ORIGINAL ARTICLE
The Clinical Respiratory Journal
Curcumin attenuates staphylococcus aureus-induced acute lung injury Feng Xu1,2*, Ran Diao2,3*, Jin Liu1, Yanhua Kang4, Xuanding Wang2 and Liyun Shi4 1 Department of Infectious Diseases, Second Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, China 2 Department of Respiratory Medicine, Second Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, China 3 Center for Allergy, Second Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, China 4 Division of Immunology, Hangzhou Normal University, Hangzhou, China
Abstract Introduction: Curcumin has remarkable anti-inflammatory and antioxidant properties. However, its effects on bacterium-induced acute lung injury (ALI) are not fully understood. Objective: To investigate the protective effects of curcumin on a mouse model of S. aureus-induced ALI. Methods: Mice were pretreated with intraperitoneal injection of curcumin or vehicle 2 h before Staphylococcus aureus instillation. The survival rate and bacterial burden after infection were recorded. Mice were sacrificed for the analyses of severity of pneumonia, integrity of lung barrier, disorder of coagulation cascades and extent of inflammation 12 h postinfection. The production of proinflammatory cytokines and chemokines in the lung and bronchoalveolar lavage fluid was detected. Results: Pretreatment with curcumin markedly attenuated S. aureus-induced pneumonia, barrier disruption, lung edema and vascular leakage. Activation of plasminogen activator inhibitor-1 and infiltration of neutrophils were reduced by curcumin, together with lower levels of proinflammatory cytokines and chemokines. Conclusion: Curcumin can alleviate S. aureus-induced ALI through multiple pathways. Please cite this paper as: Xu F, Diao R, Liu J, Kang Y, Wang X and Shi L. Curcumin attenuates staphylococcus aureus-induced acute lung injury. Clin Respir J 2015; 9: 87–97.
Key words acute lung injury – curcumin – Staphylococcus aureus Correspondence Liyun Shi, PhD, Division of Immunology, Hangzhou Normal University, 310036 Hangzhou, China. Tel: +86-571-28865632 Fax: +86-571-28865632 email: [email protected] Received: 12 August 2013 Revision requested: 13 January 2014 Accepted: 21 January 2014 DOI:10.1111/crj.12113 Authorship and contributorship F. X. and L. S. designed the study and wrote the manuscript. R. D., J. L., and Y. K. performed the experiments. X. W. analyzed the data. Ethics This study was approved by the Regional Ethics Committee. Conflict of interest The authors have declared that no competing interests exist. *These authors equally contribute to this manuscript.
Introduction Acute lung injury (ALI) is a severe clinical condition characterized as respiratory distress, refractory hypoxemia and noncardiogenic pulmonary edema, together with widespread lung inflammation and loss of epithelial and endothelial integrity (1). Severe pneumonia or sepsis is the primary cause of ALI (2). As a major pathogen in both community-acquired and nosoco-
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
mial infections (3, 4), Staphylococcus aureus (S. aureus) leads to a diverse spectrum of infections including lifethreatening pneumonia and septicemia and is recognized as one of main Gram-positive bacteria for ALI (5). These highly virulent staphylococci were responsible for more estimated deaths than HIV/AIDS in the United States (6). Despite the improvements in critical care and mechanical ventilation treatment, the mortality of
87
Curcumin attenuates S. aureus-induced ALI
pneumonia or sepsis with ALI is still high (1). Various strategies such as reducing bacterial load and attenuating exaggerated inflammation are under extensive evaluation (7, 8). Curcumin, as a naturally derived component from the rhizome of turmeric (Curcuma longa), has remarkable anti-inflammatory and antioxidant properties (9). A number of animal experiments revealed that curcumin attenuates the liver injury (10), kidney injury (11) and notably ALI caused by a variety of factors such as ischemia–reperfusion injury (12), lung transplantation (13), exposure to diesel exhaust particles (14), cecal ligature puncture (15) and Gramnegative Klebsiella pneumoniae intranasal infection (16). Although ALI caused by Gram-positive or Gramnegative bacteria infection shares clinical similarities, the pathogenesis underneath is distinguished (17). In this study, the protective effects of curcumin were evaluated on an experimental mouse model of S. aureus-induced pneumonia and ALI.
Materials and methods Ethics statement All animal experiments were in accordance with the ‘Guide for the Care and Use of Laboratory Animals’ and were approved by the Animal Care and Use Committee at Zhejiang University and Hangzhou Normal University.
S. aureus-induced ALI animal model Pathogen-free, 8-week-old female C57BL/6 mice, weighing between 18–20 g were used. Mice were purchased from the Animal Center of Slaccas (Shanghai, China) and maintained in the animal facility of Zhejiang University School of Medicine and Hangzhou Normal University. Fifty microliters of S. aureus isolated from clinics (18) or equal volume of phosphatebuffered saline (PBS) was inoculated directly into the trachea of lightly anesthetized mice. For anesthetic, 90 mg/kg of 1.5% pentobarbital in PBS was intraperitoneally (i.p.) injected. After intratracheal instillation, the mice were kept vertical for 1 min to ensure the distribution of the bacteria in the lung. In the pilot studies, no differences were revealed between the mice pretreated with curcumin or vehicle following mock (PBS) infection (data not shown). For the following experiments, mice were divided randomly into three experimental groups: (i) group CUR + SA: mice i.p. injected with 50 mg/kg of curcumin (Sigma-Aldrich Co., St. Louis, MO, USA) 2 h prior to S. aureus infection (11); (ii) group SA: mice i.p.
88
Xu et al.
injected with vehicle 2 h prior to infection; (iii) group PBS: mice i.p. injected with vehicle 2 h prior to mock infection with PBS. Of these, one setting of experiment was performed to check the viability and behavior of the mice by examining them every 12 h up to 5 days. The other experiment were performed 12 h or/and 24 h postinfection. The whole lung was harvested and homogenized for quantitative bacterial culture, myeloperoxidase activity determination, RNA extraction for quantitative real-time polymerase chain reaction (qRT-PCR) and protein extraction for Western blot. Bronchoalveolar lavage (BAL) fluid was collected for enumerating the number of total white cells and, and pathological staining were performed, respectively (n = 9–10 for each group).
Histopathological changes in S. aureus-infected mice The whole lungs of mice were fixed with 10% paraformaldehyde and embedded with paraffin. Fivemicrometer sections were sliced for hematoxylin and eosin (H&E) staining. Morphometric analysis was conducted under an automatic photo-microscope (Leica Biosystems, Nussloch, Germany). The number of neutrophils and alveolar sacs were determined in a blinded fashion (19). Three lung sections from each mice were analyzed and six randomly selected highpower fields (HPFs) (100×) were examined for each section. The extent of crowded area defined as the region of thickened septa in lung parenchyma associated with partial or complete collapse of alveoli on H&E-stained sections, also determined in a blinded fashion, was scored as follows: 0 = no detectable crowded area; 1 ≤ 15% of crowded area; 2 = 15–25% of crowded area; 3 = 25–50% of crowded area; 4 = 50– 75% of crowded area; 5 ≥ 75%–100% of crowded area/ HPF (100×) (20).
Pulmonary vascular leakage and lung edema Pulmonary vascular leakage was measured by Evans blue dye (EBD) method (13). In brief, 50 mg/kg of EBD (Sigma-Aldrich, St. Louis, MO, USA) was intravenously injected into the caudal vein of the mice 1 h prior to the termination of the experiment, when thoracotomy was performed and a 9-gauge cannula was inserted into the pulmonary artery through the incised left atrium of the heart. The pulmonary vasculature was flushed with PBS containing 5–mM of ethylenediaminetetraacetic acid till the flushed out fluid was clean in appearance. Afterwards, the lungs were removed, immersed into dimethyl formamide
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
Xu et al.
(3 mL/100 mg of lung tissue) and incubated at 60°C for 24 h, and centrifuged at 1700 × g for 5 min. The supernatant was collected and the optical density of which was measured by spectrophotometry at 620 nm. EBD concentration in the lung tissue was calculated against a standard curve. The status of lung pulmonary edema was measured by lung wet/dry ratio (13). The whole lung was removed and the weight was recorded as wet weight. After the whole lung was dried out by placing in an oven at 60°C for 48 h, the weight was recorded as dry weight.
Cell counting and measurement of proteins, cytokines in BAL fluid The BAL fluid was collected by lavaging the lungs with 1 mL of sterile PBS for three times. After the erythrocytes were lysed using lysis buffer (eBioscience, San Diego, CA, USA), the total cell number was counted. 2 × 105 cells were loaded onto a slide by cytospin (Statspin, Westwood, MA, USA) and stained with Giemsa stain (BASO, Zhuhai, China) for neutrophil counting. The cell-free BAL fluids were applied for enzyme-linked immunosorbent assays (ELISA) to measure the concentration of keratinocyte-derived chemokine (KC), macrophage inflammatory protein (MIP)-2, interleukin (IL)-1β, tumor necrosis factor (TNF)-α, IL-6 and transforming growth factor (TGF)-β (all kits from R&D systems Inc., Minneapolis, MN, USA) according to the manufacturer’s protocol. Total protein concentration was measured by BCA Protein Assay Kit (Beyotime, China).
Myeloperoxidase (MPO) activity and bacterial load in lung tissue The whole lung was excised, weighed and homogenized with 1 mL of PBS. Part of homogenate was taken out and directly used for quantitative bacterial culture. The rest of homogenate was divided and used to prepare samples for measurement of MPO activity, Western blot, and qRT-PCR, respectively. For the quantitative bacterial culture, 20 μL of homogenate was 1:10 serially diluted with PBS from 10−1 to 10−9. Five microliters of diluted homogenate was inoculated on a blood agar plate and incubated at 37°C for 24 h. The number of colonies was counted for the quantification of bacteria and expressed as colony-forming unit (CFU) per lung. MPO activity from lung homogenates was determined using a MPO standard from Sigma, according to the manufacturer’s recommendations.
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
Curcumin attenuates S. aureus-induced ALI
Western blot for the detection of plasminogen activator inhibitor-1 (PAI-1) and pIκB-α Lung homogenate containing protease inhibitor cocktail (Rothe, Basel, Switzerland) was sonicated and centrifuged at 12 000 × g for 30 min at 4°C. The supernatant was collected. For cultured cells, 1 × 106 cells were lysed with 1% NP40 with protease inhibitor cocktail. Forty-microgram protein from each lung was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis, transferred onto a PVDF membrane (Millipore, Billerica, MA, USA). The membrane was blocked with 5% BSA blocking solution, probed with antibody against PAI-1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), HMGB1(Abcam, Cambridge, MA, USA), or pIκB-α (Cell Signaling Technology, Danvers, MA, USA) followed by HRP-linked secondary antibody (Santa Cruz). Immunoreactive proteins were detected using the chemiluminescence HRP Substrate detection system (Millipore) and visualized under Chemi DocTM XRS+ imaging system (BIO-RAD, Hercules, CA, USA). Equal protein loading was verified by stripping and reprobing of membranes with antibody against β-actin (Santa Cruz).
qRT-PCR for proinflammatory genes expression Lung homogenate was conducted for RNA extraction with Trizol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized using reverse transcriptase cDNA synthesis system (Ferments, Waltham, MA, USA). Two micrograms of total RNA and random primers were included in the reaction. The real-time semi-qRT-PCR was performed in triplicates using the SYBR Green PCR assay and an ABI IQTM apparatus (both from Applied Biosystems, Foster, CA, USA). Primers were designed using Primer 5. The sequences for the primers were summarized in Table 1. β-actin was amplified as an endogenous reference gene. Expression of target genes was measured after normalization RNA with the reference gene, as fold increased expression above control calculated by corrected ΔΔ with a Sequence Detection Software version 1.2.3 (Applied Biosystems).
NF-κB activation in bone marrow-derived macrophages (BMDM) and detection of inflammatory cytokines Bone marrow cells were isolated and differentiated into BMDM in the presence of macrophage colonystimulating factor (M-CSF) (21). On day 7, the 89
Curcumin attenuates S. aureus-induced ALI
Xu et al.
Table 1. Primers used for quantitative real-time polymerase chain reaction experiments Gene
Forward primers (5′-3′)
Reverse primers (5′-3′)
β-actin kc mip-2 il-1β tnf-α il-6 tgf-β
AGAGGGAAATCGTGCGTGAC ACCCAAACCGAAGTCATA CCCAGACAGAAGTCATAGC CCTCCTTGCCTCTGATGG AATAACGCTGATTTGGTGA TTCCAGAAAC CGCTATGA TCAGACATTCGGGAAGCAG
CAATAGTGATGACCTGGCCGT GGTGCCATCAGA GCAGT TCCTTTCCAGGTCAGTTA AGTGCTGCCTAATGTCCC ACCCGTAGGGCG ATTACA GGTTGTCACCAGCATCAG AGCCACTCAGGCGTATCAG
available BMDMs were stimulated with S. aureus using a multiplicity of infection of 10 in the presence or absence of 20 μM of curcumin for 15, 30, 60 or 120 min before cells were lysed with 1% NP40 lysis buffer with protease inhibitor cocktail for Western blot. The phosphorylation level of IκB-α was detected as a marker for NF-κB activation. BMDMs were co-cultured with 20 μM of curcumin or PBS for 2 h, then stimulated with S. aureus (MOI : 10) for 12 h. The culture supernatant was collected and detected for the concentrations of IL-6 and KC (both ELISA kits from R&D systems, Inc., Minneapolis, MN, USA).
Results Survival rate and bacterial burden Curcumin moderately improved the survival rates in mice infected with S. aureus, although no significant difference between curcumin- and vehicle-treated groups (P = 0.067, Fig. 1A). Enumeration of S. aureus bacteria in the lungs from infected mice revealed that the replication of the bacteria was also mildly inhibited in curcumin pretreatment of mice, both at 12 h and 24 h post infection. However, no statistically significant changes were observed in bacterial load between two groups (P > 0.05, Fig. 1B).
Statistical analysis Survival curves were compared using the log–rank test. For other data, statistical significance was determined using two-tailed unpaired t-test, two-tailed Mann– Whitney U-test (for CFU) or one-way ANOVA corrected for multiple comparisons as appropriate. A P value of 0.05 or less was considered as statistically significant.
Histopathological change We next sought to evaluate the severity of the S. aureus-induced lung pneumonia and ALI. Histopathological examination revealed that S. aureusinfected lungs were apparently enlarged and red. H&E staining of sliced lung tissues presented with prominent thickening of alveolar walls and accumulation of
Figure 1. Curcumin (CUR) moderately affected the survival and bacterial burden upon S. aureus (SA) infection. (A) Survival curves for mice with or without the pretreatment of curcumin after infection with S. aureus, relative to mock-infected controls. Representative data from two independent experiments with similar results were shown. n = 5 for ( ) control mice and n = 10 each for ( ) SA and ( ) SA+CUR mice. (B) Loads of S. aureus in the whole lung homogenate 12 h and 24 h after infection were expressed as mean ± standard error of the mean. n = 9 per group. CFU, colony-forming units.
90
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
Xu et al.
Curcumin attenuates S. aureus-induced ALI
(A)
(C)
(D)
60
20 0
0.5
+S A R U C
+S A R U C
C
SA
S PB
+S A R
1.0
0.0
U
PB
SA
0
1.5
SA
20
* 40
*
*
S
40
2.0
*
PB
*
Crowded score
*
Number of alveoli
60
S
Number of neutrophils
(B)
Figure 2. Curcumin (CUR) reduced the morphological scores of S. aureus (SA) pneumonia. (A) Hematoxylin and eosin staining of lung tissues derived from mice 12 h after infection with a LD50 inoculation of S. aureus. (B) Semi-quantitative evaluations for lung histopathological scores with number of neutrophils. (C) Alveoli sac counts and (D) crowed score. n = 6 per group. *P < 0.01. PBS, phosphate-buffered saline.
inflammatory cells. Edema and accumulation of inflammatory cells within alveolar spaces were obvious in some areas. Consolidated air spaces with no intact alveolar structure could also be observed. Remarkably, the pretreated mice with curcumin showed greater preservations of lung tissue with remarkably reduced infiltration of inflammatory cells, alveolar wall thickening and edema after infection (Fig. 2A). Semiquantitative evaluations for lung histopathological scores proved reduced neutrophil infiltration (Fig. 2B), increased alveoli sac counts (Fig. 2C) and reduced extent of alveoli crowded area (Fig. 2D) with curcumin pretreatment (P < 0.01 for all).
Pulmonary blood-gas barrier function As major components of pulmonary gas-blood barrier, the dysfunction of epithelial and endothelial cells results in the efflux of protein-rich fluid into interstitial tissue and distal airspaces of the lung. To evaluate the barrier function, lung wet/dry ratio was assessed to measure lung pulmonary edema, and total protein in BAL fluid and absorbance (Evans blue) of DMF
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
extracts were assessed to measure vascular leak. As indicated in the Fig. 3, the exposure of mice with LD50 of S. aureus resulted in the dysfunction of lung barrier function, which was significantly attenuated by curcumin pretreatment (P < 0.01 for all).
Coagulation cascades Alteration in coagulation and fibrinolysis is another feature for ALI. We evaluated the expression of PAI-1, a strong independent predictor of mortality for ALI. Proteins from lungs of S. aureus-infected mice were extracted and checked for the expression of PAI-1 by Western blot. The pulmonary infection of S. aureus caused increased expression of PAI-1 in the lung, whereas pretreatment of curcumin effectively reduced the abundance of PAI-1 in the infected mice (Fig. 4).
Pulmonary inflammation During the course of S. aureus-induced pneumonia, the early recruitment of neutrophils (polymorphonuclear, PMNs) to the lung plays an important role in 91
Curcumin attenuates S. aureus-induced ALI
EBD (µg/g)
3000 2000 1000
*
30 20 10
0
+S A U
R
SA C
C
PB S
0
U
R
+S A
SA
3.0
*
40
+S A
3.5
*
R
4.0
50
*
U
4.5
4000
C
*
SA
*
5.0
(C)
PB S
5.5
BAL protein concentration, µg/mL
(B)
PB S
Lung wet/dry weight ratio
(A)
Xu et al.
Figure 3. Curcumin (CUR) preserved the barrier functions upon S. aureus (SA) challenge. (A) Lung wet/dry ratio. n = 4 for control group, n = 6 for SA, SA+CUR group, respectively. (B) Total protein concentration in bronchial lavage (BAL) fluid. n = 8 mice per group. (C) Evans blue dye (EBD) concentration in the lung tissue 12 h after intratracheal infection of S. aureus. n = 6 per group. *P < 0.01. PBS, phosphate-buffered saline.
eradication of the bacteria. Nevertheless, sustained and overreacted neutrophils lead to uncontrolled inflammation, contributing to the development of ALI. Consistent with the histopathological analysis we showed above, the number of total cells in the BAL fluid was increased during S. aureus infection (12, 22), and neutrophils accounted for almost all of the total cell population. Pretreatment of curcumin, however, substantially reduced the number of total cells and neutrophils (Fig. 5A and 5B). Consistently, MPO, an enzyme marker of neutrophilic infiltration, was significantly lower in mice pretreated with curcumin compared with that in the untreated mice 12 h postinfection (Fig. 5C). ELISA results revealed that in response to S. aureus infection, the concentrations of KC, IL-1β, MIP-2, TNF-α, IL-6 and TGF-β in the BAL fluid were elevated to high levels, whereas pretreatment of curcumin significantly decreased their expression (Fig. 5D–I).
Figure 4. Curcumin (CUR) reduced the expression of lung plasminogen activator inhibitor (PAI-1) caused by S. aureus (SA) infection. PAI-1 expression was detected by Western blot analysis of lung homogenate from mice 12 h after S. aureus inoculation (upper panel). Equal protein loading was verified by stripping and reprobing of membranes with antibody against β-actin (lower panel). PBS, phosphate-buffered saline; MW, molecular weight.
92
Inflammatory cytokine expression Several genes encoding for inflammatory cytokines and chemokines were assessed at the transcription level. QRT-PCR analyses demonstrated that transcription of kc, il-1β, mip-2, tnf-α, il-6 and tgf-β genes was upregulated in the lungs 12 h postinfection. Pretreatment of curcumin resulted in the downregulated expression of the genes, except for il-6 (Fig. 6A–F).
NF-κB regulation and inflammatory cytokine production Macrophages play a key role in releasing cytokines, largely through NF-κB-mediated pathway during the infection. BMDMs were then generated in vitro to test the effect of curcumin in response to S. aureus infection. Activation of NF-κB was assessed by detecting the phosphorylation level of IκB-α by Western blot. As depicted in Fig. 7, a rapid phosphorylation of IκB-α could be detected 15 min post infection, lasting till at least 60 min and diminishing at 120 min. Strikingly, co-culture of the cells with curcumin resulted in the downregulation of IκB-α phosphorylation. Accordingly, the production of inflammatory cytokines, including IL-6 and KC, was significantly decreased in the infected BMDM by curcumin pretreatment (Fig. 8). These results suggested that alleviated effects of curcumin on S. aureus-induced inflammatory response were at least partially through regulation of NF-κB activation.
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
Xu et al.
Curcumin attenuates S. aureus-induced ALI
*
U
R
+S A
SA
PB S
C
3000 2000 1000
C
U
R
+S A
SA
S PB
R U
5000
*
*
100 50
+S A U
R
SA
S PB
C
U
R
SA C
C
+S A
0 PB S
+S A
+S A
S
C
10000
U
R
SA
PB
+S A
150 *
0
0
4000
(I) TGF-beta/BAL TGF-beta (pg/mL)
500
*
*
0
U
(H) IL-6/BAL 15000 IL-6 (pg/mL)
1000
S
+S A
2000
C
U
1500
PB
R
4000
R
SA
S
R
PB
+S A
SA
PB
2000
0
U
6000
0
C
*
5
5000
*
*
0
*
10
C
*
500
0
*
*
12 h post infection
MIP-2 (pg/mL)
*
15
(F) MIP-2/BAL
8000
SA
10
(E) KC/BAL
1500 1000
20
6 h post infection
KC (pg/mL)
20
(G) TNF-alpha/BAL TNF-alpha (pg/mL)
0
U IL-1beta (pg/mL)
*
30
2500
5
C
U C
(D) IL-1 beta/BAL
S
MPO (units per lung)
(C) MPO/BAL *
10
12 h post infection
6 h post infection
40
*
*
SA
+S A
0
15
S
5
20
PB
*
10
R
+S A
SA
S
0
*
R
5
15
SA
10
20
PB S
*
Number of neutrophils in BALF (×105 cells/mL)
Total cell count in BALF (×105 cells/mL)
*
15
PB
Total cell count in BALF (×105 cells/mL)
20
Number of neutrophils in BALF (×105 cells/mL)
(B) PMN/BAL
(A) Total cells/BAL
Figure 5. Curcumin (CUR) attenuated S. aureus (SA)-induced lung inflammation. (A–B) Bronchial lavage (BAL) fluid (BALF) analysis of the number of total cells and neutrophils 6 h and 12 h after infection. (C) Analysis of myeloperoxidase (MPO) activity from lung homogenate 12 h after infection. Levels of (D) keratinocyte-derived chemokine (KC), (E) interleukin (IL)-1β, (F) macrophage inflammatory protein (MIP)-2, (G) tumor necrosis factor (TNF)-α, (H) IL-6, and (I) transforming growth factor (TGF)-β in BALF were detected by enzyme-linked immunosorbent assay at 12 h after infection. n = 5–9 per group. *P < 0.01. PBS, phosphate-buffered saline; PMN, polymorphonuclear neutrophils.
Discussion S. aureus can induce severe pneumonia together with overwhelming inflammation, microvascular leakage and thrombosis, and lung edema in immunocompetent mice. Our study demonstrated that pretreatment of curcumin significantly attenuated S. aureus-induced inflammation and injury. S. aureus replicates at the site of infection and produces surface proteins such as adhesins, protein A and secreted exoproteins, including toxins, hemolysins, and tissue-degrading enzymes (23, 24). S. aureus-produced α toxin is essential for the secretion of newly synthesized CXC chemokines (KC and MIP-2) and neutrophil recruitment into the airway (22). Protein A, which
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
is expressed on S. aureus cell walls, interacts with the TNF-α-receptor (TNFR-1) on the respiratory epithelium, thereby activating NF-κB and subsequent expression of inflammatory cytokines such as IL-8 (22). As the first site of contact with inhaled agents, epithelial cells produce a number of mediators such as reactive oxygen radicals, cytokines (TNF-α, IL-1β, GM-CSF), and platelet-activating factor to recruit inflammatory cells onto the site of inflammation (25). There is widespread activation of the innate immune response, following the initial host-microbial interaction. Macrophages play a key role in releasing not only the classic proinflammatory cytokines such as IL-1, IL-6 and TNF-α, but also an array of other cytokines including chemokines of KC, MIP-2 (18). Taken 93
Curcumin attenuates S. aureus-induced ALI
(B) KC
10
1000
3 2 1
S
30 20 10
10 5
S PB
C
U
R
+S A
SA
S PB
R U SA +C
SA
S PB
*
*
0
0
0
U C
# tgfb fold of change
il6 fold of change
4
PB
+S A R U C
(F) TGF-beta 15
* *
tnfa fold of change
SA
S (E) IL-6 40
*
5
PB
C U R +S A
SA
S PB (D) TNF-alpha
200 0
0
0
400
+S A
20
2000
R
30
*
*
C U R +S A
40
(C) MIP-2 600
*
*
SA
* kc fold of change
il1b fold of change
3000
mip2 fold of change
*
50
SA
(A) IL-beta
Xu et al.
Figure 6. Expression of proinflammatory cytokines was decreased by curcumin (CUR) administration. 12 h after S. aureus (SA) infection, relative gene expression levels of (A) interleukin (IL)-1β, (B) keratinocyte-derived chemokine (KC), (C) macrophage inflammatory protein (MIP)-2, (D) tumor necrosis factor (TNF)-α, (E) IL-6, and (F) transforming growth factor (TGF)-β were measured by quantitative real-time polymerase chain reaction analyses. n = 12–16 mice per group. *P < 0.01, #P > 0.05. PBS, phosphatebuffered saline.
together, the exposure of host cells to live S. aureus and their virulence factors induces diverse injuries including degradation of host tissue and inactivation of host defense mechanisms, thus the disease severity is determined by the balance between this organism and the host’s innate immune defense system (25). In this study, we established a lethal S. aureus pneumonia model in immunocompetent adult mice. Earlier studies have revealed aspects of S. aureus infection in lungs and epithelial cells. Early S. aureus pneumonia in
mice is featured by the releasing of proinflammatory cytokines/chemokines and rapid recruitment of neutrophils to the site of infection (26, 27). The overproduction of interleukins IL-1, IL-6, IL-8 is rapidly induced after activation of the nuclear factor-kappaB (NF-κB) pathway (28). In mice with lethal S. aureus pneumonia, active replication of S. aureus in the lungs and the over-expression of inflammatory and coagulation proteins are dominant (27, 29). In addition, in vitro study revealed that intracellular S. aureus
Figure 7. Curcumin (CUR) inhibited the activation of NF-κB upon S. aureus (SA) stimulation. Western blot analyses of phosphorylation of IκB-α (upper panel) in bone marrow-derived macrophages stimulated by S. aureus for 15 min, 30 min, 60 min and 120 min. β-actin expression is depicted as the loading control (lower panel). MW, molecular weight; PBS, phosphate-buffered saline.
94
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
Xu et al.
Curcumin attenuates S. aureus-induced ALI
Figure 8. Curcumin (CUR) pretreatment inhibited the inflammatory response in bone marrow-derived macrophages (BMDM) stimulated with S. aureus (SA). Enzyme-linked immunosorbent assay of interleukin (IL)-6 and keratinocytederived chemokine (KC) in supernatant from infected BMDM pretreated with or without 20 μM of curcumin. *P < 0.05.
in epithelial cells upregulated the transcription of a panel of proinflammatory genes including TNF-α, IL-1β, IL-6, IL-8, CCL-20, COX-2 (30). In addition to their roles in recruiting neutrophils to the site of an infection and enhancing their anti-bacterial function, the proinflammatory cytokines of TNF-α, IL-1 and IL-6 have been shown to activate the coagulation pathways and attenuate fibrinolytic activity, which are hallmarks of alveolar inflammation (25). The presence of high plasma levels of PAI-1 indicated that impaired coagulation pathways might be a feature for ALI initiated by lipopolysaccharides and other microbial components (17). S. aureus, via plasminogen binding and nonproteolytic activation, as well as secreting staphylococcal metalloprotease aureolysin, substantially impairs host’s fibrinolytic system (31). On the other side, proinflammatory cytokines, in particular IL-1 and IL-6, are also powerful inducers of coagulation (32). TGF-β is considered to be a key profibrotic protein (33) and was shown to transcriptionally regulate gene encoding PAI-1 expression (34). In this study, we revealed that application of curcumin can significantly downregulate the overexpression of PAI-1 in the lung. It could result from its anti-inflammatory effect or directly rectify the coagulation pathways impaired by S. aureus components. The anti-inflammatory and anti-apoptotic effects of curcumin enabled its applications in various organ injuries, e.g. renal or lung ischemia–reperfusion injury (11, 12), lung transplantation-associated lung injury (12), neutrophil-induced lung injury and sepsis by cecal ligation and puncture (10, 15, 35, 36), pulmonary and cardiovascular injury by repeated exposure to diesel exhaust particles in mice (14). Although lung injuries due to acute bacterial infections remain a major cause of mortality, to date there was only one report studying the effects of curcumin against pulmonary inflammation generated during Klebsiella pneumoniae B5055infection in BALB/c mice (16). Indeed, we utilized the
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
S. aureus-induced pneumonia and ALI model and revealed that curcumin could attenuate the inflammation, albeit having no major effects on bacterial burden in the lung. NF-κB is involved in the regulation of gene expression in the early processes of immune and inflammatory responses, including the activation of a number of inflammatory cytokines (e.g. TNF-α, IL-1β, IL-6 and IL-8) (28, 37). NF-κB activation is tightly regulated by its endogenous inhibitor of IκB, which complexes with NF-κB in the cytoplasm (38). Curcumin has been shown to inhibit phosphorylation and proteolytic degradation of IκB and prevent the release and nuclear transmigration of NF-κB (13, 39). Upon bacterial infection, macrophages, originating in bone marrow and reaching the lung through blood circulation, reside in the airways, alveoli and lung interstitium or migrate into the lung microvasculature. They constitute the first line of defense in recognizing various pathogens and trigger the production of cytokines and chemokines (40). The inflammatory mediators subsequently promote neutrophil accumulation and local inflammation (41, 42). In this study, we showed a direct inhibitory effect of curcumin on the activation of NF-κB on BMDM. It has been reported that curcumin promoted the apoptosis of activated neutrophils via activation of the p38 mitogen-activated protein kinase pathway, which was recognized as a mechanism of its anti-inflammatory effect (36, 43). Here we revealed another novel mechanism of direct inhibition of macrophage activation by curcumin via the inhibition of NF-κB. Our study demonstrated that curcumin protects against lung tissue injury in a mouse model of S. aureus-induced ALI. Those effects are potentially related to the inhibition of NF-κB-regulated inflammation pathways. Curcumin could be a potential adjuvant agent for treating ALI caused by bacterial infection. 95
Curcumin attenuates S. aureus-induced ALI
Acknowledgements This work was supported by grants from National Natural Science Foundation of China (81370176, 81270066), Ministry of Education of China (NCET12-0484), Natural Science Foundation of Zhejiang Province (LR12H01003) and Science and Technology Department of Zhejiang Province (2011R10027, 2012C33017).
References 1. Johnson ER, Matthay MA. Acute lung injury: epidemiology, pathogenesis, and treatment. J Aerosol Med Pulm Drug Deliv 2010;23(4): 243–52. 2. Tsushima K, King LS, Aggarwal NR, De Gorordo A, D’Alessio FR, Kubo K. Acute lung injury review. Intern Med. 2009;48(9): 621–30. 3. Klevens RM, Morrison MA, Nadle J, et al. Invasive methicillin-resistant Staphylococcus aureus infections in the United States. JAMA. 2007;298(15): 1763–71. 4. Otto M. Basis of virulence in community-associated methicillin-resistant Staphylococcus aureus. Annu Rev Microbiol. 2010;64: 143–62. 5. Schreiber MP, Chan CM, Shorr AF. Bacteremia in Staphylococcus aureus pneumonia: outcomes and epidemiology. J Crit Care. 2011;26(4): 395–401. 6. Chastre J. Evolving problems with resistant pathogens. Clin Microbiol Infect. 2008;14(Suppl. 3): 3–14. 7. Ware LB, Matthay MA. The acute respiratory distress syndrome. N Engl J Med. 2000;342: 1334–49. 8. Xu F, Hu Y, Zhou J, Wang X. Mesenchymal stem cells in acute lung injury: are they ready for translational medicine? J Cell Mol Med. 2013;17: 927–35. 9. Menon VP, Sudheer AR. Antioxidant and antiinflammatory properties of curcumin. Adv Exp Med Biol. 2007;595: 105–25. 10. Siddiqui AM, Cui X, Wu R, Dong W, Zhou M, Hu M, Simms HH, Wang P. The anti-inflammatory effect of curcumin in an experimental model of sepsis is mediated by up-regulation of peroxisome proliferatoractivated receptor-gamma. Crit Care Med. 2006;34(7): 1874–82. 11. Awad AS, El-Sharif AA. Curcumin immune-mediated and anti-apoptotic mechanisms protect against renal ischemia/reperfusion and distant organ induced injuries. Int Immunopharmacol. 2011;11(8): 992–6. 12. Sun J, Yang D, Li S, Xu Z, Wang X, Wang X, Bai C. Effects of curcumin or dexamethasone on lung ischaemia-reperfusion injury in rats. Eur Respir J. 2009;33(2): 398–404. 13. Sun J, Guo W, Ben Y, Jiang J, Tan C, Xu Z, Wang X, Bai C. Preventive effects of curcumin and dexamethasone on lung transplantation-associated lung injury in rats. Crit Care Med. 2008;36(4): 1205–13.
96
Xu et al.
14. Nemmar A, Subramaniyan D, Ali BH. Protective effect of curcumin on pulmonary and cardiovascular effects induced by repeated exposure to diesel exhaust particles in mice. PLoS ONE. 2012;7(6): e39554. 15. Xiao X, Yang M, Sun D, Sun S. Curcumin protects against sepsis-induced acute lung injury in rats. J Surg Res. 2012;176(1): e31–9. 16. Bansal S, Chhibber S. Curcumin alone and in combination with augmentin protects against pulmonary inflammation and acute lung injury generated during Klebsiella pneumoniae B5055-induced lung infection in BALB/c mice. J Med Microbiol. 2010;59(Pt 4): 429–37. 17. Cohen J. The immunopathogenesis of sepsis. Nature. 2002;420(6917): 885–91. 18. Xu F, Kang Y, Zhang H, Piao Z, Yin H, Diao R, Xia J, Shi L. Akt1-mediated regulation of macrophage polarization in a murine model of Staphylococcus aureus pulmonary infection. J Infect Dis. 2013;208(3): 528–38. 19. Sun CK, Lee FY, Sheu JJ, et al. Early combined treatment with cilostazol and bone marrow-derived endothelial progenitor cells markedly attenuates pulmonary arterial hypertension in rats. J Pharmacol Exp Ther. 2009;330(3): 718–26. 20. Sun CK, Yen CH, Lin YC, et al. Autologous transplantation of adipose-derived mesenchymal stem cells markedly reduced acute ischemia-reperfusion lung injury in a rodent model. J Transl Med. 2011;9: 118. 21. Chin AI, Dempsey PW, Bruhn K, Miller JF, Xu Y, Cheng G. Involvement of receptor-interacting protein 2 in innate and adaptive immune responses. Nature. 2002;416(6877): 190–4. 22. Gomez MI, Lee A, Reddy B, Muir A, Soong G, Pitt A, Cheung A, Prince A. Staphylococcus aureus protein A induces airway epithelial inflammatory responses by activating TNFR1. Nat Med. 2004;10(8): 842–8. 23. Novick RP, Muir TW. Virulence gene regulation by peptides in staphylococci and other Gram-positive bacteria. Curr Opin Microbiol. 1999;2(1): 40–5. 24. Li M, Diep BA, Villaruz AE, Braughton KR, Jiang X, DeLeo FR, Chambers HF, Lu Y, Otto M. Evolution of virulence in epidemic community-associated methicillin-resistant Staphylococcus aureus. Proc Natl Acad Sci U S A. 2009;106(14): 5883–8. 25. Sethi S, Chakraborty T. Role of TLR-/NLR-signaling and the associated cytokines involved in recruitment of neutrophils in murine models of Staphylococcus aureus infection. Virulence. 2011;2(4): 316–28. 26. Skerrett SJ, Liggitt HD, Hajjar AM, Wilson CB. Cutting edge: myeloid differentiation factor 88 is essential for pulmonary host defense against Pseudomonas aeruginosa but not Staphylococcus aureus. J Immunol. 2004;172(6): 3377–81. 27. Ventura CL, Higdon R, Hohmann L, Martin D, Kolker E, Liggitt HD, Skerrett SJ, Rubens CE. Staphylococcus aureus elicits marked alterations in the airway proteome during early pneumonia. Infect Immun. 2008;76(12): 5862–72.
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
Xu et al.
28. Moreilhon C, Gras D, Hologne C, Bajolet O, Cottrez F, Magnone V, Merten M, Groux H, Puchelle E, Barbry P. Live Staphylococcus aureus and bacterial soluble factors induce different transcriptional responses in human airway cells. Physiol Genomics. 2005;20(3): 244–55. 29. Inoshima I, Inoshima N, Wilke GA, Powers ME, Frank KM, Wang Y, Bubeck Wardenburg J. A Staphylococcus aureus pore-forming toxin subverts the activity of ADAM10 to cause lethal infection in mice. Nat Med. 2011;17(10): 1310–4. 30. Li X, Fusco WG, Seo KS, Bayles KW, Mosley EE, McGuire MA, Bohach GA. Epithelial cell gene expression induced by intracellular Staphylococcus aureus. Int J Microbiol. 2009;753278. 31. Beaufort N, Wojciechowski P, Sommerhoff CP, Szmyd G, Dubin G, Eick S, Kellermann J, Schmitt M, Potempa J, Magdolen V. The human fibrinolytic system is a target for the staphylococcal metalloprotease aureolysin. Biochem J. 2008;410(1): 157–65. 32. Moldoveanu B, Otmishi P, Jani P, Walker J, Sarmiento X, Guardiola J, Saad M, Yu J. Inflammatory mechanisms in the lung. J Inflamm Res. 2009;2: 1–11. 33. Lee CG, Kang HR, Homer RJ, Chupp G, Elias JA. Transgenic modeling of transforming growth factor-beta(1): role of apoptosis in fibrosis and alveolar remodeling. Proc Am Thorac Soc. 2006;3(5): 418–23. 34. Kutz SM, Hordines J, McKeown-Longo PJ, Higgins PJ. TGF-beta1-induced PAI-1 gene expression requires MEK activity and cell-to-substrate adhesion. J Cell Sci. 2001;114(Pt 21): 3905–14. 35. Thiemermann C. The spice of life: curcumin reduces the mortality associated with experimental sepsis. Crit Care Med. 2006;34(7): 2009–11.
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
Curcumin attenuates S. aureus-induced ALI
36. Hu M, Du Q, Vancurova I, Lin X, Miller EJ, Simms HH, Wang P. Proapoptotic effect of curcumin on human neutrophils: activation of the p38 mitogen-activated protein kinase pathway. Crit Care Med. 2005;33(11): 2571–8. 37. Fujisawa N, Hayashi S, Kurdowska A, Noble JM, Naitoh K, Miller EJ. Staphylococcal enterotoxin A-induced injury of human lung endothelial cells and IL-8 accumulation are mediated by TNF-alpha. J Immunol. 1998;161(10): 5627–32. 38. Kim DI, Kim SR, Kim HJ, Lee SJ, Lee HB, Park SJ, Im MJ, Lee YC. PI3K-gamma inhibition ameliorates acute lung injury through regulation of IkappaBalpha/NF-kappaB pathway and innate immune responses. J Clin Immunol. 2012;32(2): 340–51. 39. Jobin C, Bradham CA, Russo MP, Juma B, Narula AS, Brenner DA, Sartor RB. Curcumin blocks cytokinemediated NF-kappa B activation and proinflammatory gene expression by inhibiting inhibitory factor I-kappa B kinase activity. J Immunol. 1999;163(6): 3474–83. 40. Nakata K, Gotoh H, Watanabe J, et al. Augmented proliferation of human alveolar macrophages after allogeneic bone marrow transplantation. Blood. 1999;93(2): 667–73. 41. Bender AT, Ostenson CL, Wang EH, Beavo JA. Selective up-regulation of PDE1B2 upon monocyte-to-macrophage differentiation. Proc Natl Acad Sci U S A. 2005;102(2): 497–502. 42. Burns AR, Smith CW, Walker DC. Unique structural features that influence neutrophil emigration into the lung. Physiol Rev. 2003;83(2): 309–36. 43. Lee PJ. An old spice with new twists: curcumin, p38 mitogen-activated protein kinase, and apoptosis. Crit Care Med. 2005;33(11): 2703–5.
97
The Clinical Respiratory Journal
Curcumin attenuates staphylococcus aureus-induced acute lung injury Feng Xu1,2*, Ran Diao2,3*, Jin Liu1, Yanhua Kang4, Xuanding Wang2 and Liyun Shi4 1 Department of Infectious Diseases, Second Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, China 2 Department of Respiratory Medicine, Second Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, China 3 Center for Allergy, Second Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, China 4 Division of Immunology, Hangzhou Normal University, Hangzhou, China
Abstract Introduction: Curcumin has remarkable anti-inflammatory and antioxidant properties. However, its effects on bacterium-induced acute lung injury (ALI) are not fully understood. Objective: To investigate the protective effects of curcumin on a mouse model of S. aureus-induced ALI. Methods: Mice were pretreated with intraperitoneal injection of curcumin or vehicle 2 h before Staphylococcus aureus instillation. The survival rate and bacterial burden after infection were recorded. Mice were sacrificed for the analyses of severity of pneumonia, integrity of lung barrier, disorder of coagulation cascades and extent of inflammation 12 h postinfection. The production of proinflammatory cytokines and chemokines in the lung and bronchoalveolar lavage fluid was detected. Results: Pretreatment with curcumin markedly attenuated S. aureus-induced pneumonia, barrier disruption, lung edema and vascular leakage. Activation of plasminogen activator inhibitor-1 and infiltration of neutrophils were reduced by curcumin, together with lower levels of proinflammatory cytokines and chemokines. Conclusion: Curcumin can alleviate S. aureus-induced ALI through multiple pathways. Please cite this paper as: Xu F, Diao R, Liu J, Kang Y, Wang X and Shi L. Curcumin attenuates staphylococcus aureus-induced acute lung injury. Clin Respir J 2015; 9: 87–97.
Key words acute lung injury – curcumin – Staphylococcus aureus Correspondence Liyun Shi, PhD, Division of Immunology, Hangzhou Normal University, 310036 Hangzhou, China. Tel: +86-571-28865632 Fax: +86-571-28865632 email: [email protected] Received: 12 August 2013 Revision requested: 13 January 2014 Accepted: 21 January 2014 DOI:10.1111/crj.12113 Authorship and contributorship F. X. and L. S. designed the study and wrote the manuscript. R. D., J. L., and Y. K. performed the experiments. X. W. analyzed the data. Ethics This study was approved by the Regional Ethics Committee. Conflict of interest The authors have declared that no competing interests exist. *These authors equally contribute to this manuscript.
Introduction Acute lung injury (ALI) is a severe clinical condition characterized as respiratory distress, refractory hypoxemia and noncardiogenic pulmonary edema, together with widespread lung inflammation and loss of epithelial and endothelial integrity (1). Severe pneumonia or sepsis is the primary cause of ALI (2). As a major pathogen in both community-acquired and nosoco-
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
mial infections (3, 4), Staphylococcus aureus (S. aureus) leads to a diverse spectrum of infections including lifethreatening pneumonia and septicemia and is recognized as one of main Gram-positive bacteria for ALI (5). These highly virulent staphylococci were responsible for more estimated deaths than HIV/AIDS in the United States (6). Despite the improvements in critical care and mechanical ventilation treatment, the mortality of
87
Curcumin attenuates S. aureus-induced ALI
pneumonia or sepsis with ALI is still high (1). Various strategies such as reducing bacterial load and attenuating exaggerated inflammation are under extensive evaluation (7, 8). Curcumin, as a naturally derived component from the rhizome of turmeric (Curcuma longa), has remarkable anti-inflammatory and antioxidant properties (9). A number of animal experiments revealed that curcumin attenuates the liver injury (10), kidney injury (11) and notably ALI caused by a variety of factors such as ischemia–reperfusion injury (12), lung transplantation (13), exposure to diesel exhaust particles (14), cecal ligature puncture (15) and Gramnegative Klebsiella pneumoniae intranasal infection (16). Although ALI caused by Gram-positive or Gramnegative bacteria infection shares clinical similarities, the pathogenesis underneath is distinguished (17). In this study, the protective effects of curcumin were evaluated on an experimental mouse model of S. aureus-induced pneumonia and ALI.
Materials and methods Ethics statement All animal experiments were in accordance with the ‘Guide for the Care and Use of Laboratory Animals’ and were approved by the Animal Care and Use Committee at Zhejiang University and Hangzhou Normal University.
S. aureus-induced ALI animal model Pathogen-free, 8-week-old female C57BL/6 mice, weighing between 18–20 g were used. Mice were purchased from the Animal Center of Slaccas (Shanghai, China) and maintained in the animal facility of Zhejiang University School of Medicine and Hangzhou Normal University. Fifty microliters of S. aureus isolated from clinics (18) or equal volume of phosphatebuffered saline (PBS) was inoculated directly into the trachea of lightly anesthetized mice. For anesthetic, 90 mg/kg of 1.5% pentobarbital in PBS was intraperitoneally (i.p.) injected. After intratracheal instillation, the mice were kept vertical for 1 min to ensure the distribution of the bacteria in the lung. In the pilot studies, no differences were revealed between the mice pretreated with curcumin or vehicle following mock (PBS) infection (data not shown). For the following experiments, mice were divided randomly into three experimental groups: (i) group CUR + SA: mice i.p. injected with 50 mg/kg of curcumin (Sigma-Aldrich Co., St. Louis, MO, USA) 2 h prior to S. aureus infection (11); (ii) group SA: mice i.p.
88
Xu et al.
injected with vehicle 2 h prior to infection; (iii) group PBS: mice i.p. injected with vehicle 2 h prior to mock infection with PBS. Of these, one setting of experiment was performed to check the viability and behavior of the mice by examining them every 12 h up to 5 days. The other experiment were performed 12 h or/and 24 h postinfection. The whole lung was harvested and homogenized for quantitative bacterial culture, myeloperoxidase activity determination, RNA extraction for quantitative real-time polymerase chain reaction (qRT-PCR) and protein extraction for Western blot. Bronchoalveolar lavage (BAL) fluid was collected for enumerating the number of total white cells and, and pathological staining were performed, respectively (n = 9–10 for each group).
Histopathological changes in S. aureus-infected mice The whole lungs of mice were fixed with 10% paraformaldehyde and embedded with paraffin. Fivemicrometer sections were sliced for hematoxylin and eosin (H&E) staining. Morphometric analysis was conducted under an automatic photo-microscope (Leica Biosystems, Nussloch, Germany). The number of neutrophils and alveolar sacs were determined in a blinded fashion (19). Three lung sections from each mice were analyzed and six randomly selected highpower fields (HPFs) (100×) were examined for each section. The extent of crowded area defined as the region of thickened septa in lung parenchyma associated with partial or complete collapse of alveoli on H&E-stained sections, also determined in a blinded fashion, was scored as follows: 0 = no detectable crowded area; 1 ≤ 15% of crowded area; 2 = 15–25% of crowded area; 3 = 25–50% of crowded area; 4 = 50– 75% of crowded area; 5 ≥ 75%–100% of crowded area/ HPF (100×) (20).
Pulmonary vascular leakage and lung edema Pulmonary vascular leakage was measured by Evans blue dye (EBD) method (13). In brief, 50 mg/kg of EBD (Sigma-Aldrich, St. Louis, MO, USA) was intravenously injected into the caudal vein of the mice 1 h prior to the termination of the experiment, when thoracotomy was performed and a 9-gauge cannula was inserted into the pulmonary artery through the incised left atrium of the heart. The pulmonary vasculature was flushed with PBS containing 5–mM of ethylenediaminetetraacetic acid till the flushed out fluid was clean in appearance. Afterwards, the lungs were removed, immersed into dimethyl formamide
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
Xu et al.
(3 mL/100 mg of lung tissue) and incubated at 60°C for 24 h, and centrifuged at 1700 × g for 5 min. The supernatant was collected and the optical density of which was measured by spectrophotometry at 620 nm. EBD concentration in the lung tissue was calculated against a standard curve. The status of lung pulmonary edema was measured by lung wet/dry ratio (13). The whole lung was removed and the weight was recorded as wet weight. After the whole lung was dried out by placing in an oven at 60°C for 48 h, the weight was recorded as dry weight.
Cell counting and measurement of proteins, cytokines in BAL fluid The BAL fluid was collected by lavaging the lungs with 1 mL of sterile PBS for three times. After the erythrocytes were lysed using lysis buffer (eBioscience, San Diego, CA, USA), the total cell number was counted. 2 × 105 cells were loaded onto a slide by cytospin (Statspin, Westwood, MA, USA) and stained with Giemsa stain (BASO, Zhuhai, China) for neutrophil counting. The cell-free BAL fluids were applied for enzyme-linked immunosorbent assays (ELISA) to measure the concentration of keratinocyte-derived chemokine (KC), macrophage inflammatory protein (MIP)-2, interleukin (IL)-1β, tumor necrosis factor (TNF)-α, IL-6 and transforming growth factor (TGF)-β (all kits from R&D systems Inc., Minneapolis, MN, USA) according to the manufacturer’s protocol. Total protein concentration was measured by BCA Protein Assay Kit (Beyotime, China).
Myeloperoxidase (MPO) activity and bacterial load in lung tissue The whole lung was excised, weighed and homogenized with 1 mL of PBS. Part of homogenate was taken out and directly used for quantitative bacterial culture. The rest of homogenate was divided and used to prepare samples for measurement of MPO activity, Western blot, and qRT-PCR, respectively. For the quantitative bacterial culture, 20 μL of homogenate was 1:10 serially diluted with PBS from 10−1 to 10−9. Five microliters of diluted homogenate was inoculated on a blood agar plate and incubated at 37°C for 24 h. The number of colonies was counted for the quantification of bacteria and expressed as colony-forming unit (CFU) per lung. MPO activity from lung homogenates was determined using a MPO standard from Sigma, according to the manufacturer’s recommendations.
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
Curcumin attenuates S. aureus-induced ALI
Western blot for the detection of plasminogen activator inhibitor-1 (PAI-1) and pIκB-α Lung homogenate containing protease inhibitor cocktail (Rothe, Basel, Switzerland) was sonicated and centrifuged at 12 000 × g for 30 min at 4°C. The supernatant was collected. For cultured cells, 1 × 106 cells were lysed with 1% NP40 with protease inhibitor cocktail. Forty-microgram protein from each lung was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis, transferred onto a PVDF membrane (Millipore, Billerica, MA, USA). The membrane was blocked with 5% BSA blocking solution, probed with antibody against PAI-1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), HMGB1(Abcam, Cambridge, MA, USA), or pIκB-α (Cell Signaling Technology, Danvers, MA, USA) followed by HRP-linked secondary antibody (Santa Cruz). Immunoreactive proteins were detected using the chemiluminescence HRP Substrate detection system (Millipore) and visualized under Chemi DocTM XRS+ imaging system (BIO-RAD, Hercules, CA, USA). Equal protein loading was verified by stripping and reprobing of membranes with antibody against β-actin (Santa Cruz).
qRT-PCR for proinflammatory genes expression Lung homogenate was conducted for RNA extraction with Trizol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized using reverse transcriptase cDNA synthesis system (Ferments, Waltham, MA, USA). Two micrograms of total RNA and random primers were included in the reaction. The real-time semi-qRT-PCR was performed in triplicates using the SYBR Green PCR assay and an ABI IQTM apparatus (both from Applied Biosystems, Foster, CA, USA). Primers were designed using Primer 5. The sequences for the primers were summarized in Table 1. β-actin was amplified as an endogenous reference gene. Expression of target genes was measured after normalization RNA with the reference gene, as fold increased expression above control calculated by corrected ΔΔ with a Sequence Detection Software version 1.2.3 (Applied Biosystems).
NF-κB activation in bone marrow-derived macrophages (BMDM) and detection of inflammatory cytokines Bone marrow cells were isolated and differentiated into BMDM in the presence of macrophage colonystimulating factor (M-CSF) (21). On day 7, the 89
Curcumin attenuates S. aureus-induced ALI
Xu et al.
Table 1. Primers used for quantitative real-time polymerase chain reaction experiments Gene
Forward primers (5′-3′)
Reverse primers (5′-3′)
β-actin kc mip-2 il-1β tnf-α il-6 tgf-β
AGAGGGAAATCGTGCGTGAC ACCCAAACCGAAGTCATA CCCAGACAGAAGTCATAGC CCTCCTTGCCTCTGATGG AATAACGCTGATTTGGTGA TTCCAGAAAC CGCTATGA TCAGACATTCGGGAAGCAG
CAATAGTGATGACCTGGCCGT GGTGCCATCAGA GCAGT TCCTTTCCAGGTCAGTTA AGTGCTGCCTAATGTCCC ACCCGTAGGGCG ATTACA GGTTGTCACCAGCATCAG AGCCACTCAGGCGTATCAG
available BMDMs were stimulated with S. aureus using a multiplicity of infection of 10 in the presence or absence of 20 μM of curcumin for 15, 30, 60 or 120 min before cells were lysed with 1% NP40 lysis buffer with protease inhibitor cocktail for Western blot. The phosphorylation level of IκB-α was detected as a marker for NF-κB activation. BMDMs were co-cultured with 20 μM of curcumin or PBS for 2 h, then stimulated with S. aureus (MOI : 10) for 12 h. The culture supernatant was collected and detected for the concentrations of IL-6 and KC (both ELISA kits from R&D systems, Inc., Minneapolis, MN, USA).
Results Survival rate and bacterial burden Curcumin moderately improved the survival rates in mice infected with S. aureus, although no significant difference between curcumin- and vehicle-treated groups (P = 0.067, Fig. 1A). Enumeration of S. aureus bacteria in the lungs from infected mice revealed that the replication of the bacteria was also mildly inhibited in curcumin pretreatment of mice, both at 12 h and 24 h post infection. However, no statistically significant changes were observed in bacterial load between two groups (P > 0.05, Fig. 1B).
Statistical analysis Survival curves were compared using the log–rank test. For other data, statistical significance was determined using two-tailed unpaired t-test, two-tailed Mann– Whitney U-test (for CFU) or one-way ANOVA corrected for multiple comparisons as appropriate. A P value of 0.05 or less was considered as statistically significant.
Histopathological change We next sought to evaluate the severity of the S. aureus-induced lung pneumonia and ALI. Histopathological examination revealed that S. aureusinfected lungs were apparently enlarged and red. H&E staining of sliced lung tissues presented with prominent thickening of alveolar walls and accumulation of
Figure 1. Curcumin (CUR) moderately affected the survival and bacterial burden upon S. aureus (SA) infection. (A) Survival curves for mice with or without the pretreatment of curcumin after infection with S. aureus, relative to mock-infected controls. Representative data from two independent experiments with similar results were shown. n = 5 for ( ) control mice and n = 10 each for ( ) SA and ( ) SA+CUR mice. (B) Loads of S. aureus in the whole lung homogenate 12 h and 24 h after infection were expressed as mean ± standard error of the mean. n = 9 per group. CFU, colony-forming units.
90
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
Xu et al.
Curcumin attenuates S. aureus-induced ALI
(A)
(C)
(D)
60
20 0
0.5
+S A R U C
+S A R U C
C
SA
S PB
+S A R
1.0
0.0
U
PB
SA
0
1.5
SA
20
* 40
*
*
S
40
2.0
*
PB
*
Crowded score
*
Number of alveoli
60
S
Number of neutrophils
(B)
Figure 2. Curcumin (CUR) reduced the morphological scores of S. aureus (SA) pneumonia. (A) Hematoxylin and eosin staining of lung tissues derived from mice 12 h after infection with a LD50 inoculation of S. aureus. (B) Semi-quantitative evaluations for lung histopathological scores with number of neutrophils. (C) Alveoli sac counts and (D) crowed score. n = 6 per group. *P < 0.01. PBS, phosphate-buffered saline.
inflammatory cells. Edema and accumulation of inflammatory cells within alveolar spaces were obvious in some areas. Consolidated air spaces with no intact alveolar structure could also be observed. Remarkably, the pretreated mice with curcumin showed greater preservations of lung tissue with remarkably reduced infiltration of inflammatory cells, alveolar wall thickening and edema after infection (Fig. 2A). Semiquantitative evaluations for lung histopathological scores proved reduced neutrophil infiltration (Fig. 2B), increased alveoli sac counts (Fig. 2C) and reduced extent of alveoli crowded area (Fig. 2D) with curcumin pretreatment (P < 0.01 for all).
Pulmonary blood-gas barrier function As major components of pulmonary gas-blood barrier, the dysfunction of epithelial and endothelial cells results in the efflux of protein-rich fluid into interstitial tissue and distal airspaces of the lung. To evaluate the barrier function, lung wet/dry ratio was assessed to measure lung pulmonary edema, and total protein in BAL fluid and absorbance (Evans blue) of DMF
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
extracts were assessed to measure vascular leak. As indicated in the Fig. 3, the exposure of mice with LD50 of S. aureus resulted in the dysfunction of lung barrier function, which was significantly attenuated by curcumin pretreatment (P < 0.01 for all).
Coagulation cascades Alteration in coagulation and fibrinolysis is another feature for ALI. We evaluated the expression of PAI-1, a strong independent predictor of mortality for ALI. Proteins from lungs of S. aureus-infected mice were extracted and checked for the expression of PAI-1 by Western blot. The pulmonary infection of S. aureus caused increased expression of PAI-1 in the lung, whereas pretreatment of curcumin effectively reduced the abundance of PAI-1 in the infected mice (Fig. 4).
Pulmonary inflammation During the course of S. aureus-induced pneumonia, the early recruitment of neutrophils (polymorphonuclear, PMNs) to the lung plays an important role in 91
Curcumin attenuates S. aureus-induced ALI
EBD (µg/g)
3000 2000 1000
*
30 20 10
0
+S A U
R
SA C
C
PB S
0
U
R
+S A
SA
3.0
*
40
+S A
3.5
*
R
4.0
50
*
U
4.5
4000
C
*
SA
*
5.0
(C)
PB S
5.5
BAL protein concentration, µg/mL
(B)
PB S
Lung wet/dry weight ratio
(A)
Xu et al.
Figure 3. Curcumin (CUR) preserved the barrier functions upon S. aureus (SA) challenge. (A) Lung wet/dry ratio. n = 4 for control group, n = 6 for SA, SA+CUR group, respectively. (B) Total protein concentration in bronchial lavage (BAL) fluid. n = 8 mice per group. (C) Evans blue dye (EBD) concentration in the lung tissue 12 h after intratracheal infection of S. aureus. n = 6 per group. *P < 0.01. PBS, phosphate-buffered saline.
eradication of the bacteria. Nevertheless, sustained and overreacted neutrophils lead to uncontrolled inflammation, contributing to the development of ALI. Consistent with the histopathological analysis we showed above, the number of total cells in the BAL fluid was increased during S. aureus infection (12, 22), and neutrophils accounted for almost all of the total cell population. Pretreatment of curcumin, however, substantially reduced the number of total cells and neutrophils (Fig. 5A and 5B). Consistently, MPO, an enzyme marker of neutrophilic infiltration, was significantly lower in mice pretreated with curcumin compared with that in the untreated mice 12 h postinfection (Fig. 5C). ELISA results revealed that in response to S. aureus infection, the concentrations of KC, IL-1β, MIP-2, TNF-α, IL-6 and TGF-β in the BAL fluid were elevated to high levels, whereas pretreatment of curcumin significantly decreased their expression (Fig. 5D–I).
Figure 4. Curcumin (CUR) reduced the expression of lung plasminogen activator inhibitor (PAI-1) caused by S. aureus (SA) infection. PAI-1 expression was detected by Western blot analysis of lung homogenate from mice 12 h after S. aureus inoculation (upper panel). Equal protein loading was verified by stripping and reprobing of membranes with antibody against β-actin (lower panel). PBS, phosphate-buffered saline; MW, molecular weight.
92
Inflammatory cytokine expression Several genes encoding for inflammatory cytokines and chemokines were assessed at the transcription level. QRT-PCR analyses demonstrated that transcription of kc, il-1β, mip-2, tnf-α, il-6 and tgf-β genes was upregulated in the lungs 12 h postinfection. Pretreatment of curcumin resulted in the downregulated expression of the genes, except for il-6 (Fig. 6A–F).
NF-κB regulation and inflammatory cytokine production Macrophages play a key role in releasing cytokines, largely through NF-κB-mediated pathway during the infection. BMDMs were then generated in vitro to test the effect of curcumin in response to S. aureus infection. Activation of NF-κB was assessed by detecting the phosphorylation level of IκB-α by Western blot. As depicted in Fig. 7, a rapid phosphorylation of IκB-α could be detected 15 min post infection, lasting till at least 60 min and diminishing at 120 min. Strikingly, co-culture of the cells with curcumin resulted in the downregulation of IκB-α phosphorylation. Accordingly, the production of inflammatory cytokines, including IL-6 and KC, was significantly decreased in the infected BMDM by curcumin pretreatment (Fig. 8). These results suggested that alleviated effects of curcumin on S. aureus-induced inflammatory response were at least partially through regulation of NF-κB activation.
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
Xu et al.
Curcumin attenuates S. aureus-induced ALI
*
U
R
+S A
SA
PB S
C
3000 2000 1000
C
U
R
+S A
SA
S PB
R U
5000
*
*
100 50
+S A U
R
SA
S PB
C
U
R
SA C
C
+S A
0 PB S
+S A
+S A
S
C
10000
U
R
SA
PB
+S A
150 *
0
0
4000
(I) TGF-beta/BAL TGF-beta (pg/mL)
500
*
*
0
U
(H) IL-6/BAL 15000 IL-6 (pg/mL)
1000
S
+S A
2000
C
U
1500
PB
R
4000
R
SA
S
R
PB
+S A
SA
PB
2000
0
U
6000
0
C
*
5
5000
*
*
0
*
10
C
*
500
0
*
*
12 h post infection
MIP-2 (pg/mL)
*
15
(F) MIP-2/BAL
8000
SA
10
(E) KC/BAL
1500 1000
20
6 h post infection
KC (pg/mL)
20
(G) TNF-alpha/BAL TNF-alpha (pg/mL)
0
U IL-1beta (pg/mL)
*
30
2500
5
C
U C
(D) IL-1 beta/BAL
S
MPO (units per lung)
(C) MPO/BAL *
10
12 h post infection
6 h post infection
40
*
*
SA
+S A
0
15
S
5
20
PB
*
10
R
+S A
SA
S
0
*
R
5
15
SA
10
20
PB S
*
Number of neutrophils in BALF (×105 cells/mL)
Total cell count in BALF (×105 cells/mL)
*
15
PB
Total cell count in BALF (×105 cells/mL)
20
Number of neutrophils in BALF (×105 cells/mL)
(B) PMN/BAL
(A) Total cells/BAL
Figure 5. Curcumin (CUR) attenuated S. aureus (SA)-induced lung inflammation. (A–B) Bronchial lavage (BAL) fluid (BALF) analysis of the number of total cells and neutrophils 6 h and 12 h after infection. (C) Analysis of myeloperoxidase (MPO) activity from lung homogenate 12 h after infection. Levels of (D) keratinocyte-derived chemokine (KC), (E) interleukin (IL)-1β, (F) macrophage inflammatory protein (MIP)-2, (G) tumor necrosis factor (TNF)-α, (H) IL-6, and (I) transforming growth factor (TGF)-β in BALF were detected by enzyme-linked immunosorbent assay at 12 h after infection. n = 5–9 per group. *P < 0.01. PBS, phosphate-buffered saline; PMN, polymorphonuclear neutrophils.
Discussion S. aureus can induce severe pneumonia together with overwhelming inflammation, microvascular leakage and thrombosis, and lung edema in immunocompetent mice. Our study demonstrated that pretreatment of curcumin significantly attenuated S. aureus-induced inflammation and injury. S. aureus replicates at the site of infection and produces surface proteins such as adhesins, protein A and secreted exoproteins, including toxins, hemolysins, and tissue-degrading enzymes (23, 24). S. aureus-produced α toxin is essential for the secretion of newly synthesized CXC chemokines (KC and MIP-2) and neutrophil recruitment into the airway (22). Protein A, which
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
is expressed on S. aureus cell walls, interacts with the TNF-α-receptor (TNFR-1) on the respiratory epithelium, thereby activating NF-κB and subsequent expression of inflammatory cytokines such as IL-8 (22). As the first site of contact with inhaled agents, epithelial cells produce a number of mediators such as reactive oxygen radicals, cytokines (TNF-α, IL-1β, GM-CSF), and platelet-activating factor to recruit inflammatory cells onto the site of inflammation (25). There is widespread activation of the innate immune response, following the initial host-microbial interaction. Macrophages play a key role in releasing not only the classic proinflammatory cytokines such as IL-1, IL-6 and TNF-α, but also an array of other cytokines including chemokines of KC, MIP-2 (18). Taken 93
Curcumin attenuates S. aureus-induced ALI
(B) KC
10
1000
3 2 1
S
30 20 10
10 5
S PB
C
U
R
+S A
SA
S PB
R U SA +C
SA
S PB
*
*
0
0
0
U C
# tgfb fold of change
il6 fold of change
4
PB
+S A R U C
(F) TGF-beta 15
* *
tnfa fold of change
SA
S (E) IL-6 40
*
5
PB
C U R +S A
SA
S PB (D) TNF-alpha
200 0
0
0
400
+S A
20
2000
R
30
*
*
C U R +S A
40
(C) MIP-2 600
*
*
SA
* kc fold of change
il1b fold of change
3000
mip2 fold of change
*
50
SA
(A) IL-beta
Xu et al.
Figure 6. Expression of proinflammatory cytokines was decreased by curcumin (CUR) administration. 12 h after S. aureus (SA) infection, relative gene expression levels of (A) interleukin (IL)-1β, (B) keratinocyte-derived chemokine (KC), (C) macrophage inflammatory protein (MIP)-2, (D) tumor necrosis factor (TNF)-α, (E) IL-6, and (F) transforming growth factor (TGF)-β were measured by quantitative real-time polymerase chain reaction analyses. n = 12–16 mice per group. *P < 0.01, #P > 0.05. PBS, phosphatebuffered saline.
together, the exposure of host cells to live S. aureus and their virulence factors induces diverse injuries including degradation of host tissue and inactivation of host defense mechanisms, thus the disease severity is determined by the balance between this organism and the host’s innate immune defense system (25). In this study, we established a lethal S. aureus pneumonia model in immunocompetent adult mice. Earlier studies have revealed aspects of S. aureus infection in lungs and epithelial cells. Early S. aureus pneumonia in
mice is featured by the releasing of proinflammatory cytokines/chemokines and rapid recruitment of neutrophils to the site of infection (26, 27). The overproduction of interleukins IL-1, IL-6, IL-8 is rapidly induced after activation of the nuclear factor-kappaB (NF-κB) pathway (28). In mice with lethal S. aureus pneumonia, active replication of S. aureus in the lungs and the over-expression of inflammatory and coagulation proteins are dominant (27, 29). In addition, in vitro study revealed that intracellular S. aureus
Figure 7. Curcumin (CUR) inhibited the activation of NF-κB upon S. aureus (SA) stimulation. Western blot analyses of phosphorylation of IκB-α (upper panel) in bone marrow-derived macrophages stimulated by S. aureus for 15 min, 30 min, 60 min and 120 min. β-actin expression is depicted as the loading control (lower panel). MW, molecular weight; PBS, phosphate-buffered saline.
94
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
Xu et al.
Curcumin attenuates S. aureus-induced ALI
Figure 8. Curcumin (CUR) pretreatment inhibited the inflammatory response in bone marrow-derived macrophages (BMDM) stimulated with S. aureus (SA). Enzyme-linked immunosorbent assay of interleukin (IL)-6 and keratinocytederived chemokine (KC) in supernatant from infected BMDM pretreated with or without 20 μM of curcumin. *P < 0.05.
in epithelial cells upregulated the transcription of a panel of proinflammatory genes including TNF-α, IL-1β, IL-6, IL-8, CCL-20, COX-2 (30). In addition to their roles in recruiting neutrophils to the site of an infection and enhancing their anti-bacterial function, the proinflammatory cytokines of TNF-α, IL-1 and IL-6 have been shown to activate the coagulation pathways and attenuate fibrinolytic activity, which are hallmarks of alveolar inflammation (25). The presence of high plasma levels of PAI-1 indicated that impaired coagulation pathways might be a feature for ALI initiated by lipopolysaccharides and other microbial components (17). S. aureus, via plasminogen binding and nonproteolytic activation, as well as secreting staphylococcal metalloprotease aureolysin, substantially impairs host’s fibrinolytic system (31). On the other side, proinflammatory cytokines, in particular IL-1 and IL-6, are also powerful inducers of coagulation (32). TGF-β is considered to be a key profibrotic protein (33) and was shown to transcriptionally regulate gene encoding PAI-1 expression (34). In this study, we revealed that application of curcumin can significantly downregulate the overexpression of PAI-1 in the lung. It could result from its anti-inflammatory effect or directly rectify the coagulation pathways impaired by S. aureus components. The anti-inflammatory and anti-apoptotic effects of curcumin enabled its applications in various organ injuries, e.g. renal or lung ischemia–reperfusion injury (11, 12), lung transplantation-associated lung injury (12), neutrophil-induced lung injury and sepsis by cecal ligation and puncture (10, 15, 35, 36), pulmonary and cardiovascular injury by repeated exposure to diesel exhaust particles in mice (14). Although lung injuries due to acute bacterial infections remain a major cause of mortality, to date there was only one report studying the effects of curcumin against pulmonary inflammation generated during Klebsiella pneumoniae B5055infection in BALB/c mice (16). Indeed, we utilized the
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
S. aureus-induced pneumonia and ALI model and revealed that curcumin could attenuate the inflammation, albeit having no major effects on bacterial burden in the lung. NF-κB is involved in the regulation of gene expression in the early processes of immune and inflammatory responses, including the activation of a number of inflammatory cytokines (e.g. TNF-α, IL-1β, IL-6 and IL-8) (28, 37). NF-κB activation is tightly regulated by its endogenous inhibitor of IκB, which complexes with NF-κB in the cytoplasm (38). Curcumin has been shown to inhibit phosphorylation and proteolytic degradation of IκB and prevent the release and nuclear transmigration of NF-κB (13, 39). Upon bacterial infection, macrophages, originating in bone marrow and reaching the lung through blood circulation, reside in the airways, alveoli and lung interstitium or migrate into the lung microvasculature. They constitute the first line of defense in recognizing various pathogens and trigger the production of cytokines and chemokines (40). The inflammatory mediators subsequently promote neutrophil accumulation and local inflammation (41, 42). In this study, we showed a direct inhibitory effect of curcumin on the activation of NF-κB on BMDM. It has been reported that curcumin promoted the apoptosis of activated neutrophils via activation of the p38 mitogen-activated protein kinase pathway, which was recognized as a mechanism of its anti-inflammatory effect (36, 43). Here we revealed another novel mechanism of direct inhibition of macrophage activation by curcumin via the inhibition of NF-κB. Our study demonstrated that curcumin protects against lung tissue injury in a mouse model of S. aureus-induced ALI. Those effects are potentially related to the inhibition of NF-κB-regulated inflammation pathways. Curcumin could be a potential adjuvant agent for treating ALI caused by bacterial infection. 95
Curcumin attenuates S. aureus-induced ALI
Acknowledgements This work was supported by grants from National Natural Science Foundation of China (81370176, 81270066), Ministry of Education of China (NCET12-0484), Natural Science Foundation of Zhejiang Province (LR12H01003) and Science and Technology Department of Zhejiang Province (2011R10027, 2012C33017).
References 1. Johnson ER, Matthay MA. Acute lung injury: epidemiology, pathogenesis, and treatment. J Aerosol Med Pulm Drug Deliv 2010;23(4): 243–52. 2. Tsushima K, King LS, Aggarwal NR, De Gorordo A, D’Alessio FR, Kubo K. Acute lung injury review. Intern Med. 2009;48(9): 621–30. 3. Klevens RM, Morrison MA, Nadle J, et al. Invasive methicillin-resistant Staphylococcus aureus infections in the United States. JAMA. 2007;298(15): 1763–71. 4. Otto M. Basis of virulence in community-associated methicillin-resistant Staphylococcus aureus. Annu Rev Microbiol. 2010;64: 143–62. 5. Schreiber MP, Chan CM, Shorr AF. Bacteremia in Staphylococcus aureus pneumonia: outcomes and epidemiology. J Crit Care. 2011;26(4): 395–401. 6. Chastre J. Evolving problems with resistant pathogens. Clin Microbiol Infect. 2008;14(Suppl. 3): 3–14. 7. Ware LB, Matthay MA. The acute respiratory distress syndrome. N Engl J Med. 2000;342: 1334–49. 8. Xu F, Hu Y, Zhou J, Wang X. Mesenchymal stem cells in acute lung injury: are they ready for translational medicine? J Cell Mol Med. 2013;17: 927–35. 9. Menon VP, Sudheer AR. Antioxidant and antiinflammatory properties of curcumin. Adv Exp Med Biol. 2007;595: 105–25. 10. Siddiqui AM, Cui X, Wu R, Dong W, Zhou M, Hu M, Simms HH, Wang P. The anti-inflammatory effect of curcumin in an experimental model of sepsis is mediated by up-regulation of peroxisome proliferatoractivated receptor-gamma. Crit Care Med. 2006;34(7): 1874–82. 11. Awad AS, El-Sharif AA. Curcumin immune-mediated and anti-apoptotic mechanisms protect against renal ischemia/reperfusion and distant organ induced injuries. Int Immunopharmacol. 2011;11(8): 992–6. 12. Sun J, Yang D, Li S, Xu Z, Wang X, Wang X, Bai C. Effects of curcumin or dexamethasone on lung ischaemia-reperfusion injury in rats. Eur Respir J. 2009;33(2): 398–404. 13. Sun J, Guo W, Ben Y, Jiang J, Tan C, Xu Z, Wang X, Bai C. Preventive effects of curcumin and dexamethasone on lung transplantation-associated lung injury in rats. Crit Care Med. 2008;36(4): 1205–13.
96
Xu et al.
14. Nemmar A, Subramaniyan D, Ali BH. Protective effect of curcumin on pulmonary and cardiovascular effects induced by repeated exposure to diesel exhaust particles in mice. PLoS ONE. 2012;7(6): e39554. 15. Xiao X, Yang M, Sun D, Sun S. Curcumin protects against sepsis-induced acute lung injury in rats. J Surg Res. 2012;176(1): e31–9. 16. Bansal S, Chhibber S. Curcumin alone and in combination with augmentin protects against pulmonary inflammation and acute lung injury generated during Klebsiella pneumoniae B5055-induced lung infection in BALB/c mice. J Med Microbiol. 2010;59(Pt 4): 429–37. 17. Cohen J. The immunopathogenesis of sepsis. Nature. 2002;420(6917): 885–91. 18. Xu F, Kang Y, Zhang H, Piao Z, Yin H, Diao R, Xia J, Shi L. Akt1-mediated regulation of macrophage polarization in a murine model of Staphylococcus aureus pulmonary infection. J Infect Dis. 2013;208(3): 528–38. 19. Sun CK, Lee FY, Sheu JJ, et al. Early combined treatment with cilostazol and bone marrow-derived endothelial progenitor cells markedly attenuates pulmonary arterial hypertension in rats. J Pharmacol Exp Ther. 2009;330(3): 718–26. 20. Sun CK, Yen CH, Lin YC, et al. Autologous transplantation of adipose-derived mesenchymal stem cells markedly reduced acute ischemia-reperfusion lung injury in a rodent model. J Transl Med. 2011;9: 118. 21. Chin AI, Dempsey PW, Bruhn K, Miller JF, Xu Y, Cheng G. Involvement of receptor-interacting protein 2 in innate and adaptive immune responses. Nature. 2002;416(6877): 190–4. 22. Gomez MI, Lee A, Reddy B, Muir A, Soong G, Pitt A, Cheung A, Prince A. Staphylococcus aureus protein A induces airway epithelial inflammatory responses by activating TNFR1. Nat Med. 2004;10(8): 842–8. 23. Novick RP, Muir TW. Virulence gene regulation by peptides in staphylococci and other Gram-positive bacteria. Curr Opin Microbiol. 1999;2(1): 40–5. 24. Li M, Diep BA, Villaruz AE, Braughton KR, Jiang X, DeLeo FR, Chambers HF, Lu Y, Otto M. Evolution of virulence in epidemic community-associated methicillin-resistant Staphylococcus aureus. Proc Natl Acad Sci U S A. 2009;106(14): 5883–8. 25. Sethi S, Chakraborty T. Role of TLR-/NLR-signaling and the associated cytokines involved in recruitment of neutrophils in murine models of Staphylococcus aureus infection. Virulence. 2011;2(4): 316–28. 26. Skerrett SJ, Liggitt HD, Hajjar AM, Wilson CB. Cutting edge: myeloid differentiation factor 88 is essential for pulmonary host defense against Pseudomonas aeruginosa but not Staphylococcus aureus. J Immunol. 2004;172(6): 3377–81. 27. Ventura CL, Higdon R, Hohmann L, Martin D, Kolker E, Liggitt HD, Skerrett SJ, Rubens CE. Staphylococcus aureus elicits marked alterations in the airway proteome during early pneumonia. Infect Immun. 2008;76(12): 5862–72.
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
Xu et al.
28. Moreilhon C, Gras D, Hologne C, Bajolet O, Cottrez F, Magnone V, Merten M, Groux H, Puchelle E, Barbry P. Live Staphylococcus aureus and bacterial soluble factors induce different transcriptional responses in human airway cells. Physiol Genomics. 2005;20(3): 244–55. 29. Inoshima I, Inoshima N, Wilke GA, Powers ME, Frank KM, Wang Y, Bubeck Wardenburg J. A Staphylococcus aureus pore-forming toxin subverts the activity of ADAM10 to cause lethal infection in mice. Nat Med. 2011;17(10): 1310–4. 30. Li X, Fusco WG, Seo KS, Bayles KW, Mosley EE, McGuire MA, Bohach GA. Epithelial cell gene expression induced by intracellular Staphylococcus aureus. Int J Microbiol. 2009;753278. 31. Beaufort N, Wojciechowski P, Sommerhoff CP, Szmyd G, Dubin G, Eick S, Kellermann J, Schmitt M, Potempa J, Magdolen V. The human fibrinolytic system is a target for the staphylococcal metalloprotease aureolysin. Biochem J. 2008;410(1): 157–65. 32. Moldoveanu B, Otmishi P, Jani P, Walker J, Sarmiento X, Guardiola J, Saad M, Yu J. Inflammatory mechanisms in the lung. J Inflamm Res. 2009;2: 1–11. 33. Lee CG, Kang HR, Homer RJ, Chupp G, Elias JA. Transgenic modeling of transforming growth factor-beta(1): role of apoptosis in fibrosis and alveolar remodeling. Proc Am Thorac Soc. 2006;3(5): 418–23. 34. Kutz SM, Hordines J, McKeown-Longo PJ, Higgins PJ. TGF-beta1-induced PAI-1 gene expression requires MEK activity and cell-to-substrate adhesion. J Cell Sci. 2001;114(Pt 21): 3905–14. 35. Thiemermann C. The spice of life: curcumin reduces the mortality associated with experimental sepsis. Crit Care Med. 2006;34(7): 2009–11.
The Clinical Respiratory Journal (2015) • ISSN 1752-6981 © 2014 John Wiley & Sons Ltd
Curcumin attenuates S. aureus-induced ALI
36. Hu M, Du Q, Vancurova I, Lin X, Miller EJ, Simms HH, Wang P. Proapoptotic effect of curcumin on human neutrophils: activation of the p38 mitogen-activated protein kinase pathway. Crit Care Med. 2005;33(11): 2571–8. 37. Fujisawa N, Hayashi S, Kurdowska A, Noble JM, Naitoh K, Miller EJ. Staphylococcal enterotoxin A-induced injury of human lung endothelial cells and IL-8 accumulation are mediated by TNF-alpha. J Immunol. 1998;161(10): 5627–32. 38. Kim DI, Kim SR, Kim HJ, Lee SJ, Lee HB, Park SJ, Im MJ, Lee YC. PI3K-gamma inhibition ameliorates acute lung injury through regulation of IkappaBalpha/NF-kappaB pathway and innate immune responses. J Clin Immunol. 2012;32(2): 340–51. 39. Jobin C, Bradham CA, Russo MP, Juma B, Narula AS, Brenner DA, Sartor RB. Curcumin blocks cytokinemediated NF-kappa B activation and proinflammatory gene expression by inhibiting inhibitory factor I-kappa B kinase activity. J Immunol. 1999;163(6): 3474–83. 40. Nakata K, Gotoh H, Watanabe J, et al. Augmented proliferation of human alveolar macrophages after allogeneic bone marrow transplantation. Blood. 1999;93(2): 667–73. 41. Bender AT, Ostenson CL, Wang EH, Beavo JA. Selective up-regulation of PDE1B2 upon monocyte-to-macrophage differentiation. Proc Natl Acad Sci U S A. 2005;102(2): 497–502. 42. Burns AR, Smith CW, Walker DC. Unique structural features that influence neutrophil emigration into the lung. Physiol Rev. 2003;83(2): 309–36. 43. Lee PJ. An old spice with new twists: curcumin, p38 mitogen-activated protein kinase, and apoptosis. Crit Care Med. 2005;33(11): 2703–5.
97
