming bacilli isolated from fruit juices. J. Food Prot. 57, 1080e1083. Splittstoesser, D.F., Lee, C.Y., Churey, J.J., 1998. Control of Alicyclobacillus in the juice industry. Dairy Food Environ. Sanit. 18, 585e587. Than, V.N., 2006. Lipomyces orientalis sp. nov., a yeast species isolated from soil in Vietnam. Int. J. Syst. Evol. Microbiol. 56, 2009e2013. Walker, M., Phillips, C.A., 2008. Alicyclobacillus acidoterrestris: an increasing threat to the fruit juice industry? Int. J. Food Sci.Tech. 43, 250e260. Walls, I., Chuyate, R., 1998. Alicyclobacillus e historical perspective and preliminary characterization study. Dairy Food Environ. Sanitat. 18, 499e503. Wang, Y., Yue, T., Yuan, Y., Gao, Z., 2010. Isolation and identification of thermoacidophilic bacteria from orchards in China. J. Food Prot. 73, 390e394. Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, D.J., 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173, 697e703. Wisotzkey, J.D., Jurtshuk, P., Fox, G.E., Deinhart, G., Poralla, K., 1992. Comparative sequence analyses on the 16S rRNA (rDNA) of Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus and proposal for creation of a new genus, Alicyclobacillus gen., nov. Int. J. Syst. Bacteriol. 42, 263e269. Witthuhn, R.C., Van der Merwe, E., Venter, P., Cameron, M., 2012. Guaiacol production from ferulic acid, vanillin and vanillic acid by Alicyclobacillus acidoterrestris. Int. J. Food Microbiol. 157, 113e117. Yamazaki, k, Murakami, M., Kawai, Y., Inoue, N., Matsuda, T., 2000. Use of nisin for inhibition of Alicyclobacillus acidoterrestris in acidic drinks. Food Microbiol. 17, 315e320. Yamazaki, K., Okubo, T., Inoue, N., Shinano, H., 1997. Randomly amplified polymorphic DNA (RAPD) for rapid identification of the spoilage bacterium Alicyclobacillus acidoterrestris. Biosci. Biotech. Biochem. 61, 1016e1018. Yamazaki, K., Teduka, H., Shinano, H., 1996. Isolation and identification of Alicyclobacillus acidoterrestris from acidic beverages. Biosci. Biotechnol. Biochem. 60, 543e545. Yergeau, E., Filion, M., Vujanovic, V., St-Arnaud, M., 2005. A PCR-denaturing gel electrophoresis approach to assess Fusarium diversity in asparagus. J. Microbiol. Methods 60, 143e154. Zhang, J., Yue, T., Yuan, Y., 2013. Alicyclobacillus contamination in the production line of Kiwi products in China. PLoS One 8 (7), e67704. http://dx.doi.org/ 10.1371/journal.pone.0067704.