ARTICLE IN PRESS Developmental and Comparative Immunology ■■ (2014) ■■–■■

Contents lists available at ScienceDirect

Developmental and Comparative Immunology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d c i

Short communication

1 2 3 4 5 6 7

Cxcl8-l1 and Cxcl8-l2 are required in the zebrafish defense against Salmonella Typhimurium Sofia de Oliveira a,b,c, Azucena Lopez-Muñoz a, Francisco J. Martinez-Navarro a, Q2 Jorge Galindo-Villegas a, Victoriano Mulero a,*,1, Ângelo Calado b,c,**,1 a

8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43

Departamento de Biología Celular e Histología, Facultad de Biología, Universidad de Murcia, IMIB-Arrixaca, Murcia, Spain CSaldanha Lab, Instituto de Medicina Molecular, Lisboa, Portugal c Instituto de Bioquímica, Faculdade de Medicina, Universidade de Lisboa, Lisboa, Portugal b

A R T I C L E

I N F O

Article history: Received 21 October 2014 Revised 3 November 2014 Accepted 4 November 2014 Available online Keywords: cxcl8 Chemokines Neutrophils Bacterial infection Tg(mpx:gfp)

A B S T R A C T

In recent years zebrafish has emerged as an excellent model for studying the Cxcl8 signaling pathway in inflammation elicited upon tissue damage or infection. Zebrafish has two true homologs of mammalian CXCL8, named Cxcl8-l1 and Cxcl8-l2. Previously, we have shown that in wound-associated inflammation, these chemokines are up-regulated and are relevant for neutrophil recruitment. In infections, no such knowledge is available as most studies performed on this subject in zebrafish have mainly focused on Cxcl8-l1 even though Cxcl8-l2 shares higher homology with human CXCL8. In this study, we aimed to address the biological function of both zfCxcl8s in infection to improve our understanding of their respective roles under different inflammatory conditions. Gene expression analysis first confirmed that both Cxcl8-l1 and l2 are induced upon infection or in PAMP-elicited inflammatory processes. In addition, we also found that cxcl8-deficient larvae show higher susceptibility to Salmonella enterica serovar Typhimurium (S. Typhimurium) infection, reduced neutrophil recruitment to the infection site, assayed in the line Tg(mpx:gfp), and decreased bacterial clearance. These data indicate that both zebrafish Cxcl8s play important roles in neutrophil recruitment and in the inflammatory response elicited upon infection or tissue damage, suggesting that even though the divergence of lower vertebrates and humans from a common ancestor occurred about 450 millions years ago, the basic principles of neutrophil recruitment are apparently conserved in all vertebrates. © 2014 Published by Elsevier Ltd.

44 1. Introduction

45 46 47 48 49 50 51 52 53 54 55

Zebrafish was first used as an animal model to study chemokine biology in 2000 (Long et al., 2000). In 2006, the first comprehensive analysis of the zebrafish chemokine system was published based on comparative whole genome analysis studies (DeVries et al., 2006). and the first transgenic zebrafish lines with fluorescently labeled leukocytes (Hall et al., 2007; Mathias et al., 2006; Renshaw et al., 2006), that revolutionized our ability to dissect the molecular mechanisms that regulate inflammation, were developed. This, along with the remarkable similarity observed between the zebrafish and mam-

56 57 58 59 60 61 62 63 64 65 66

Q1

* Corresponding author. Department of Cell Biology and Histology, Faculty of Biology, University of Murcia, Murcia 30100, Spain. Tel.: +868 887581; fax: +868 883963. E-mail-address: [email protected] (V. Mulero). ** Corresponding author. CSaldanha Laboratory, Instituto de Medicina Molecular, Instituto de Bioquímica, Faculdade de Medicina, Universidade de Lisboa, Lisboa 1649-028, Portugal. E-mail address: [email protected] (Â. Calado). 1 These authors contributed equally to the work.

malian immune systems and the possibility of using non-invasive procedures to study inflammation in vivo, led to zebrafish emerging as an ideal model for the study of leukocyte recruitment. In particular, zebrafish has become an attractive and powerful new tool to study CXCL8 biology in inflammation (de Oliveira et al., 2013; Deng et al., 2013; Oehlers et al., 2010; Sarris et al., 2012). Similar to the carp, the zebrafish expresses two homologs of the human CXCL8, the Cxcl8-l1 and the Cxcl8-l2 (van der Aa et al., 2010) and both chemokines have been shown to be induced under inflammatory conditions (de Oliveira et al., 2013; Deng et al., 2013; Oehlers et al., 2010; Sarris et al., 2012; van der Aa et al., 2010). In particular, we have previously shown that Cxcl8-l1 and l2 are induced after tail-fin wounding, the latter being more potently induced than Cxcl8-l1 (de Oliveira et al., 2013). In this wound-associated inflammatory model, both were equally observed to be essential for neutrophil recruitment to the inflamed area (de Oliveira et al., 2013). In this respect, Cxcl8-l1 has been shown to be expressed in tissuebound gradients in vivo by binding to heparan sulfate proteoglycans (HSPGs) so as to guide and control neutrophil speed in order to promote their recruitment to the inflammatory locus (Sarris et al., 2012). In addition, Cxcl8-l1-mediated neutrophil recruitment from

http://dx.doi.org/10.1016/j.dci.2014.11.004 0145-305X/© 2014 Published by Elsevier Ltd.

Please cite this article in press as: Sofia de Oliveira, et al., Cxcl8-l1 and Cxcl8-l2 are required in the zebrafish defense against Salmonella Typhimurium, Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.11.004

67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87

ARTICLE IN PRESS S. de Oliveira et al./Developmental and Comparative Immunology ■■ (2014) ■■–■■

2

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

the caudal hematopoietic tissue to sites of Pseudomonas aeruginosa infection has been shown to be dependent of the function of Cxcr2 but not of Cxcr1 in zebrafish larvae (Deng et al., 2013). Just as this last study, zebrafish studies addressing the expression and/or role of Cxcl8 chemokines in infection have mostly focused on Cxcl8-l1, overlooking the other homolog. For this reason, we believe that in order to lend weight to the use of zebrafish as an animal model for the study of inflammation/immunity and, more precisely, neutrophil function, a full understanding of the biological roles of both Cxcl8-l1 and l2 in the zebrafish immune defense was needed. In this regard, we consider it to be of utmost importance to ascertain whether these two chemokines have different biological functions in infection-elicited inflammation. For this, we first made use of specific infection models, such as the Spring viremia of carp virus (SVCV) infection, or subjected zebrafish larvae to treatment with specific PAMPs, such as poly I:C or bacterial DNA, which are known to produce inflammatory responses in the context of particular infection models. In these assays, we observed that the gene expression of both Cxcl8s was always up-regulated. To further address their role in infection, we focused on S. Typhimurium infection (Stockhammer et al., 2009; van der Sar et al., 2003), a well characterized infection model in zebrafish (Milligan-Myhre et al., 2011). In this model, we observed that cxcl8–deficient larvae were more susceptible than controls in the first 72 h post-infection (hpi). Moreover, we also observed that chemokine-deficient larvae presented: (i) a significantly reduced neutrophil recruitment at 6 h postinfection (hpi), and (ii) reduced bacteria clearance from the site of infection at 24 hpi. Taken together, our findings demonstrate that both chemokines are important for larval immune defense against infection, as has already been demonstrated in the response to wounding (de Oliveira et al., 2013).

32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

2. Materials and methods 2.1. Zebrafish husbandry All experiments with live animals were performed using protocols approved by the European Union Council Guidelines (86/ 609/EU), the Spanish RD 53/2013 and the Bioethical Committee of the University of Murcia (approval number #537/2011). Fertilized zebrafish eggs were obtained from the natural spawning of wildtype (obtained from the Zebrafish International Resource Center) and the Tg(mpx:gfp)i114 line, in which the GFP expression is driven by the myeloid-specific peroxidase (mpx) promoter and whose neutrophils are green fluorescent (Renshaw et al., 2006), held at our facilities following standard husbandry practices. Animals were maintained in a 12 h light/dark cycle at 28.5 °C.

48 49 50 51 52 53 54 55 56

2.2. Characterization of zebrafish CXCL8 Both zebrafish Cxcl8s sequences used in this study have previously been identified and studied by us and others (de Oliveira et al., 2013; Deng et al., 2013; van der Aa et al., 2010). Protein sequence alignments of zebrafish Cxcl8-l1 (XP_001342606) and Cxcl8-l2 (HF674400) with human CXCL8 (NP_000575) were generated using Q3 Clustal Omega (http://www.ebi.ac.uk/Tools/msa/clustalo/).

57 58 59 60 61 62 63 64

2.3. Morpholino knockdown The following splice blocking morpholino-modified antisense oligonucleotides (morpholinos (MO), Gene Tools) were injected into 1-cell stage fertilized eggs: MO cxcl8-l1 E1/I1 5’-GGTTTTGCATGTTCACTTAC CTTCA-3’ (4 ng/egg), MO cxcl8-l2 E1/I1 5’-TTAGTATCTGCTTACCCT CATTGGC-3’ (4 ng/egg) (de Oliveira et al., 2013). Standard control MO

(MO Std) purchased from GeneTools was used as control. MOs were validated by RT-PCR, as described previously (de Oliveira et al., 2013). Briefly, total RNA was prepared from 3 days post-fertilization (dpf) whole-larvae using TRIzol reagent and purified with PureLink RNA MiniKit (Invitrogen), following the manufacturer’s instructions and treated with DNase I, amplification grade (1 U/μg RNA; Invitrogen). The SuperScript III RNase H- reverse transcriptase (Invitrogen) was used to synthesize first-strand cDNA with oligo(dT)18 primer from 1 μg of total RNA at 50 °C for 50 min. To confirm MO efficiency, PCR was performed in an Eppendorf Mastercycle Gradient Instrument (Eppendorf) using the following program: 2 min at 95 °C, followed by 35 cycles of 45 s at 95 °C, 45 s at the specific annealing temperature, 1 min at 72 °C, and finally 10 min at 72 °C. The primers used were: cxcl8-l1-Fw 5’CCAGCTGAACTGAGCTCCTC-3’, cxcl8-l1-Rv 5’-GGAGATCTGTCTGGAC CCCT-3’, cxcl8-l2-Fw 5’-CCACACACACTCCACACACA-3’, cxcl8-l2-Rv 5’TGCTGCAAACTTTTCCTTGA -3’, actb-Fw 5’-GGCACCACACCTTCTACAATG3’ and actb-Rv 5’- GTGGTGGTGAAGCTGTAGCC-3’. 2.4. Analysis of gene expression Total RNA was extracted from whole larvae and gene expression analysis was performed as previously reported (de Oliveira et al., 2013). For real-time PCR (qPCR), total RNA was extracted from tail tissue and reverse transcribed as indicated above. Real-time PCR was performed with an ABIPrism 7500 instrument (Applied Biosystems) using SYBRGreen (AppliedBiosystems). Reaction mixtures were incubated for 10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C, 1 min at 60 °C, and finally 15 s at 95 °C, 1 min 60 °C, and 15 s at 95 °C. Gene expression was normalized to the ribosomal protein S11 (rps11) content in each sample using the comparative Ct method (2-ΔΔCt) (Pfaffl, 2001). The primers used were: rps11-Fw 5’-ACAGAAATGCCCCTTCACTG-3’, rps11Rv 5’-GCCTCTTCTCAAAACGGTTG-3’, cxcl8-l1-Fw 5’-GTCGCTGCATTGA AACAGAA-3’, cxcl8-l1-Rv 5’-CTTAACCCATGGAGCAGAGG-3’, cxcl8-l2Fw 5’-GCTGGATCACACTGCAGAAA-3’, cxcl8-l2-Rv 5’- TGCTGCAAA CTTTTCCTTGA -3’. In all cases, each PCR was performed in triplicate samples and repeated at least with two independent experiments. Statistical analysis was performed using two-way ANOVA and a post hoc Tukey’s test generated with Graph Pad Prism5 software. 2.5. SVCV infection and Poly(I:C)/vDNA stimulation SVCV infections were carried out as previously described (Lopez-Munoz et al., 2009, 2010). Repeats of molecular CpG motifs obtained as phenol-extracted genomic Vibrio anguillarum DNA (vDNA, 50 μg/ml) (Pelegrin et al., 2004) and Poly (I:C) (25 μg/ml) were used to stimulate 3 dpf zebrafish larvae by bath immersion (Galindo-Villegas et al., 2012). Incubation was carried out for 24 h for SVCV and 4 h for PAMPs at 28.5 °C. Whole larvae were collected into TRIzol for RNA extraction and gene expression analysis. 2.6. Salmonella Typhimurium culture S. Typhimurium wild type (WT) or expressing DsRedT3 were inoculated in 5 mL of LB (for S. Typhimurium) or LB with 40 μg/ml Kanamycin (for S Typhimurium:DsRedT3) incubated overnight at 37 °C at 250–300 rpm (Benard et al., 2012). The following morning inocula were diluted 1/5 (WT) or 2/5 (S. Typhimurium:DsRedT3) in the corresponding media, with 0.3 M NaCl and incubated at 37 °C until 1.5 optical density at 600 nm. Bacteria were diluted in sterile Q4 PBS for further experimentation. 2.7. Infection survival assay Larvae of 2 dpf were anesthetized in embryo medium with 0.16 mg/ml tricaine, and 10 bacteria per larvae were microinjected into the yolk sac. Larvae were allowed to recover in egg water

Please cite this article in press as: Sofia de Oliveira, et al., Cxcl8-l1 and Cxcl8-l2 are required in the zebrafish defense against Salmonella Typhimurium, Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.11.004

65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

ARTICLE IN PRESS S. de Oliveira et al./Developmental and Comparative Immunology ■■ (2014) ■■–■■

1 2 3 4 5 6 7 8 9

3

Fig. 1. Cxcl8-l1 and Cxcl8-l2 are important for zebrafish survival upon infection. (A) Zebrafish 2 dpf Tg(mpx:GFP)i114 larvae were infected with SVCV for 24 h or, S. Typhimurium for 2 h, or stimulated with Poly(I:C) or vDNA for 4 h by bath immersion. The mRNA levels of the cxcl8-l1 and cxcl8-l2 were determined by RT-qPCR. Gene expression was normalized against rps11 and each control condition. Each bar represents the mean ± SEM of triplicate samples from pooled larvae and the results are representative of two independent experiments. P values were calculated using one-way ANOVA and the Tukey multiple comparison test. “a” represents P < 0.001 after statistical analysis with control larvae. (B) RT-PCR of cxcl8-l1 and cxcl8-l2 transcripts detection, in 3 and 5 dpf Tg(mpx:gfp)i114 control and morphant larvae. The insertion of intron 1 in MOs targeting E1/I1 boundary resulted in several premature stop codons and early truncated Cxcl8 proteins (22 of 98 aa for Cxcl8-l1 and 24 of 118 aa for Cxcl8-l2). (C) Survival curves of 2dpf larvae infected with WT S. Typhimurium from 0 to 3 dpi. Each curve represents the mean of three independent experiments. Non-infected: MO StdC n = 29; MO cxcl8l1: n = 30; MO cxcl8l2: n = 30. Infected: MO StdC: n = 82; MO cxcl8l1: n = 77; MO cxcl8l2: n = 68. P values were calculated using Log-Rank Mantel-Cox test, *P < 0.5, and ***P < 0.001.

10 11 12 13

at 28–29 °C, and monitored for clinical signs of disease or mortality over 72 h. In parallel, at 2 hpi, whole larvae were collected into TRIzol for RNA extraction and gene expression analysis.

2.8. Neutrophil recruitment assay To study neutrophil recruitment to a localized site of S. Typhimurium infection, 2 dpf larvae were anesthetized in embryo medium with 0.16 mg/ml tricaine and mounted in 1% low melting point agarose supplemented with 0.16 mg/ml tricaine. 0.5 nL of PBS or S. Typhimurium:DsREDT3 suspension, supplemented with phenol red, was then injected into the otic ear vesicle. In the latter condition, 100 bacteria per larvae were microinjected into the otic ear. Embryo medium with 0.16 mg/ml tricaine solution was added, in order to maintain the embryos hydrated during the experiments. Images of the otic area were taken 1, 6 and 24 h post-injection (hpi). At 6 hpi, agarose was taken from the tail fin area to prevent larval death due to repressed growth and was imaged at 24 hpi. Neutrophil counts and S. Typhimurium:DsRedT3 fluorescence intensity were determined at 1, 6 and 24 hpi. Images were acquired using a Leica

31 32 33

2.9. Statistical analysis

14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

MZ16F fluorescence stereo microscope and treated with ImageJ software (http://rsb.info.nih.gov/ij/).

Data were analyzed by analysis of one- or two-way analysis of variance (ANOVA) with followed by a post hoc Tukey (qPCR) or Bonferroni multiple range test (neutrophil recruitment and S. Typhimurium fluorescence quantification) to determine differences between groups. The contingency graphs were analyzed by the Log-Rank Mantel-Cox test.

34 35 36 37 38 39 40 41 42

3. Results and discussion 3.1. Cxcl8s expression is induced in response to different PAMPs and infectious stimuli in zebrafish larvae Despite the fact that the zebrafish possesses two distinct CXCL8 homologs of human CXCL8, zfCxcl8-l1 and zfCxcl8-l2, the second showing higher homology with its human counterpart (de Oliveira

Please cite this article in press as: Sofia de Oliveira, et al., Cxcl8-l1 and Cxcl8-l2 are required in the zebrafish defense against Salmonella Typhimurium, Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.11.004

43 44 45 46 47 48 49 50

ARTICLE IN PRESS 4

1 2 3 4 5 6

S. de Oliveira et al./Developmental and Comparative Immunology ■■ (2014) ■■–■■

Fig. 2. Neutrophil recruitment and bacterial clearance after S. Typhimurium infection is dependent on both Cxcl8s. Zebrafish one-cell stage Tg(mpx:GFP)i114 embryos were microinjected with standard control (MO StdC) or cxcl8-l1 or l2 morpholinos (MO Cxcl8-l1 or MO cxcl8-l2) and, at 2 dpf, were further microinjected with PBS or S. Typhimurium:DsRedT3 bacteria into the otic vesicle. (A) Schematic representation of the otic vesicle injection assay. (B) Representative images of red (S. Typhimurium:DsRedT3) and green (neutrophils) channels of otic vesicles (C) Counts of fluorescent neutrophils at the site of infection were made 1, 6 and 24 hpi. (D) Fluorescence intensity quantification of S. Typhimurium:DsRedT3 bacteria 1, 6 and 24 hpi. All data are represented as means ± SEM. MO StdC n = 29; MO cxcl8-l1 n = 30; MO cxcl8-l2 n = 29. P values were calculated using one-way ANOVA and the Bonferroni multiple comparison test (*P < 0.5, **P < 0.01; ***P < 0.001). Scale bars = 100 μm.

7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26

et al., 2013; van der Aa et al., 2010), previous studies have mostly addressed the expression and/or role of Cxcl8-l1 in infection overlooking Cxcl8-l2 (de Oliveira et al., 2013; Deng et al., 2013; Oehlers et al., 2010; Sarris et al., 2012; van der Aa et al., 2010, 2012). As such, it is currently unclear whether Cxcl8-l2 plays a role in infection and, if this is the case, whether these two chemokines play distinct roles in zebrafish infection, as is suggested by the different expression profiles of carp Cxcl8s after infection (van der Aa et al., 2010). In order to address these issues, we started by analyzing the gene expression levels of both Cxcl8s, using larvae previously infected with virus (SVCV) (Lopez-Munoz et al., 2010) or bacteria (S. Typhimurium) (Benard et al., 2012), or incubated in the presence of two different PAMPs, namely the Poly(I:C), which is structurally similar to viral double-stranded RNAs and is sensed by TLR3, or with genomic DNA from the bacteria Vibrio anguillarum DNA (vDNA), which is recognized by TLR9 (Sepulcre et al., 2009). We observed that the gene expression of both chemokines was significantly up-regulated in whole larvae in response to all these stimuli (Fig. 1A), thus confirming that both Cxcl8s are involved in the inflammatory processes

elicited upon infection, as previously observed upon wounding (de Oliveira et al., 2013). 3.2. Cxcl8s are required for zebrafish larva survival upon S. Typhimurium infection After establishing that both Cxcl8s were induced in response to different infectious stimuli, we next addressed the relevance of these chemokines to larvae survival upon bacterial infection. For such, survival curves were performed with 2 dpf (days-post fertilization) cxcl8 morphants and control larvae infected with S. Typhimurium, a gramnegative bacteria known to be involved in food poisoning and extensively used as an infection model in zebrafish (Meijer and Spaink, 2011; Stockhammer et al., 2009; van der Sar et al., 2003). Although survival curves are usually made until 5 to 7 days after infection, here, we only focus on the early stages of infection (1–3 days post infection). This limitation was mainly due to two reasons: (i) the first and most important, gene expression silencing efficiencies of both cxcl8-l1 and cxcl8-l2 splice-blocking morpholinos were

Please cite this article in press as: Sofia de Oliveira, et al., Cxcl8-l1 and Cxcl8-l2 are required in the zebrafish defense against Salmonella Typhimurium, Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.11.004

27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45

ARTICLE IN PRESS S. de Oliveira et al./Developmental and Comparative Immunology ■■ (2014) ■■–■■

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57

reduced 5 dpf onwards (Fig. 1B), and (ii) Cxcl8 is a pro-inflammatory molecule responsible for neutrophil recruitment, the first immune cells being recruited to the inflamed area, and thus it is mainly important in the early stages of inflammation. By performing survival experiments until 3 dpi, we observed that, upon S. Typhimurium infection, both cxcl8-deficient larvae were significantly more susceptible than the controls (Fig. 1C), demonstrating that both zebrafish Cxcl8s are important for the immune response against S. Typhimurium. 3.3. Both Cxcl8s are required for neutrophil recruitment and bacteria clearance in S. Typhimurium infection Next we hypothesized that the higher susceptibility to S. Typhimurium infection of cxcl8-deficient larvae might be due to deficient neutrophil recruitment. In order to test this hypothesis, cxcl8 morphants and control larvae were injected with DsRedT3 expressing S. Typhimurium into the otic vesicle (Fig. 2A). Larvae from both cxcl8-deficient larvae showed significantly decreased neutrophil recruitment to the infected ears at 6 hpi compared to PBS-injected control larvae (Fig. 2B and C). Additionally we observed that cxcl8 morphants showed a significantly decreased ability to clear bacteria from the site of infection at 24 hpi in comparison with control larvae (Fig. 2B and D). These results strongly suggest that the higher susceptibility of cxcl8 morphants to S. Typhimurium infection is mainly related to deficient neutrophil recruitment, which, directly or indirectly, may further affect bacterial clearance. However, it cannot be completely ruled out that lower recruitment of macrophages also contributes to reduced bacterial clearance. Overall, we report here that Cxcl8-l1 and l2 are important for larval survival in the first 72 h following S. Typhimurium infection, both controlling neutrophil recruitment and modulating bacterial clearance in the early stages of the infection. In line with our previous observations in the wound-associated inflammation model (de Oliveira et al., 2013), both Cxcl8s seem to be equally important in the zebrafish immune response against infections. A plausible explanation for these results as well as for those previously reported for wounding (de Oliveira et al., 2013), is that these two chemokines function as a heterodimer. Additional work will be required to clarify this issue. Nevertheless, we conclude that both Cxcl8s play central roles in neutrophil recruitment and in the inflammatory response of zebrafish against infection or tissue damage, as happens in mammals. These results, together with our growing knowledge concerning neutrophil biology during the zebrafish inflammatory process, strongly indicate that the basic principles governing the above-mentioned process are conserved between fish and humans, even though these species diverged from a common ancestor about 450 million years ago. Altogether, these considerations firmly place zebrafish in the frontline of the in vivo study of Cxcl8 biology in preference to other experimental animal models. Acknowledgements We thank I. Fuentes and P. Martínez for excellent technical assistance and Dr. S. Renshaw for the Tg(mpx:gfp) line. This work was supported by Fundação para a Ciência e Tecnologia (FCT) via S. de Oliveira PhD Fellowship Grant (SFRH/BD/62674/2009), the Spanish

5

Ministry of Economy and Competence (grants BIO2011-23400 and CSD2007-00002 to V.M., co-funded with Fondos Europeos de Desarrollo Regional/European Regional Development Funds).

58 59 60 61

References Benard, E.L., van der Sar, A.M., Ellett, F., Lieschke, G.J., Spaink, H.P., Meijer, A.H., 2012. Infection of zebrafish embryos with intracellular bacterial pathogens. J. Vis. Exp. de Oliveira, S., Reyes-Aldasoro, C.C., Candel, S., Renshaw, S.A., Mulero, V., Calado, A., 2013. Cxcl8 (IL-8) mediates neutrophil recruitment and behavior in the zebrafish inflammatory response. J. Immunol. 190, 4349–4359. Deng, Q., Sarris, M., Bennin, D.A., Green, J.M., Herbomel, P., Huttenlocher, A., 2013. Localized bacterial infection induces systemic activation of neutrophils through Cxcr2 signaling in zebrafish. J. Leukoc. Biol. 93, 761–769. DeVries, M.E., Kelvin, A.A., Xu, L., Ran, L., Robinson, J., Kelvin, D.J., 2006. Defining the origins and evolution of the chemokine/chemokine receptor system. J. Immunol. 176, 401–415. Galindo-Villegas, J., Garcia-Moreno, D., de Oliveira, S., Meseguer, J., Mulero, V., 2012. Regulation of immunity and disease resistance by commensal microbes and chromatin modifications during zebrafish development. Proc. Natl. Acad. Sci. U. S. A. 109, E2605–E2614. Hall, C., Flores, M.V., Storm, T., Crosier, K., Crosier, P., 2007. The zebrafish lysozyme C promoter drives myeloid-specific expression in transgenic fish. BMC Dev. Biol. 7, 42. Long, Q., Quint, E., Lin, S., Ekker, M., 2000. The zebrafish scyba gene encodes a novel CXC-type chemokine with distinctive expression patterns in the vestibuloacoustic system during embryogenesis. Mech. Dev. 97, 183–186. Lopez-Munoz, A., Roca, F.J., Meseguer, J., Mulero, V., 2009. New insights into the evolution of IFNs: zebrafish group II IFNs induce a rapid and transient expression of IFN-dependent genes and display powerful antiviral activities. J. Immunol. 182, 3440–3449. Lopez-Munoz, A., Roca, F.J., Sepulcre, M.P., Meseguer, J., Mulero, V., 2010. Zebrafish larvae are unable to mount a protective antiviral response against waterborne infection by spring viremia of carp virus. Dev. Comp. Immunol. 34, 546–552. Mathias, J.R., Perrin, B.J., Liu, T.X., Kanki, J., Look, A.T., Huttenlocher, A., 2006. Resolution of inflammation by retrograde chemotaxis of neutrophils in transgenic zebrafish. J. Leukoc. Biol. 80, 1281–1288. Meijer, A.H., Spaink, H.P., 2011. Host-pathogen interactions made transparent with the zebrafish model. Curr. Drug Targets 12, 1000–1017. Milligan-Myhre, K., Charette, J.R., Phennicie, R.T., Stephens, W.Z., Rawls, J.F., Guillemin, K., et al., 2011. Study of host-microbe interactions in zebrafish. Methods Cell Biol. 105, 87–116. Oehlers, S.H., Flores, M.V., Hall, C.J., O’Toole, R., Swift, S., Crosier, K.E., et al., 2010. Expression of zebrafish cxcl8 (interleukin-8) and its receptors during development and in response to immune stimulation. Dev. Comp. Immunol. 34, 352–359. Pelegrin, P., Chaves-Pozo, E., Mulero, V., Meseguer, J., 2004. Production and mechanism of secretion of interleukin-1beta from the marine fish gilthead seabream. Dev. Comp. Immunol. 28, 229–237. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45. Renshaw, S.A., Loynes, C.A., Trushell, D.M., Elworthy, S., Ingham, P.W., Whyte, M.K., 2006. A transgenic zebrafish model of neutrophilic inflammation. Blood 108, 3976–3978. Sarris, M., Masson, J.B., Maurin, D., Van der Aa, L.M., Boudinot, P., Lortat-Jacob, H., et al., 2012. Inflammatory chemokines direct and restrict leukocyte migration within live tissues as glycan-bound gradients. Curr. Biol. 22, 2375–2382. Sepulcre, M.P., Alcaraz-Perez, F., Lopez-Munoz, A., Roca, F.J., Meseguer, J., Cayuela, M.L., et al., 2009. Evolution of lipopolysaccharide (LPS) recognition and signaling: fish TLR4 does not recognize LPS and negatively regulates NF-kappaB activation. J. Immunol. 182, 1836–1845. Stockhammer, O.W., Zakrzewska, A., Hegedus, Z., Spaink, H.P., Meijer, A.H., 2009. Transcriptome profiling and functional analyses of the zebrafish embryonic innate immune response to Salmonella infection. J. Immunol. 182, 5641–5653. van der Aa, L.M., Chadzinska, M., Tijhaar, E., Boudinot, P., Verburg-van Kemenade, B.M., 2010. CXCL8 chemokines in teleost fish: two lineages with distinct expression profiles during early phases of inflammation. PLoS ONE 5, e12384. van der Aa, L.M., Chadzinska, M., Derks, W., Scheer, M., Levraud, J.P., Boudinot, P., et al., 2012. Diversification of IFNgamma-inducible CXCb chemokines in cyprinid fish. Dev. Comp. Immunol. van der Sar, A.M., Musters, R.J., van Eeden, F.J., Appelmelk, B.J., Vandenbroucke-Grauls, C.M., Bitter, W., 2003. Zebrafish embryos as a model host for the real time analysis of Salmonella typhimurium infections. Cell. Microbiol. 5, 601–611.

Please cite this article in press as: Sofia de Oliveira, et al., Cxcl8-l1 and Cxcl8-l2 are required in the zebrafish defense against Salmonella Typhimurium, Developmental and Comparative Immunology (2014), doi: 10.1016/j.dci.2014.11.004

62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129