Full Length
Arthritis & Rheumatism DOI 10.1002/art.38750
Citrullination of ENA-78/CXCL5 results in conversion from a non-monocyte recruiting to a monocyte recruiting chemokine *1Ken Yoshida, *2Olexandr Korchynskyi, 2Paul P. Tak, 1Takeo Isozaki, 1Jeffrey H. Ruth, 1Phillip L. Campbell, 2Dominique L. Baeten, 2Danielle M. Gerlag, 1M. Asif Amin, and 3, 1Alisa E. Koch 1
University of Michigan Medical School, Division of Rheumatology, Ann Arbor, Michigan, USA, 2
Academic Medical Center/University of Amsterdam, Division of Clinical Immunology and Rheumatology, Amsterdam, Netherlands,
3
VA Medical Service, Department of Veterans Affairs Medical Center, Ann Arbor, MI 48109
*These authors contributed equally
Type of manuscript: full-length article Running title: Citrullinated ENA-78/CXCL5 in rheumatoid arthritis Grant support: This work was supported by the Office of Research and Development, Medical Research Service, Department of Veterans Affairs, and the Frederick G. L. Huetwell and William D. Robinson, MD Professorship in Rheumatology. Corresponding author: Alisa E. Koch, M.D. University of Michigan Medical School, Ann Arbor, MI 48109-2200, U.S.A. Telephone: (734) 222-3707 Email: [email protected] Key Words: ENA-78/CXCL5, Citrullination, Monocytes, Peptidylarginine deiminase, Rheumatoid Arthritis
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an ‘Accepted Article’, doi: 10.1002/art.38750 © 2014 American College of Rheumatology Received: Jun 20, 2013; Revised: Apr 02, 2014; Accepted: Jun 12, 2014
Arthritis & Rheumatology
Abstract Objective: Citrullination is a post-translational modification mediated by peptidylarginine deiminase (PAD). Chemokines, which play an important role in the development of rheumatoid arthritis (RA), can be citrullinated in vitro. We undertook this study to examine whether the citrullinated chemokines epithelial-derived neutrophil-activating peptide 78 (ENA-78/CXCL5), macrophage inflammatory protein-1α (MIP-1α/CCL3), and monocyte chemotactic protein-1 (MCP-1/CCL2) are detected in RA biological fluids, and if so, what their biological activities are. Methods: Recombinant human chemokines were citrullinated by PAD. Citrullinated chemokine concentrations were measured by enzyme linked immunosorbent assay in RA and normal sera and in RA, osteoarthritis (OA), and other inflammatory rheumatic disease (OD) synovial fluids (SFs). The correlation between the citrullinated chemokine levels and clinical data was analyzed. Monocyte and neutrophil chemotaxis assays and mouse knee injection with native (noncitrullinated) or citrullinated ENA-78/CXCL5 were performed to evaluate their biological activities. Results: Citrullinated ENA-78/CXCL5 was significantly higher in RA sera and SFs than normal sera and OD including OA SFs, respectively. A strong correlation was found between the amount of citrullinated ENA-78/CXCL5 and C-reactive protein or erythrocyte sedimentation rate in RA SFs. Citrullinated ENA-78/CXCL5 induced monocyte chemotaxis via CXCR1 and 2, while non-citrullinated ENA-78/CXCL5 did not. Citrullinated ENA-78/CXCL5 induced more severe inflammation and recruited more monocytes than non-citrullinated ENA-78/CXCL5 in a mouse inflammatory arthritis model. Conclusions: Citrullinated ENA-78/CXCL5 is highly correlated with RA disease activity and, unlike non-citrullinated ENA-78/CXCL5, recruits monocytes. These results indicate that 2
John Wiley & Sons
Page 2 of 39
Page 3 of 39
Arthritis & Rheumatology
citrullinated ENA-78/CXCL5 may have previously unrecognized inflammatory properties in RA by recruiting monocytes to inflamed joint tissue.
3
John Wiley & Sons
Arthritis & Rheumatology
Introduction Rheumatoid arthritis (RA) is a chronic inflammatory disorder characterized by the infiltration of inflammatory cells into the synovial tissue and fluid (SF) (1). Anti-cyclic citrullinated peptide antibodies are present in the serum of nearly 70% of RA patients and have become key diagnostic markers for RA (2). Citrulline residues in target antigens are essential to formation of anti-citrullinated peptide/protein antibody epitopes (3, 4). These epitopes result from citrullination, a post-translational modification of arginine. Peptidylarginine deiminases (PAD) enzymes are calcium-dependent enzymes that catalyze citrullination of target proteins by converting arginine to citrulline (5). Five PAD family members, PAD1-4 and, 6 have been identified in many kinds of tissues including synovial tissue and leukocytes in humans (6). Chemokines play an important role as monocyte and polymorphonuclear neutrophil (PMN) recruiters in RA synovitis and tissue destruction (7, 8). Chemokines are classified into four subfamilies based on the number and spacing of their first cysteine residues in the primary amino acid sequence (9). These chemokine families are designated as C-X-C, C-C, C, and C-X3C. The C-X-C chemokines are further divided into two subgroups based on whether the GluLeu-Arg (ELR) motif precedes the first cysteine residue. Epithelial-derived neutrophil-activating peptide 78 (ENA-78/CXCL5), a C-X-C chemokine, is an 8.3 kDa protein with 78 amino acids containing 4 cysteines positioned identically to those of interleukin-8 (IL-8/CXCL8) (10). We found that concentrations of ENA-78/CXCL5, which is associated with neutrophil recruitment, are significantly higher in RA SF compared to osteoarthritis (OA) or other arthritis (11). We have shown that neutralization of ENA-78/CXCL5 ameliorates arthritis in rat adjuvant-induced arthritis model (12). These findings support the idea that ENA-78/CXCL5 is important in the pathogenesis of RA. 4
John Wiley & Sons
Page 4 of 39
Page 5 of 39
Arthritis & Rheumatology
Although citrullinated proteins such as fibrinogen, α-enolase, and vimentin, have been identified in RA (4, 13-15), citrullinated chemokines have not yet been detected in RA. We chose to examine chemokines as they are biologically relevant joint proteins. Several chemokines are highly expressed in RA joints, and PAD 2 and PAD 4 are mainly present in synovial tissue. The expression levels of these PADs are correlated with inflammation, thickness of the synovial lining layer, and vascularity (16). These results support the hypothesis that citrullinated chemokines may be present in RA joints. We examined the presence of citrullinated ENA-78/CXCL5, macrophage inflammatory protein-1α (MIP-1α/CCL3), and monocyte chemotactic protein-1 (MCP-1/CCL2) directly in RA compared to other arthritic disease biological fluids by a newly developed enzyme linked immunosorbent assay (ELISA) system, and examined the biological activity of these chemokines in vitro and that of ENA-78/CXCL5 in vivo.
5
John Wiley & Sons
Arthritis & Rheumatology
Page 6 of 39
Materials and Methods Patients and normal control subjects We obtained sera from patients with RA (n=11) and normal control subjects (n=15), and SFs from patients with RA (n=20), OA (n=15), and other inflammatory rheumatic diseases (OD) (n=13) consisting of gout (n=4), pseudogout (n=2), psoriatic arthritis (n=1), spondyloarthritis (n=3), Behçet's disease (n=1), Lyme disease (n=1), unclassified arthritis (n=1). Rheumatoid factor (RF) was immunodepleted from RA sera and SFs with goat anti-human IgM (µ-chain specific) agarose (Sigma-Aldrich, St. Louis, MO) prior to measurement of citrullinated chemokines by ELISA. All samples were obtained with Institutional Review Board approval and patient informed consent.
Chemokine DNA cloning We have obtained a full length ENA-78/CXCL5 cDNA (NCBI Accession number NM_002994) from Open Biosystems (Thermo Fisher Scientific, Waltham, MA). We generated cDNA libraries for MCP-1/CCL2 and MIP-1α/CCL3 from primary synovial fibroblasts derived from RA patients. The cDNA fragments encoding mature proteins were amplified by polymerase chain reaction using primers with an incorporated NcoI restriction site in the forward primer and with six codons encoding histidines followed by a stop codon, and the EcoRI restriction site into reverse
primers
(Primer
Express,
ABI);
TAATCCATGGGAGCTGGTCCTGCCGCTGCTGT-3’;
ENA-78/CXCL5
forward
reverse
TAAGAATTCTCAGTGATGGTGATGGTGATGGTTTTCCTTGTTTCCACCGT-3’;
5’5’MIP-
1α/CCL3 forward 5’-TAATCCATGGGAGCTGACACGCCGACCGCCTG-3’; reverse 5’TAAGAATTCTCAGTGATGGTGATGGTGATGGGCACTCAGCTCCAGGTCGC-3’; 6
John Wiley & Sons
MCP-
Page 7 of 39
Arthritis & Rheumatology
1/CCL2 forward 5’-TAATCCATGGGACAGCCAGATGCAATCAATGCC-3’; reverse 5’TAAGAATTCTCAGTGATGGTGATGGTGATGAGTCTTCGGAGTTTGGGTTTG-3’. NcoI/Eco RI-flanked PCR fragments containing a C-terminal 6His-tag were initially cloned into a pQE-TriSystem vector (Qiagen). All sequences were verified using BigDye terminator sequencing (Life Technologies, Carlsbad, CA). For optimization of mammalian expression, inserts containing a C-terminal 6His-tag were further cloned into the mammalian expression vector pcDEF (17).
Transfection of human embryonic kidney 293T (HEK293T) cells and purification of recombinant human (rh) chemokines All mammalian expression vectors were transfected into HEK 293T cells using polyethylenimine (Polysciences, Warrington, PA) to collect 6His-tagged chemokines from cellular lysates prepared with 1% Triton X-100. 6-His-tagged chemokines from 293-T cell lysates were purified with ProBond nickel beads (Life Technologies, Carlsbad, CA), rinsed extensively with 10 mM imidazole and eluted gradually with 50-200 mM imidazole. The quality and quantity of expressed recombinant proteins were assessed with appropriate DuoSet ELISA kits (R&D Systems, Minneapolis, MN) specific for these proteins and with colloidal Coomassie staining upon SDS-PAGE resolution.
In vitro citrullination of chemokines After measuring the concentration of purified chemokines by DuoSet ELISA kits, one hundred microliters of purified rh chemokine (~100 ng/ml) was incubated with 0.5U of rabbit skeletal muscle PAD (Sigma-Aldrich) in 40 mM Tris-HCl, pH 7.6, 10 mM CaCl2, and 2.5 mM 7
John Wiley & Sons
Arthritis & Rheumatology
DTT for 2 hours at 37°C. Deimination was stopped by chelating the calcium with 25 mM EDTA. These citrullinated chemokines were subsequently used as standards for ELISA assay of citrullinated chemokines. Alternatively, 5µM of rhENA-78/CXCL5, MIP-1α/CCL3, or MCP1/CCL2 (Origene, Rockville, MD) was incubated with rabbit skeletal PAD (250 nM) at enzymesubstrate molar ratios of 1/20 in 40 mM Tris-HCl with 2 mM CaCl2 (pH 7.4) for 1.5 hours at 37°C. Deimination was stopped with 0.1% trifluoroacetic acid (TFA). These citrullinated chemokines were used in in vitro chemotaxis assays and in vivo experiments. Citrullination of rhENA-78/CXCL5 was confirmed by Western blotting (18). For detection of citrullinated protein, citrulline residues were chemically modified to form an ureido group adduct before addition of an anti-modified citrulline antibody (Millipore, Billerica, MA) according to the manufacturer’s protocol, which enables detection of citrulline residues independent of neighboring amino acid sequences (19). The diagnostic +1Da mass shift occurring upon citrullination was identified by tandem mass spectrometry (LC-MS/MS) (MS Bioworks, Ann Arbor, MI) (20).
Sandwich ELISA for citrullinated chemokines An ELISA was designed to determine the concentrations of citrullinated chemokines in biological fluids. 96-well plates (Thermo Fisher Scientific) were coated overnight at room temperature with mouse anti-human ENA-78/CXCL5, mouse anti-human MCP-1/CCL2 antibody, or goat anti-human MIP-1α/CCL3 (R&D Systems). In between each step, the plates were washed with wash buffer (0.05% Tween 20 in PBS). The plates were blocked with 1% BSA in PBS for 1 hour at room temperature, and incubated for 2 hours with serum, SFs, or standards at room temperature. Citrullinated rh chemokines and native (non-citrullinated) rh chemokines purified from the transfected HEK 293T cells were used as standards and negative 8
John Wiley & Sons
Page 8 of 39
Page 9 of 39
Arthritis & Rheumatology
controls for the ELISA, respectively. The samples were crosslinked onto the plates with 1% glutaraldehyde in PBS for 30 minutes at room temperature. The plates were then incubated with 0.2 M Tris-HCl (pH 7.8) for 30 minutes at room temperature to block the crosslinking. The plates were then incubated overnight at 37°C in a citrulline modification solution consisting of 2 parts solution A (0.025% [weight/volume] FeCl3, 4.6 M H2SO4, and 3.0 M H3PO4), 1 part solution B (1% diacetylmonoxime, 0.5% antipyrine, and 1M acetic acid), and 1 part H2O (18). The plates were incubated for 2 hours at room temperature with rabbit anti-modified citrulline (Millipore), diluted 1:2500 in PBS containing 1% BSA. The plates were incubated for 2 hours at room temperature with horseradish peroxidase (HRP)-conjugated swine anti-rabbit IgG (Dako, Carpinteria, CA), diluted 1:1000 in PBS containing 1% BSA. Biotinyl-Tyramide Reagent (Perkin Elmer, Waltham, MA), diluted 1:1000 in 0.05M Tris-base pH 8.5, was added, followed by streptavidin-HRP. The plates were developed using tetramethylbenzidine (TMB), stopped with 2N H2SO4, and read on a microplate reader at 450 nm. Serum and SF chemokine concentrations were also measured by DuoSet ELISA kits.
In vitro monocyte and polymorphonuclear neutrophil (PMN) chemotaxis assays Monocytes and PMNs were isolated from normal human peripheral blood. Monocyte and PMN chemotaxis was performed using 48-well modified Boyden chambers (Neuro Probe, Cabin John, MD) as described previously (21, 22). Non-citrullinated (Origene), citrullinated chemokines and reaction buffer consisting of 40 mM Tris-HCl, 2 mM CaCl2, 250 nM rabbit skeletal PAD, and 0.1% TFA were diluted by PBS with calcium and magnesium in the same way and tested for chemotaxis. The reaction buffer including PAD enzymes was the same as the composition of the stock solution of citrullinated chemokines. PBS with calcium and magnesium 9
John Wiley & Sons
Arthritis & Rheumatology
Page 10 of 39
and N-formyl-methionine-leucine-phenylalanine (fMLP) (100 nM) (Sigma-Aldrich) were used as negative and positive stimuli, respectively. For the inhibitor studies, monocytes (2.5×106/ml) were pretreated with 500 ng/ml pertussis toxin (PTX) (Sigma-Aldrich), which is a G proteincoupled receptor antagonist, 10 µg/ml anti-CXCR1, anti-CXCR2 or isotype control IgG2a (R&D Systems) in PBS with calcium and magnesium for 1 hour to examine if G protein-coupled receptors are utilized by citrullinated ENA-78/CXCL5 to induce monocyte chemotaxis.
Mouse inflammatory arthritis model C57BL/6 female mice (8-10 weeks old) were purchased from the National Cancer Institute. Mice were divided into one group for PBS, a second group for non-citrullinated ENA78/CXCL5 (Origene), and a third group for citrullinated ENA-78/CXCL5. Mice were anesthetized and the knee circumference was determined by caliper measurements before intraarticular injection and calculated using the following formula: circumference = π (a+b)/2, where a is the latero-lateral diameter and b is the antero-posterior diameter. Anesthetized mice received 20 µl/knee joint of PBS, non-citrullinated (16 ng), or citrullinated ENA-78/CXCL5 (16 ng). The circumference measurements were taken in a blinded manner 24 hours after the intraarticular injection for all mice.
Hematoxylin and eosin (H&E) and immunofluorescence staining Mouse knee joints embedded in OCT compound were frozen and cut (10 µm). H&E staining was performed as described previously (23). Immunofluorescence was performed on cryosections from mouse knee joints to determine monocytes/macrophages, using rat anti-mouse F4/80 antibodies (GeneTex, Irvine, CA) at 1 µg/ml as primary antibody and Alexa Fluor 555 10
John Wiley & Sons
Page 11 of 39
Arthritis & Rheumatology
goat anti-rat IgG (Life Technologies) at a dilution of 1:200 as secondary antibody. The method of immunofluorescence has been described previously (21). The number of F4/80 positive monocytes/macrophages was calculated as the average of the number of cells in 3 fields (400×) that showed the most remarkable infiltrates in the joint space where the injections were administered.
Statistical analysis Statistical differences between experimental groups was determined by Student’s t-test or one-way ANOVA followed by Tukey's multiple comparison test for post-hoc analysis. The clinical correlation between chemokine levels and clinical data was assessed by Pearson’s rank correlation coefficient. Statistical analysis was performed with assistance from the Center for Statistical Consultation & Research at the University of Michigan. Results are expressed as the mean ± SEM. P values < 0.05 were considered significant.
11
John Wiley & Sons
Arthritis & Rheumatology
Page 12 of 39
Results The standard curve of citrullinated rhENA-78/CXCL5 by ELISA and verification of in vitro citrullination of rhENA-78/CXCL5 by Western blotting and mass spectrometry Figure 1A shows the ELISA standard curve of citrullinated rhENA-78/CXCL5. The standard curve showed a high correlation between the concentration of citrullinated rhENA78/CXCL5 and absorbance (Figure 1A). Non-citrullinated ENA-78/CXCL5 (1000 pg/ml) was not detected by this ELISA assay. We then confirmed by Western blotting that rhENA78/CXCL5 was citrullinated in vitro. Citrullinated ENA-78/CXCL5 was recognized by antimodified citrulline antibody (right lane), while non-citrullinated ENA-78/CXCL5 was not (left lane) (Figure 1B). The diagnostic +1Da mass shift occurring upon citrullination of ENA78/CXCL5, which has 2 arginine residues, was identified by mass spectrometry (20). The mass spectrometry data indicate that both arginine residues were detected and citrullinated (Figure 1C and 1D). Citrullination of MCP-1/CCL2 and MIP-1α/CCL3, which have 4 and 3 arginine residues, respectively, was also identified by mass spectrometry (data not shown).
RA patient sera have higher citrullinated chemokine concentrations than normal control subject sera To ascertain whether citrullinated chemokines were detectable in biological fluids, we assayed serum samples obtained from patients with RA and normal control subjects with the citrullinated chemokine sandwich ELISA. In patients with RA and normal control subjects, citrullinated ENA-78/CXCL5 was 286 ± 68 pg/ml (mean ± SEM) (n=number of patients; n=11), and 1.2 ± 0.7 pg/ml (n=number of normal control subjects; n=15), respectively (Figure 2A). Citrullinated MIP-1α/CCL3 was 624 ± 96 pg/ml in RA sera (n=11) and 1.2 ± 1.2 pg/ml in 12
John Wiley & Sons
Page 13 of 39
Arthritis & Rheumatology
normal control subject sera (n=15) (Figure 2B). Citrullinated MCP-1/CCL2 was 143 ± 18 pg/ml in RA sera (n=11) and 0.9 ± 0.5 pg/ml in normal control subject sera (n=15) (Figure 2C). Citrullinated ENA-78/CXCL5, MIP-1α/CCL3, and MCP-1/CCL2 in patients with RA were all significantly higher compared to normal control subjects (p
Arthritis & Rheumatism DOI 10.1002/art.38750
Citrullination of ENA-78/CXCL5 results in conversion from a non-monocyte recruiting to a monocyte recruiting chemokine *1Ken Yoshida, *2Olexandr Korchynskyi, 2Paul P. Tak, 1Takeo Isozaki, 1Jeffrey H. Ruth, 1Phillip L. Campbell, 2Dominique L. Baeten, 2Danielle M. Gerlag, 1M. Asif Amin, and 3, 1Alisa E. Koch 1
University of Michigan Medical School, Division of Rheumatology, Ann Arbor, Michigan, USA, 2
Academic Medical Center/University of Amsterdam, Division of Clinical Immunology and Rheumatology, Amsterdam, Netherlands,
3
VA Medical Service, Department of Veterans Affairs Medical Center, Ann Arbor, MI 48109
*These authors contributed equally
Type of manuscript: full-length article Running title: Citrullinated ENA-78/CXCL5 in rheumatoid arthritis Grant support: This work was supported by the Office of Research and Development, Medical Research Service, Department of Veterans Affairs, and the Frederick G. L. Huetwell and William D. Robinson, MD Professorship in Rheumatology. Corresponding author: Alisa E. Koch, M.D. University of Michigan Medical School, Ann Arbor, MI 48109-2200, U.S.A. Telephone: (734) 222-3707 Email: [email protected] Key Words: ENA-78/CXCL5, Citrullination, Monocytes, Peptidylarginine deiminase, Rheumatoid Arthritis
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an ‘Accepted Article’, doi: 10.1002/art.38750 © 2014 American College of Rheumatology Received: Jun 20, 2013; Revised: Apr 02, 2014; Accepted: Jun 12, 2014
Arthritis & Rheumatology
Abstract Objective: Citrullination is a post-translational modification mediated by peptidylarginine deiminase (PAD). Chemokines, which play an important role in the development of rheumatoid arthritis (RA), can be citrullinated in vitro. We undertook this study to examine whether the citrullinated chemokines epithelial-derived neutrophil-activating peptide 78 (ENA-78/CXCL5), macrophage inflammatory protein-1α (MIP-1α/CCL3), and monocyte chemotactic protein-1 (MCP-1/CCL2) are detected in RA biological fluids, and if so, what their biological activities are. Methods: Recombinant human chemokines were citrullinated by PAD. Citrullinated chemokine concentrations were measured by enzyme linked immunosorbent assay in RA and normal sera and in RA, osteoarthritis (OA), and other inflammatory rheumatic disease (OD) synovial fluids (SFs). The correlation between the citrullinated chemokine levels and clinical data was analyzed. Monocyte and neutrophil chemotaxis assays and mouse knee injection with native (noncitrullinated) or citrullinated ENA-78/CXCL5 were performed to evaluate their biological activities. Results: Citrullinated ENA-78/CXCL5 was significantly higher in RA sera and SFs than normal sera and OD including OA SFs, respectively. A strong correlation was found between the amount of citrullinated ENA-78/CXCL5 and C-reactive protein or erythrocyte sedimentation rate in RA SFs. Citrullinated ENA-78/CXCL5 induced monocyte chemotaxis via CXCR1 and 2, while non-citrullinated ENA-78/CXCL5 did not. Citrullinated ENA-78/CXCL5 induced more severe inflammation and recruited more monocytes than non-citrullinated ENA-78/CXCL5 in a mouse inflammatory arthritis model. Conclusions: Citrullinated ENA-78/CXCL5 is highly correlated with RA disease activity and, unlike non-citrullinated ENA-78/CXCL5, recruits monocytes. These results indicate that 2
John Wiley & Sons
Page 2 of 39
Page 3 of 39
Arthritis & Rheumatology
citrullinated ENA-78/CXCL5 may have previously unrecognized inflammatory properties in RA by recruiting monocytes to inflamed joint tissue.
3
John Wiley & Sons
Arthritis & Rheumatology
Introduction Rheumatoid arthritis (RA) is a chronic inflammatory disorder characterized by the infiltration of inflammatory cells into the synovial tissue and fluid (SF) (1). Anti-cyclic citrullinated peptide antibodies are present in the serum of nearly 70% of RA patients and have become key diagnostic markers for RA (2). Citrulline residues in target antigens are essential to formation of anti-citrullinated peptide/protein antibody epitopes (3, 4). These epitopes result from citrullination, a post-translational modification of arginine. Peptidylarginine deiminases (PAD) enzymes are calcium-dependent enzymes that catalyze citrullination of target proteins by converting arginine to citrulline (5). Five PAD family members, PAD1-4 and, 6 have been identified in many kinds of tissues including synovial tissue and leukocytes in humans (6). Chemokines play an important role as monocyte and polymorphonuclear neutrophil (PMN) recruiters in RA synovitis and tissue destruction (7, 8). Chemokines are classified into four subfamilies based on the number and spacing of their first cysteine residues in the primary amino acid sequence (9). These chemokine families are designated as C-X-C, C-C, C, and C-X3C. The C-X-C chemokines are further divided into two subgroups based on whether the GluLeu-Arg (ELR) motif precedes the first cysteine residue. Epithelial-derived neutrophil-activating peptide 78 (ENA-78/CXCL5), a C-X-C chemokine, is an 8.3 kDa protein with 78 amino acids containing 4 cysteines positioned identically to those of interleukin-8 (IL-8/CXCL8) (10). We found that concentrations of ENA-78/CXCL5, which is associated with neutrophil recruitment, are significantly higher in RA SF compared to osteoarthritis (OA) or other arthritis (11). We have shown that neutralization of ENA-78/CXCL5 ameliorates arthritis in rat adjuvant-induced arthritis model (12). These findings support the idea that ENA-78/CXCL5 is important in the pathogenesis of RA. 4
John Wiley & Sons
Page 4 of 39
Page 5 of 39
Arthritis & Rheumatology
Although citrullinated proteins such as fibrinogen, α-enolase, and vimentin, have been identified in RA (4, 13-15), citrullinated chemokines have not yet been detected in RA. We chose to examine chemokines as they are biologically relevant joint proteins. Several chemokines are highly expressed in RA joints, and PAD 2 and PAD 4 are mainly present in synovial tissue. The expression levels of these PADs are correlated with inflammation, thickness of the synovial lining layer, and vascularity (16). These results support the hypothesis that citrullinated chemokines may be present in RA joints. We examined the presence of citrullinated ENA-78/CXCL5, macrophage inflammatory protein-1α (MIP-1α/CCL3), and monocyte chemotactic protein-1 (MCP-1/CCL2) directly in RA compared to other arthritic disease biological fluids by a newly developed enzyme linked immunosorbent assay (ELISA) system, and examined the biological activity of these chemokines in vitro and that of ENA-78/CXCL5 in vivo.
5
John Wiley & Sons
Arthritis & Rheumatology
Page 6 of 39
Materials and Methods Patients and normal control subjects We obtained sera from patients with RA (n=11) and normal control subjects (n=15), and SFs from patients with RA (n=20), OA (n=15), and other inflammatory rheumatic diseases (OD) (n=13) consisting of gout (n=4), pseudogout (n=2), psoriatic arthritis (n=1), spondyloarthritis (n=3), Behçet's disease (n=1), Lyme disease (n=1), unclassified arthritis (n=1). Rheumatoid factor (RF) was immunodepleted from RA sera and SFs with goat anti-human IgM (µ-chain specific) agarose (Sigma-Aldrich, St. Louis, MO) prior to measurement of citrullinated chemokines by ELISA. All samples were obtained with Institutional Review Board approval and patient informed consent.
Chemokine DNA cloning We have obtained a full length ENA-78/CXCL5 cDNA (NCBI Accession number NM_002994) from Open Biosystems (Thermo Fisher Scientific, Waltham, MA). We generated cDNA libraries for MCP-1/CCL2 and MIP-1α/CCL3 from primary synovial fibroblasts derived from RA patients. The cDNA fragments encoding mature proteins were amplified by polymerase chain reaction using primers with an incorporated NcoI restriction site in the forward primer and with six codons encoding histidines followed by a stop codon, and the EcoRI restriction site into reverse
primers
(Primer
Express,
ABI);
TAATCCATGGGAGCTGGTCCTGCCGCTGCTGT-3’;
ENA-78/CXCL5
forward
reverse
TAAGAATTCTCAGTGATGGTGATGGTGATGGTTTTCCTTGTTTCCACCGT-3’;
5’5’MIP-
1α/CCL3 forward 5’-TAATCCATGGGAGCTGACACGCCGACCGCCTG-3’; reverse 5’TAAGAATTCTCAGTGATGGTGATGGTGATGGGCACTCAGCTCCAGGTCGC-3’; 6
John Wiley & Sons
MCP-
Page 7 of 39
Arthritis & Rheumatology
1/CCL2 forward 5’-TAATCCATGGGACAGCCAGATGCAATCAATGCC-3’; reverse 5’TAAGAATTCTCAGTGATGGTGATGGTGATGAGTCTTCGGAGTTTGGGTTTG-3’. NcoI/Eco RI-flanked PCR fragments containing a C-terminal 6His-tag were initially cloned into a pQE-TriSystem vector (Qiagen). All sequences were verified using BigDye terminator sequencing (Life Technologies, Carlsbad, CA). For optimization of mammalian expression, inserts containing a C-terminal 6His-tag were further cloned into the mammalian expression vector pcDEF (17).
Transfection of human embryonic kidney 293T (HEK293T) cells and purification of recombinant human (rh) chemokines All mammalian expression vectors were transfected into HEK 293T cells using polyethylenimine (Polysciences, Warrington, PA) to collect 6His-tagged chemokines from cellular lysates prepared with 1% Triton X-100. 6-His-tagged chemokines from 293-T cell lysates were purified with ProBond nickel beads (Life Technologies, Carlsbad, CA), rinsed extensively with 10 mM imidazole and eluted gradually with 50-200 mM imidazole. The quality and quantity of expressed recombinant proteins were assessed with appropriate DuoSet ELISA kits (R&D Systems, Minneapolis, MN) specific for these proteins and with colloidal Coomassie staining upon SDS-PAGE resolution.
In vitro citrullination of chemokines After measuring the concentration of purified chemokines by DuoSet ELISA kits, one hundred microliters of purified rh chemokine (~100 ng/ml) was incubated with 0.5U of rabbit skeletal muscle PAD (Sigma-Aldrich) in 40 mM Tris-HCl, pH 7.6, 10 mM CaCl2, and 2.5 mM 7
John Wiley & Sons
Arthritis & Rheumatology
DTT for 2 hours at 37°C. Deimination was stopped by chelating the calcium with 25 mM EDTA. These citrullinated chemokines were subsequently used as standards for ELISA assay of citrullinated chemokines. Alternatively, 5µM of rhENA-78/CXCL5, MIP-1α/CCL3, or MCP1/CCL2 (Origene, Rockville, MD) was incubated with rabbit skeletal PAD (250 nM) at enzymesubstrate molar ratios of 1/20 in 40 mM Tris-HCl with 2 mM CaCl2 (pH 7.4) for 1.5 hours at 37°C. Deimination was stopped with 0.1% trifluoroacetic acid (TFA). These citrullinated chemokines were used in in vitro chemotaxis assays and in vivo experiments. Citrullination of rhENA-78/CXCL5 was confirmed by Western blotting (18). For detection of citrullinated protein, citrulline residues were chemically modified to form an ureido group adduct before addition of an anti-modified citrulline antibody (Millipore, Billerica, MA) according to the manufacturer’s protocol, which enables detection of citrulline residues independent of neighboring amino acid sequences (19). The diagnostic +1Da mass shift occurring upon citrullination was identified by tandem mass spectrometry (LC-MS/MS) (MS Bioworks, Ann Arbor, MI) (20).
Sandwich ELISA for citrullinated chemokines An ELISA was designed to determine the concentrations of citrullinated chemokines in biological fluids. 96-well plates (Thermo Fisher Scientific) were coated overnight at room temperature with mouse anti-human ENA-78/CXCL5, mouse anti-human MCP-1/CCL2 antibody, or goat anti-human MIP-1α/CCL3 (R&D Systems). In between each step, the plates were washed with wash buffer (0.05% Tween 20 in PBS). The plates were blocked with 1% BSA in PBS for 1 hour at room temperature, and incubated for 2 hours with serum, SFs, or standards at room temperature. Citrullinated rh chemokines and native (non-citrullinated) rh chemokines purified from the transfected HEK 293T cells were used as standards and negative 8
John Wiley & Sons
Page 8 of 39
Page 9 of 39
Arthritis & Rheumatology
controls for the ELISA, respectively. The samples were crosslinked onto the plates with 1% glutaraldehyde in PBS for 30 minutes at room temperature. The plates were then incubated with 0.2 M Tris-HCl (pH 7.8) for 30 minutes at room temperature to block the crosslinking. The plates were then incubated overnight at 37°C in a citrulline modification solution consisting of 2 parts solution A (0.025% [weight/volume] FeCl3, 4.6 M H2SO4, and 3.0 M H3PO4), 1 part solution B (1% diacetylmonoxime, 0.5% antipyrine, and 1M acetic acid), and 1 part H2O (18). The plates were incubated for 2 hours at room temperature with rabbit anti-modified citrulline (Millipore), diluted 1:2500 in PBS containing 1% BSA. The plates were incubated for 2 hours at room temperature with horseradish peroxidase (HRP)-conjugated swine anti-rabbit IgG (Dako, Carpinteria, CA), diluted 1:1000 in PBS containing 1% BSA. Biotinyl-Tyramide Reagent (Perkin Elmer, Waltham, MA), diluted 1:1000 in 0.05M Tris-base pH 8.5, was added, followed by streptavidin-HRP. The plates were developed using tetramethylbenzidine (TMB), stopped with 2N H2SO4, and read on a microplate reader at 450 nm. Serum and SF chemokine concentrations were also measured by DuoSet ELISA kits.
In vitro monocyte and polymorphonuclear neutrophil (PMN) chemotaxis assays Monocytes and PMNs were isolated from normal human peripheral blood. Monocyte and PMN chemotaxis was performed using 48-well modified Boyden chambers (Neuro Probe, Cabin John, MD) as described previously (21, 22). Non-citrullinated (Origene), citrullinated chemokines and reaction buffer consisting of 40 mM Tris-HCl, 2 mM CaCl2, 250 nM rabbit skeletal PAD, and 0.1% TFA were diluted by PBS with calcium and magnesium in the same way and tested for chemotaxis. The reaction buffer including PAD enzymes was the same as the composition of the stock solution of citrullinated chemokines. PBS with calcium and magnesium 9
John Wiley & Sons
Arthritis & Rheumatology
Page 10 of 39
and N-formyl-methionine-leucine-phenylalanine (fMLP) (100 nM) (Sigma-Aldrich) were used as negative and positive stimuli, respectively. For the inhibitor studies, monocytes (2.5×106/ml) were pretreated with 500 ng/ml pertussis toxin (PTX) (Sigma-Aldrich), which is a G proteincoupled receptor antagonist, 10 µg/ml anti-CXCR1, anti-CXCR2 or isotype control IgG2a (R&D Systems) in PBS with calcium and magnesium for 1 hour to examine if G protein-coupled receptors are utilized by citrullinated ENA-78/CXCL5 to induce monocyte chemotaxis.
Mouse inflammatory arthritis model C57BL/6 female mice (8-10 weeks old) were purchased from the National Cancer Institute. Mice were divided into one group for PBS, a second group for non-citrullinated ENA78/CXCL5 (Origene), and a third group for citrullinated ENA-78/CXCL5. Mice were anesthetized and the knee circumference was determined by caliper measurements before intraarticular injection and calculated using the following formula: circumference = π (a+b)/2, where a is the latero-lateral diameter and b is the antero-posterior diameter. Anesthetized mice received 20 µl/knee joint of PBS, non-citrullinated (16 ng), or citrullinated ENA-78/CXCL5 (16 ng). The circumference measurements were taken in a blinded manner 24 hours after the intraarticular injection for all mice.
Hematoxylin and eosin (H&E) and immunofluorescence staining Mouse knee joints embedded in OCT compound were frozen and cut (10 µm). H&E staining was performed as described previously (23). Immunofluorescence was performed on cryosections from mouse knee joints to determine monocytes/macrophages, using rat anti-mouse F4/80 antibodies (GeneTex, Irvine, CA) at 1 µg/ml as primary antibody and Alexa Fluor 555 10
John Wiley & Sons
Page 11 of 39
Arthritis & Rheumatology
goat anti-rat IgG (Life Technologies) at a dilution of 1:200 as secondary antibody. The method of immunofluorescence has been described previously (21). The number of F4/80 positive monocytes/macrophages was calculated as the average of the number of cells in 3 fields (400×) that showed the most remarkable infiltrates in the joint space where the injections were administered.
Statistical analysis Statistical differences between experimental groups was determined by Student’s t-test or one-way ANOVA followed by Tukey's multiple comparison test for post-hoc analysis. The clinical correlation between chemokine levels and clinical data was assessed by Pearson’s rank correlation coefficient. Statistical analysis was performed with assistance from the Center for Statistical Consultation & Research at the University of Michigan. Results are expressed as the mean ± SEM. P values < 0.05 were considered significant.
11
John Wiley & Sons
Arthritis & Rheumatology
Page 12 of 39
Results The standard curve of citrullinated rhENA-78/CXCL5 by ELISA and verification of in vitro citrullination of rhENA-78/CXCL5 by Western blotting and mass spectrometry Figure 1A shows the ELISA standard curve of citrullinated rhENA-78/CXCL5. The standard curve showed a high correlation between the concentration of citrullinated rhENA78/CXCL5 and absorbance (Figure 1A). Non-citrullinated ENA-78/CXCL5 (1000 pg/ml) was not detected by this ELISA assay. We then confirmed by Western blotting that rhENA78/CXCL5 was citrullinated in vitro. Citrullinated ENA-78/CXCL5 was recognized by antimodified citrulline antibody (right lane), while non-citrullinated ENA-78/CXCL5 was not (left lane) (Figure 1B). The diagnostic +1Da mass shift occurring upon citrullination of ENA78/CXCL5, which has 2 arginine residues, was identified by mass spectrometry (20). The mass spectrometry data indicate that both arginine residues were detected and citrullinated (Figure 1C and 1D). Citrullination of MCP-1/CCL2 and MIP-1α/CCL3, which have 4 and 3 arginine residues, respectively, was also identified by mass spectrometry (data not shown).
RA patient sera have higher citrullinated chemokine concentrations than normal control subject sera To ascertain whether citrullinated chemokines were detectable in biological fluids, we assayed serum samples obtained from patients with RA and normal control subjects with the citrullinated chemokine sandwich ELISA. In patients with RA and normal control subjects, citrullinated ENA-78/CXCL5 was 286 ± 68 pg/ml (mean ± SEM) (n=number of patients; n=11), and 1.2 ± 0.7 pg/ml (n=number of normal control subjects; n=15), respectively (Figure 2A). Citrullinated MIP-1α/CCL3 was 624 ± 96 pg/ml in RA sera (n=11) and 1.2 ± 1.2 pg/ml in 12
John Wiley & Sons
Page 13 of 39
Arthritis & Rheumatology
normal control subject sera (n=15) (Figure 2B). Citrullinated MCP-1/CCL2 was 143 ± 18 pg/ml in RA sera (n=11) and 0.9 ± 0.5 pg/ml in normal control subject sera (n=15) (Figure 2C). Citrullinated ENA-78/CXCL5, MIP-1α/CCL3, and MCP-1/CCL2 in patients with RA were all significantly higher compared to normal control subjects (p
