bs_bs_banner
Animal Science Journal (2014) ••, ••–••
doi: 10.1111/asj.12220
ORIGINAL ARTICLE Cyclopamine did not affect mouse oocyte maturation in vitro but decreased early embryonic development Yang LIU,1 Zhuying WEI,2 Yafei HUANG,2 Chunling BAI,2 Linsen ZAN1 and Guangpeng LI2 1
College of Animal Science and Technology, Northwest A&F University, Yangling and 2The Key Laboratory of National Education Ministry for Mammalian Reproductive Biology and Biotechnology, Inner Mongolia University, Hohhot, China
ABSTRACT Hedgehog (Hh) pathway has been studied in various animal body life procedures and is suggested to be important for the development of multiple organs. The genes involved in the Hh signaling pathway were expressed in the ovary of mice, pigs and cattle. However, the function of Hh signaling pathway on oocyte maturation and early embryonic development is still controversial. We detected the effect of sonic hedgehog (Shh) and cyclopamine on the in vitro maturation of mouse oocytes and embryo development. The results showed that the presence of Shh or cyclopamine resulted in similar oocyte maturation to control groups. Shh did not improve early embryonic development. However, the supplement of cyclopamine depressed early embryo development. The mRNA of shh, ptch1, smo and gli1 were less detected in the denuded oocytes. The expression levels of ptch1 ascended from the uncleaved zygote to blastocyst stage. Smo or gli1 were expressed on a higher level at the two-cell or four-cell stage in early embryonic development separately. Therefore, Shh did not affect mouse oocyte maturation and early embryo development, but cyclopamine led to inhibited development of mouse early embryo. The effects of Hh signaling on the oocyte maturation and early embryo development might be species-specific.
Key words: embryo, gli1, patched 1, smoothened, sonic hedgehog.
INTRODUCTION Hedgehog (Hh) signals play important roles in regulating cell fate specification, cell proliferation and cell survival in diverse cells (Ingham & McMahon 2001). The Hh family is highly conserved from Drosophila to mammals and generally acts as a morphogen to modulate almost all of the processes during embryo or adult development (Nusslein-Volhard & Wieschaus 1980; Ingham & McMahon 2001; McMahon et al. 2003; Wijgerde et al. 2005; Spicer et al. 2009). Vertebrates have at least three Hh proteins: sonic hedgehog (Shh), indian hedgehog (Ihh) and desert hedgehog (Dhh) (Lee et al. 2006; Riobo & Manning 2007; Russell et al. 2007). The Hh signaling pathway is mediated through a cell surface receptor system consisting of two proteins, the receptor Patched (Ptch) and its co-receptor Smoothened (Smo). In the absence of Hh ligand, Smo is inactive, accompanied with the suppression of Ptch, and inhibited downstream signaling cascades (Taipale et al. 2002; Watkins & Peacock 2004). In contrast, in the presence of Hh, suppression of Smo was lifted to relay its signaling. Signaling through Smo is conveyed © 2014 Japanese Society of Animal Science
by modulation of the activity of a family of transcription factors, Gli1, Gli2 and Gli3 (Wijgerde et al. 2005; Huangfu & Anderson 2006; Lee et al. 2006; Russell et al. 2007). Gli1 is a transcriptional target of Hh signaling and has been used as an indicator of activated Hh signaling (Marigo et al. 1996; Lee et al. 1997; Ahn & Joyner 2004; Ikram et al. 2004). Whereas deletion of gli1 in mice is compatible with normal development (Bai et al. 2002), deletion of gli2 and gli3 generate phenotypes that mimic deletion of shh, indicating that they are essential for mediating its effects on development (Mo et al. 1997). In animal reproductive systems, Hh pathway regulated and influenced primordial germ cell (PGC) migration in the Drosophila embryo (Mich et al. 2009)
Correspondence: Linsen Zan, College of Animal Science and Techonology, Northwest A&F University, No.22 Xinong Road, Yangling, Shaanxi 712100 China. (Email: zanlinsen@ 163.com) Received 23 May 2013; accepted for publication 30 January 2014.
2 Y. LIU et al.
and cell-cell adhesion in the zebrafish embryo (Ingham & McMahon 2001; Mich et al. 2009). Hh signal can stimulate both somatic cell and stem cell proliferation in Drosophila ovary (Zhang & Kalderon 2001). In mammals, Hh signals are expressed in ovaries or testes in rodents (Wijgerde et al. 2005; Russell et al. 2007; Ren et al. 2009; Spicer et al. 2009), pig (Nguyen et al. 2009) and cattle (Spicer et al. 2009), and alters development of the female reproductive tract (Migone et al. 2012). In testis development, Dhh has been proven to be produced by Sertoli cells (Wijgerde et al. 2005; Morales et al. 2009), fetal leydig cells (Yao et al. 2002; Barsoum et al. 2009) and spermatogenic cells (Pierucci-Alves et al. 2001; Yao et al. 2002; Barsoum et al. 2009). Hh signals and the receptors are detected in whole ovary, follicles, granulosa cells and corpora lutea (Wijgerde et al. 2005; Russell et al. 2007; Nguyen et al. 2009; Ren et al. 2009; Spicer et al. 2009). In the study of porcine oocytes, Nguyen reported that Shh signaling pathway is active in porcine ovaries and improves oocyte maturation, and the Shh receptor Ptch1 and Smo are expressed at various stages of parthenogenetic embryos (Nguyen et al. 2009). Supplementation of Shh increased blastocyst development (Nguyen et al. 2010, 2011); the presence of cyclopamine, a Shh inhibitor, in culture medium had no significant effect on blastocyst rate and total cell number (Nguyen et al. 2010). These results suggested that the Shh pathway had beneficial effects on oocyte maturation and preimplantation development of porcine embryos. However, in other species, including the mouse, there is no report on the effect of Shh or cyclopamine on oocyte maturation and in vitro embryo development. Otherwise, there are contradictory conclusions on the point of Hh signaling pathway taking part in the regulation of ovary and oocyte development in mammals (Wijgerde et al. 2005). The present study was designed to investigate whether Shh or cyclopamine affected mouse oocyte maturation and subsequent embryo development.
MATERIALS AND METHODS Animals and reagents All experiments adhered to procedures consistent with the National Institute of Biological Sciences guide for the care and use of laboratory animals. All chemicals, unless stated otherwise, were purchased from Sigma-Aldrich Chemical Inc. (St. Louis, MO, USA).
ovary and to release the cumulus oocyte complexes (COCs). Only the COCs with at least three intact layers of cumulus cells were collected.
In vitro maturation (IVM) of oocytes The COCs were washed with M2 medium three times, then added into Toyoda Yokoyama Hoshi medium (Chen 2000) drops containing 4 mg/mL bovine serum albumin and 0.1 IU/mL PMSG and 5% fetal bovine serum (FBS), and the drops were covered by mineral oil. Every 50 μL drop contained 20–25 COCs. After being cultured for 14 h at 37°C with an atmosphere of 5% CO2 and maximum humidity, the maturation rate was evaluated by the extrusion of the first polar body (PB1). COCs in germinal vesicle (GV) stage or in vitro matured for 8 h or in vitro matured for 14 h and reached MII stage, were pipetted to peel off the cumulus cells. The denuded oocytes and cumulus cells were collected for RNA extraction.
Embryo culture To collect ovulated fertilized zygotes, mice were peritoneally injected with 10 IU human chorionic gonadotropin and made to copulate at 48 h after PMSG injection. About 20 h later, in vivo fertilized zygotes were collected from oviduct ampullas and incubated in 0.5 mg/mL hyaluronidase briefly and then pipetted repeatedly to remove the cumulus cells. The denuded zygotes were cultured in modified simplex optimization medium with a higher K+ concentration (Millipore, Billerica, MA, USA) drops covered by mineral oil at 37°C in an atmosphere of 5% CO2 and maximum humidity. Embryos which developed to the stage of two-cell, fourcell, morula and blastocysts were counted every day and collected for RNA extraction.
Immunocytochemical staining of oocytes Oocytes were fixed in phosphate-buffered saline (PBS) containing 4% paraformaldehyde for 30 min at room temperature. After being washed twice with PBS containing 0.1% bovine serum albumin (BSA), oocytes were stored in PBS containing 0.1% BSA in 4°C for less than 1 week. Permeablization was carried out in 0.5% TritonX-100 and 0.1% BSA in PBS at room temperature for 50 min. Then the oocytes were blocked in 3% BSA in PBS for 30 min, and subsequently incubated in a mouse monoclonal antibody against α-tubulin (T-5168; Sigma) diluted by PBS containing 3% BSA (1:500) at 4°C overnight. Then they were washed with PBS containing 0.1% BSA three times, and incubated in fluorescein isothiocyanate (FITC)-labeled goat anti mouse immunoglobulin G (IgG: F-0257; Sigma) diluted with PBS containing 0.1% BSA (1:1000) at 37°C for 80 min. Chromosome was stained with 5 μg/mL 4′,6-diamidino-2phenylindole (DAPI) for 10 min at room temperature. After that, oocytes were mounted on slides with fluorescent mounting media (KPL, Gaithersburg, MD, USA) and examined under a Nikon confocal microscope.
Oocytes collection
RNA extraction and quantitative real-time PCR
Female Kunmingwhite mice were superovulated with 10 IU pregnant mare serum gonadotropin (PMSG) by hypodermic injection. After 48 h, the ovaries were taken out and transferred to M2 medium (Nagy et al. 2003). Sterile acupuncture needles were used to pierce the antral follicles on the mouse
Total RNA of oocytes or cumulus cells or embryos were extracted by using Arcturus® PicoPure™ RNA Isolation Kit (Applied Biosystems, Foster City, CA, USA) following the manufacturer’s instructions. The total RNA was reverse transcribed via PrimeScriptTM RT Master Mix (Takara, Otsu,
© 2014 Japanese Society of Animal Science
Animal Science Journal (2014) ••, ••–••
CYCLOPAMINE INHIBITING EMBRYO DEVELOPMENT
Japan). The relative expressions of shh (forward primer 5′- G TTTATTCCCAACGTAGCCGAGA -3′ and reverse primer 5′- C AGAGATGGCCAAGGCATTTA -3′), ptch1 (forward primer 5′CGAGACAAGCCCATCGACATTA -3′ and reverse primer 5′AGGGTCGTTGCTGACCCAAG -3′), smo (forward primer 5′- AAGGCCACCCTGCTCATCTG -3′ and reverse primer 5′AGGCCTTGGCGATCATCTTG -3′) and gli1 (forward primer 5′- AAGGCCCAATACATGCTGGTG -3′ and reverse primer 5′GACCGAAGGTGCGTCTTGAG -3′) were determined by using SYBR® Premix Ex Taq™ II (Tli RNaseH Plus) (Takara, Dalian, China), and carrying out the quantitative real-time PCR on an ABI 7500 RT-PCR system (Applied Biosystems). The levels of 18srRNA (forward primer 5′- CGCTTCCTTACCTGGTTGAT -3′ and reverse primer 5′- GAGCGACCAAAGGAACCATA -3′) RNA were used as an endogenous control (Dunning et al. 2010; Salhab et al. 2010; Adriaenssens et al. 2011). The relative gene expressions were calculated using the 2−ΔΔCt method.
Statistical analysis Statistical analysis was carried out by using SPSS Version 16.0 (SPSS Inc., Chicago, IL, USA). One-way analysis of variance (ANOVA) was done for all data, followed by Duncan’s test. The data analyzed by percentile data were arcsinetransformed before ANOVA analysis and P < 0.05 was considered significant.
RESULTS Maturation of mouse oocytes in the presence of cyclopamine or Shh During oocyte maturation, Shh was added to the culture media at a concentration of 0.02, 0.2 and 2 μg/ mL, respectively. The results showed that the presence of Shh or its inhibitor cyclopamine did not improved oocyte maturation when compared to the control (P > 0.05) (Table 1). The solvent of cyclopamine was dimethyl sulfoxide (DMSO), so a group in which only 0.1% DMSO was supplemented in the medium was set in the experiment. Immunostaining of the matured oocytes showed that either Shh or cyclopamine had no effects on metaphase chromosomal arrangement and spindle morphology (Fig. 1). All the samples from denuded oocytes have large cycle threshold (Ct) values (the overwhelming majority were over 32) when the gene Shh or Ptch1 or Smo or Gli1 was amplified by quanTable 1 Maturation of mouse oocytes incubated with the presence of Shh or cyclopamine
Treatment
Numbers of oocytes
Maturation rate (mean ± SE, %)
Control 0.1% dimethyl sulfoxide Sonic hedgehog (Shh) (0.02 μg/mL) Shh (0.2 μg/mL) Shh (2 μg/mL) Cyclopamine (1 μmol/L) Cyclopamine (10 μmol/L)
94 109 108
91.85 ± 4.52 89.67 ± 2.67 89.07 ± 2.09
103 105 103 109
92.35 ± 1.38 91.77 ± 4.21 90.30 ± 2.27 88.10 ± 2.07
Animal Science Journal (2014) ••, ••–••
3
titative real-time PCR, while the Ct values were between 14 and 21 when amplified by 18srRNA. Therefore, it was considered that four components of Hh signaling pathway shh, ptch1, smo and gli1, were barely expressed in denuded oocytes during the process of IVM of mouse oocytes, regardless of containing cyclopamine in the medium. Expressions of Shh and Ptch1 were higher in the cumulus cell surroundings at the GV stage oocytes or oocytes in vitro matured for 8 h, and then went down when the oocytes came to the MII stage (Fig. 2A,B). The expression of gli1 in cumulus cells was elevating from the beginning to 8 h of IVM, but declining from 8 h to 24 h when the oocytes reached the MII stage (Fig. 2D). For the samples from the control group, the expression of Smo was elevatory in the cumulus cells which in vitro matured for 8 h, compared to in the cumulus cells of GV stage oocytes, and then became lower in the cumulus cells of MII stage oocytes (Fig. 2C). However, when it was treated with cyclopamine, expression of Smo was lower in cumulus cells at 8 h of IVM, and elevated when the oocytes reached the MII stage (Fig. 2C). In cumulus cells, ptch1 and gli1 which are the target genes of Hh signaling, were less expressed when treated by 5 μmol/L cyclopamine compared to the control group and 0.1% DMSO group (P < 0.05) at 8 h of IVM, and the expression of gli1 was depressed when oocytes reached the MII as well (P < 0.05) (Fig. 2B,D).
Shh did not affect mouse embryo development After incubation of mouse zygotes with the addition of Shh, the percentages of two-cell embryos, four-cell embryos, morula and blastocyst development showed no obvious differences as compared to the controls (Table 2).
Cyclopamine decreased the mouse embryo development Addition of cyclopamine to the culture medium affected mouse embryonic development as showed in Table 3. In the treatment group of 1.0 μmol/L or 10.0 μmol/L cyclopamine, 0.1% DMSO was contained in the medium as the solvent. But in the group of 20.0 μmol/L or 50.0 μmol/L cyclopamine, the concentration of DMSO was 0.5% because of the solubility of cyclopamine. Excepting in percentage of two-cell embryos, the development of mouse embryo in the medium containing 0.5% DMSO is not different from the control group and 0.1% DMSO group. The cleavage rates were significantly lower in the 1.0 μmol/L (79.03%) or 10.0 μmol/L (82.33%) cyclopamine group in which the concentration of DMSO was 0.1%, compared to the 0.1% DMSO group (94.04%). The percentage of embryos developing to four-cell stage in 1.0 μmol/L (67.83%) or 10 μmol/L (70.71%) © 2014 Japanese Society of Animal Science
4 Y. LIU et al.
Figure 1 Meiotic apparatus of mouse MII oocytes cultured with cyclopamine. (A, B, C: control; D, E, F: 0.1% dimethyl sulfoxide (DMSO); G, H, I: 1 μmol/L cyclopamine; J, K, L: 10 μmol/L cyclopamine. A, D, G, J: 4′,6-diamidino-2-phenylindole (DAPI); B, E, H, K: α-tubulin; C, F, I, L: merged)
cyclopamine group was also lower than in the 0.1% DMSO (78.05%) group. The percentages of embryos developed to blastocyst in 1.0 μmol/L or 10.0 μmol/L or 20.0 μmol/L group were 36.3% or 35.02% or 31.19%, significantly lower than the control (57.1%, 46.26% and 42.66%), respectively. Only 20% of the embryos developed to blastocysts when the cyclopamine concentration was 50 μmol/L.
Expression of Hh pathway component during early embryonic development The expression of Shh gene was hardly detected in the mouse embryo from the stage of uncleaved zygote to © 2014 Japanese Society of Animal Science
blastocyst by quantitative real-time PCR in our experiment. The expression levels of ptch1 ascended progressively from the uncleaved zygote stage to blastocyst stage in the control group, but were decreased in blastocysts compared to morulas in the DMSO or cyclopamine treated groups (P < 0.05) (Fig. 3A). For smo gene, there was a peak expression level at the two-cell embryo stage, and declined from two-cell embryo stage to blastocyst stage (Fig. 3B). Gli1 was scarcely expressed in uncleaved zygotes or two-cell embryos of mouse, and was expressed highly in fourcell embryos (Fig. 3C). The expression of ptch1 and gli1 in mouse embryos was depressed with the treatment Animal Science Journal (2014) ••, ••–••
CYCLOPAMINE INHIBITING EMBRYO DEVELOPMENT
Relative Smo mRNA Levels
0.8 0.6 0.4 0.2
Relative Ptch1 mRNA Levels
control DMSO 5 µM cyclopamine
1.0
0
C
B
1.2
control DMSO 5 µM cyclopamine
3.0 2.5 2.0 1.5 1.0 0.5
1.6 control DMSO 5 µM cyclopamine
1.4 1.2 1.0 0.8 0.6 0.4 0.2 0
cumulus cumulus cell cumulus of oocytes cell of cell of oocytes at IVM for 8 h oocytes at MII stage GV stage
cumulus cumulus cell cumulus of oocytes cell of cell of oocytes at IVM for 8 h oocytes at MII stage GV stage
D 2.0 Relative Gli1 mRNA Levels
Relative Shh mRNA Levels
A
5
control DMSO 5 µM cyclopamine
1.8 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2
0
0 cumulus cumulus cell cumulus of oocytes cell of cell of oocytes at IVM for 8 h oocytes at MII stage GV stage
cumulus cumulus cell cumulus of oocytes cell of cell of oocytes at IVM for 8 h oocytes at MII stage GV stage
Figure 2 Expression of the component of hedgehog (Hh) signaling pathway in cumulus cells during the in vitro maturation (IVM) of mouse cumulus oocyte complexes (COCs) with or without cyclopamine. (A) Relative expression of sonic hedgehog (Shh) messenger RNA (mRNA). (B) Relative expression of Patched 1 (Ptch1) mRNA. (C) Relative expression of Smoothened (Smo) mRNA. (D) Relative expression of Gli1 mRNA. Table 2
In vitro development of mouse embryos with the presence of sonic hedgehog (Shh)
Shh treatment
Numbers of embryos in each group
Percentage of two-cell embryo (mean ± SE, %)
Percentage of four-cell embryo (mean ± SE, %)
Percentage of morula (mean ± SE, %)
Percentage of blastocyst (mean ± SE, %)
Control 0.5 μg/mL 2.0 μg/mL
144 146 156
74.88 ± 5.17 81.07 ± 5.15 77.37 ± 7.11
62.52 ± 4.80 61.63 ± 6.43 66.65 ± 9.00
56.25 ± 6.91 54.09 ± 8.58 57.95 ± 11.12
53.63 ± 7.40 46.70 ± 10.53 50.29 ± 10.40
of cyclopamine (P < 0.05) from the four-cell stage to blastocyst stage (Fig. 3A,C).
DISCUSSION Previous studies showed that mRNA of ihh, dhh, smo and ptch1 was expressed in mouse preantral follicle or antral follicle, and the receptors Ptch1 and Ptch2, and the transcript factor Gli was found in theca cells and Animal Science Journal (2014) ••, ••–••
corpora luteum (Wijgerde et al. 2005; Russell et al. 2007). Although in situ hybridization did not exclude the probability of the existence of the components of Hh pathway in oocytes in a lower level, the results of RT-PCR have proven that there was only ptch1 expressed in oocytes of different stages; Ihh, Dhh, Ptch2 and Smo did not express in denuded oocytes (Wijgerde et al. 2005). This is in accordance with our research. These results suggested that the mouse © 2014 Japanese Society of Animal Science
6 Y. LIU et al.
Table 3 In vitro development of mouse preimplantation embryos with the presence of cyclopamine
Treatment (μmol/L)
Numbers of embryos in each group
Percentage of two-cell embryo (mean ± SE, %)
Percentage of four-cell embryo (mean ± SE, %)
Percentage of morula (mean ± SE, %)
Percentage of blastocyst (mean ± SE, %)
Control 0.1% DMSO 0.5% DMSO 1.0 μmol/L Cyclopamine 10.0 μmol/L Cyclopamine 20.0 μmol/L Cyclopamine 50.0 μmol/L Cyclopamine
222 234 198 241 258 146 195
91.54 ± 1.21a 94.04 ± 4.57a 85.31 ± 5.20b 79.03 ± 9.45b 82.33 ± 7.05b 80.76 ± 7.17b 70.10 ± 2.81b
80.38 ± 3.32a 78.05 ± 6.00a 72.95 ± 7.69ab 67.83 ± 9.47b 70.71 ± 8.18b 62.86 ± 6.48bc 53.49 ± 7.09c
68.74 ± 4.57a 61.19 ± 7.02ab 63.43 ± 6.68ab 60.92 ± 8.38b 60.56 ± 8.36b 52.89 ± 7.16b 34.51 ± 7.67c
57.13 ± 6.13a 46.26 ± 4.36b 42.66 ± 6.03b 36.31 ± 4.09c 35.02 ± 7.00c 31.19 ± 9.11c 20.19 ± 6.08d
In the same column, different letters indicate significant differences (P < 0.05). DMSO, dimethyl sulfoxide.
70 60
control DMSO 5 µM cyclopamine
50 40 30 20 10
Relative Gli1 mRNA Levels
25
control DMSO 5 µM cyclopamine
20 15 10 5 0
0
C 180
B Relative Smo mRNA Levels
Relative Ptch1 mRNA Levels
A
control DMSO 5 µM cyclopamine
160 140 120 100 80 60 40 20 0
Figure 3 Expression of the component of hedgehog (Hh) signaling pathway in mouse embryos during in vitro culture with or without cyclopamine. (A) Relative expression of Patched 1 (Ptch1) messenger RNA (mRNA). (B) Relative expression of Smoothened (Smo) mRNA. (C) Relative expression of Gli1 mRNA.
oocytes may not respond to the Hh signals released by granulosa cells. Contrary to the mouse, studies in porcine revealed that Smo was not only found in granulosa cells, but was also detected in oocytes, and gli1 expressed in oocytes, cumulus cells, granulosa © 2014 Japanese Society of Animal Science
cells and theca cells of small size follicles (Nguyen et al. 2009). In the study of IVM in pigs, Nguyen et al. (2009) reported that addition of Shh in the culture media improved oocyte maturation by a cumulus cell Animal Science Journal (2014) ••, ••–••
CYCLOPAMINE INHIBITING EMBRYO DEVELOPMENT 7
independent manner, while the supplementation of Shh inhibitor cyclopamine decreased maturation. However, in the mouse the present results showed that mouse oocyte maturation was not affected when adding Shh or cyclopamine to the media. In developing mouse ovaries, the oocytes expressed Shh receptor Ptch1 but lack signal transducer Smo, while the surrounded granulosa cells were Ihh and Dhh positively stained (Wijgerde et al. 2005). In the in vitro culture of mouse follicles the recombinant Shh improved the proliferation of granulosa cells and the growth of preantral follicles (Russell et al. 2007). However, the Shh improvement of follicular growth could be blocked by cyclopamine (Russell et al. 2007). Our results indicated that several components of Hh signaling pathway were expressed in cumulus cells and the expression of the target genes of Hh signaling in cumulus cells were inhibited when treated by cyclopamine supplement. Granulosa cells can be considered as target cells of Hh pathway during follicle development and oocyte maturation. The developmental ability of mouse preimplantation embryos was inhibited when cyclopamine was supplemented in the medium, which is consistent with the porcine embryo development (Nguyen et al. 2010). The blastocyst development of the porcine embryos derived from Shh treated oocytes is higher than that from non-Shh treatment controls (Nguyen et al. 2011). Shh supplementation also increased porcine parthenogenetically activated or nuclear transfer embryos (Nguyen et al. 2010). However, cyclopamine negatively affected the porcine embryo development even in combination with Shh. In the present study, these results indicated that Shh did not improve mouse embryo development, but the addition of cyclopamine significantly decreased the cleavage rates and blastocyst development. In this study, we have not detected the expression of Shh mRNA during embryonic development; we suppose that another Hh homolog may exert in mouse early embryonic development. These results implied that mouse oocytes may not respond to Hh signals. The different effects of Shh on oocyte maturation and embryo development might be due to species differences. Inhibition of the Hh signaling by cyclopamine depressed the development of mouse embryos, which implied that Hh signaling is required for embryo development, but surplus Shh is less functional during mouse early embryonic development.
ACKNOWLEDGMENTS This work was supported by the China National Twelfth ‘Five Year’ Science and Technology Support Project (2011BAD28B04-03), two 863 Programs (2011AA100307-02 and 2013AA102505) and 973 Project (2012CB722306).
Animal Science Journal (2014) ••, ••–••
REFERENCES Adriaenssens T, Segers I, Wathlet S, Smitz J. 2011. The cumulus cell gene expression profile of oocytes with different nuclear maturity and potential for blastocyst formation. Journal of Assisted Reproduction and Genetics 28, 31–40. Ahn S, Joyner AL. 2004. Dynamic changes in the response of cells to positive hedgehog signaling during mouse limb patterning. Cell 118, 505–516. Bai CB, Auerbach W, Lee JS, Stephen D, Joyner AL. 2002. Gli2, but not Gli1, is required for initial Shh signaling and ectopic activation of the Shh pathway. Development 129, 4753–4761. Barsoum IB, Bingham NC, Parker KL, Jorgensen JS, Yao HH. 2009. Activation of the Hedgehog pathway in the mouse fetal ovary leads to ectopic appearance of fetal Leydig cells and female pseudohermaphroditism. Developmental Biology 329, 96–103. Chen D (ed.). 2000. Fertilization Biology: The Mechanism of Fertilization and Reproductive Engineering, 1st edn. Science Perss, Beijing. Dunning KR, Cashman K, Russell DL, Thompson JG, Norman RJ, Robker RL. 2010. Beta-oxidation is essential for mouse oocyte developmental competence and early embryo development. Biology of Reproduction 83, 909– 918. Huangfu D, Anderson KV. 2006. Signaling from Smo to Ci/Gli: conservation and divergence of Hedgehog pathways from Drosophila to vertebrates. Development 133, 3–14. Ikram MS, Neill GW, Regl G, Eichberger T, Frischauf AM, Aberger F, et al. 2004. GLI2 is expressed in normal human epidermis and BCC and induces GLI1 expression by binding to its promoter. Journal of Investigative Dermatology 122, 1503–1509. Ingham PW, McMahon AP. 2001. Hedgehog signaling in animal development: paradigms and principles. Genes & Development 15, 3059–3087. Lee J, Platt KA, Censullo P, Ruiz i Altaba A. 1997. Gli1 is a target of Sonic hedgehog that induces ventral neural tube development. Development 124, 2537–2552. Lee K, Jeong J, Kwak I, Yu CT, Lanske B, Soegiarto DW, et al. 2006. Indian hedgehog is a major mediator of progesterone signaling in the mouse uterus. Nature Genetics 38, 1204–1209. Marigo V, Johnson RL, Vortkamp A, Tabin CJ. 1996. Sonic hedgehog differentially regulates expression of GLI and GLI3 during limb development. Developmental Biology 180, 273–283. McMahon AP, Ingham PW, Tabin CJ. 2003. Developmental roles and clinical significance of hedgehog signaling. Current Topics in Developmental Biology 53, 1–114. Mich JK, Blaser H, Thomas NA, Firestone AJ, Yelon D, Raz E, Chen JK. 2009. Germ cell migration in zebrafish is cyclopamine-sensitive but Smoothened-independent. Developmental Biology 328, 342–354. Migone FF, Ren Y, Cowan RG, Harman RM, Nikitin AY, Quirk SM. 2012. Dominant activation of the hedgehog signaling pathway alters development of the female reproductive tract. Genesis 50, 28–40. Mo R, Freer AM, Zinyk DL, Crackower MA, Michaud J, Heng HH, et al. 1997. Specific and redundant functions of Gli2 and Gli3 zinc finger genes in skeletal patterning and development. Development 124, 113–123.
© 2014 Japanese Society of Animal Science
8 Y. LIU et al.
Morales CR, Fox A, El-Alfy M, Ni X, Argraves WS. 2009. Expression of Patched-1 and Smoothened in testicular meiotic and post-meiotic cells. Microscopy Research and Technique 72, 809–815. Nagy A, Gertsenstein M, Vintersten K, Behringer R (eds). 2003. Manipulating the Mouse Embryo:A Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory Press, New York. Nguyen NT, Lin DP, Siriboon C, Lo NW, Ju JC. 2010. Sonic Hedgehog improves in vitro development of porcine parthenotes and handmade cloned embryos. Theriogenology 74, 1149–1160. Nguyen NT, Lin DP, Yen SY, Tseng JK, Chuang JF, Chen BY, et al. 2009. Sonic hedgehog promotes porcine oocyte maturation and early embryo development. Reproduction Fertility and Development 21, 805–815. Nguyen NT, Lo NW, Chuang SP, Jian YL, Ju JC. 2011. Sonic hedgehog supplementation of oocyte and embryo culture media enhances development of IVF porcine embryos. Reproduction 142, 87–97. Nusslein-Volhard C, Wieschaus E. 1980. Mutations affecting segment number and polarity in Drosophila. Nature 287, 795–801. Pierucci-Alves F, Clark AM, Russell LD. 2001. A developmental study of the Desert hedgehog-null mouse testis. Biology of Reproduction 65, 1392–1402. Ren Y, Cowan RG, Harman RM, Quirk SM. 2009. Dominant activation of the hedgehog signaling pathway in the ovary alters theca development and prevents ovulation. Molecular Endocrinology 23, 711–723. Riobo NA, Manning DR. 2007. Pathways of signal transduction employed by vertebrate Hedgehogs. Biochemical Journal 403, 369–379.
© 2014 Japanese Society of Animal Science
Russell MC, Cowan RG, Harman RM, Walker AL, Quirk SM. 2007. The hedgehog signaling pathway in the mouse ovary. Biology of Reproduction 77, 226–236. Salhab M, Papillier P, Perreau C, Guyader-Joly C, Dupont J, Mermillod P, Uzbekova S. 2010. Thymosins beta-4 and beta-10 are expressed in bovine ovarian follicles and upregulated in cumulus cells during meiotic maturation. Reproduction Fertility and Development 22, 1206–1221. Spicer LJ, Sudo S, Aad PY, Wang LS, Chun SY, Ben-Shlomo I, et al. 2009. The hedgehog-patched signaling pathway and function in the mammalian ovary: a novel role for hedgehog proteins in stimulating proliferation and steroidogenesis of theca cells. Reproduction 138, 329–339. Taipale J, Cooper MK, Maiti T, Beachy PA. 2002. Patched acts catalytically to suppress the activity of Smoothened. Nature 418, 892–897. Watkins DN, Peacock CD. 2004. Hedgehog signalling in foregut malignancy. Biochemical Pharmacology 68, 1055– 1060. Wijgerde M, Ooms M, Hoogerbrugge JW, Grootegoed JA. 2005. Hedgehog signaling in mouse ovary: Indian hedgehog and desert hedgehog from granulosa cells induce target gene expression in developing theca cells. Endocrinology 146, 3558–3566. Yao HH, Whoriskey W, Capel B. 2002. Desert Hedgehog/ Patched 1 signaling specifies fetal Leydig cell fate in testis organogenesis. Genes & Development 16, 1433–1440. Zhang Y, Kalderon D. 2001. Hedgehog acts as a somatic stem cell factor in the Drosophila ovary. Nature 410, 599–604.
Animal Science Journal (2014) ••, ••–••
Animal Science Journal (2014) ••, ••–••
doi: 10.1111/asj.12220
ORIGINAL ARTICLE Cyclopamine did not affect mouse oocyte maturation in vitro but decreased early embryonic development Yang LIU,1 Zhuying WEI,2 Yafei HUANG,2 Chunling BAI,2 Linsen ZAN1 and Guangpeng LI2 1
College of Animal Science and Technology, Northwest A&F University, Yangling and 2The Key Laboratory of National Education Ministry for Mammalian Reproductive Biology and Biotechnology, Inner Mongolia University, Hohhot, China
ABSTRACT Hedgehog (Hh) pathway has been studied in various animal body life procedures and is suggested to be important for the development of multiple organs. The genes involved in the Hh signaling pathway were expressed in the ovary of mice, pigs and cattle. However, the function of Hh signaling pathway on oocyte maturation and early embryonic development is still controversial. We detected the effect of sonic hedgehog (Shh) and cyclopamine on the in vitro maturation of mouse oocytes and embryo development. The results showed that the presence of Shh or cyclopamine resulted in similar oocyte maturation to control groups. Shh did not improve early embryonic development. However, the supplement of cyclopamine depressed early embryo development. The mRNA of shh, ptch1, smo and gli1 were less detected in the denuded oocytes. The expression levels of ptch1 ascended from the uncleaved zygote to blastocyst stage. Smo or gli1 were expressed on a higher level at the two-cell or four-cell stage in early embryonic development separately. Therefore, Shh did not affect mouse oocyte maturation and early embryo development, but cyclopamine led to inhibited development of mouse early embryo. The effects of Hh signaling on the oocyte maturation and early embryo development might be species-specific.
Key words: embryo, gli1, patched 1, smoothened, sonic hedgehog.
INTRODUCTION Hedgehog (Hh) signals play important roles in regulating cell fate specification, cell proliferation and cell survival in diverse cells (Ingham & McMahon 2001). The Hh family is highly conserved from Drosophila to mammals and generally acts as a morphogen to modulate almost all of the processes during embryo or adult development (Nusslein-Volhard & Wieschaus 1980; Ingham & McMahon 2001; McMahon et al. 2003; Wijgerde et al. 2005; Spicer et al. 2009). Vertebrates have at least three Hh proteins: sonic hedgehog (Shh), indian hedgehog (Ihh) and desert hedgehog (Dhh) (Lee et al. 2006; Riobo & Manning 2007; Russell et al. 2007). The Hh signaling pathway is mediated through a cell surface receptor system consisting of two proteins, the receptor Patched (Ptch) and its co-receptor Smoothened (Smo). In the absence of Hh ligand, Smo is inactive, accompanied with the suppression of Ptch, and inhibited downstream signaling cascades (Taipale et al. 2002; Watkins & Peacock 2004). In contrast, in the presence of Hh, suppression of Smo was lifted to relay its signaling. Signaling through Smo is conveyed © 2014 Japanese Society of Animal Science
by modulation of the activity of a family of transcription factors, Gli1, Gli2 and Gli3 (Wijgerde et al. 2005; Huangfu & Anderson 2006; Lee et al. 2006; Russell et al. 2007). Gli1 is a transcriptional target of Hh signaling and has been used as an indicator of activated Hh signaling (Marigo et al. 1996; Lee et al. 1997; Ahn & Joyner 2004; Ikram et al. 2004). Whereas deletion of gli1 in mice is compatible with normal development (Bai et al. 2002), deletion of gli2 and gli3 generate phenotypes that mimic deletion of shh, indicating that they are essential for mediating its effects on development (Mo et al. 1997). In animal reproductive systems, Hh pathway regulated and influenced primordial germ cell (PGC) migration in the Drosophila embryo (Mich et al. 2009)
Correspondence: Linsen Zan, College of Animal Science and Techonology, Northwest A&F University, No.22 Xinong Road, Yangling, Shaanxi 712100 China. (Email: zanlinsen@ 163.com) Received 23 May 2013; accepted for publication 30 January 2014.
2 Y. LIU et al.
and cell-cell adhesion in the zebrafish embryo (Ingham & McMahon 2001; Mich et al. 2009). Hh signal can stimulate both somatic cell and stem cell proliferation in Drosophila ovary (Zhang & Kalderon 2001). In mammals, Hh signals are expressed in ovaries or testes in rodents (Wijgerde et al. 2005; Russell et al. 2007; Ren et al. 2009; Spicer et al. 2009), pig (Nguyen et al. 2009) and cattle (Spicer et al. 2009), and alters development of the female reproductive tract (Migone et al. 2012). In testis development, Dhh has been proven to be produced by Sertoli cells (Wijgerde et al. 2005; Morales et al. 2009), fetal leydig cells (Yao et al. 2002; Barsoum et al. 2009) and spermatogenic cells (Pierucci-Alves et al. 2001; Yao et al. 2002; Barsoum et al. 2009). Hh signals and the receptors are detected in whole ovary, follicles, granulosa cells and corpora lutea (Wijgerde et al. 2005; Russell et al. 2007; Nguyen et al. 2009; Ren et al. 2009; Spicer et al. 2009). In the study of porcine oocytes, Nguyen reported that Shh signaling pathway is active in porcine ovaries and improves oocyte maturation, and the Shh receptor Ptch1 and Smo are expressed at various stages of parthenogenetic embryos (Nguyen et al. 2009). Supplementation of Shh increased blastocyst development (Nguyen et al. 2010, 2011); the presence of cyclopamine, a Shh inhibitor, in culture medium had no significant effect on blastocyst rate and total cell number (Nguyen et al. 2010). These results suggested that the Shh pathway had beneficial effects on oocyte maturation and preimplantation development of porcine embryos. However, in other species, including the mouse, there is no report on the effect of Shh or cyclopamine on oocyte maturation and in vitro embryo development. Otherwise, there are contradictory conclusions on the point of Hh signaling pathway taking part in the regulation of ovary and oocyte development in mammals (Wijgerde et al. 2005). The present study was designed to investigate whether Shh or cyclopamine affected mouse oocyte maturation and subsequent embryo development.
MATERIALS AND METHODS Animals and reagents All experiments adhered to procedures consistent with the National Institute of Biological Sciences guide for the care and use of laboratory animals. All chemicals, unless stated otherwise, were purchased from Sigma-Aldrich Chemical Inc. (St. Louis, MO, USA).
ovary and to release the cumulus oocyte complexes (COCs). Only the COCs with at least three intact layers of cumulus cells were collected.
In vitro maturation (IVM) of oocytes The COCs were washed with M2 medium three times, then added into Toyoda Yokoyama Hoshi medium (Chen 2000) drops containing 4 mg/mL bovine serum albumin and 0.1 IU/mL PMSG and 5% fetal bovine serum (FBS), and the drops were covered by mineral oil. Every 50 μL drop contained 20–25 COCs. After being cultured for 14 h at 37°C with an atmosphere of 5% CO2 and maximum humidity, the maturation rate was evaluated by the extrusion of the first polar body (PB1). COCs in germinal vesicle (GV) stage or in vitro matured for 8 h or in vitro matured for 14 h and reached MII stage, were pipetted to peel off the cumulus cells. The denuded oocytes and cumulus cells were collected for RNA extraction.
Embryo culture To collect ovulated fertilized zygotes, mice were peritoneally injected with 10 IU human chorionic gonadotropin and made to copulate at 48 h after PMSG injection. About 20 h later, in vivo fertilized zygotes were collected from oviduct ampullas and incubated in 0.5 mg/mL hyaluronidase briefly and then pipetted repeatedly to remove the cumulus cells. The denuded zygotes were cultured in modified simplex optimization medium with a higher K+ concentration (Millipore, Billerica, MA, USA) drops covered by mineral oil at 37°C in an atmosphere of 5% CO2 and maximum humidity. Embryos which developed to the stage of two-cell, fourcell, morula and blastocysts were counted every day and collected for RNA extraction.
Immunocytochemical staining of oocytes Oocytes were fixed in phosphate-buffered saline (PBS) containing 4% paraformaldehyde for 30 min at room temperature. After being washed twice with PBS containing 0.1% bovine serum albumin (BSA), oocytes were stored in PBS containing 0.1% BSA in 4°C for less than 1 week. Permeablization was carried out in 0.5% TritonX-100 and 0.1% BSA in PBS at room temperature for 50 min. Then the oocytes were blocked in 3% BSA in PBS for 30 min, and subsequently incubated in a mouse monoclonal antibody against α-tubulin (T-5168; Sigma) diluted by PBS containing 3% BSA (1:500) at 4°C overnight. Then they were washed with PBS containing 0.1% BSA three times, and incubated in fluorescein isothiocyanate (FITC)-labeled goat anti mouse immunoglobulin G (IgG: F-0257; Sigma) diluted with PBS containing 0.1% BSA (1:1000) at 37°C for 80 min. Chromosome was stained with 5 μg/mL 4′,6-diamidino-2phenylindole (DAPI) for 10 min at room temperature. After that, oocytes were mounted on slides with fluorescent mounting media (KPL, Gaithersburg, MD, USA) and examined under a Nikon confocal microscope.
Oocytes collection
RNA extraction and quantitative real-time PCR
Female Kunmingwhite mice were superovulated with 10 IU pregnant mare serum gonadotropin (PMSG) by hypodermic injection. After 48 h, the ovaries were taken out and transferred to M2 medium (Nagy et al. 2003). Sterile acupuncture needles were used to pierce the antral follicles on the mouse
Total RNA of oocytes or cumulus cells or embryos were extracted by using Arcturus® PicoPure™ RNA Isolation Kit (Applied Biosystems, Foster City, CA, USA) following the manufacturer’s instructions. The total RNA was reverse transcribed via PrimeScriptTM RT Master Mix (Takara, Otsu,
© 2014 Japanese Society of Animal Science
Animal Science Journal (2014) ••, ••–••
CYCLOPAMINE INHIBITING EMBRYO DEVELOPMENT
Japan). The relative expressions of shh (forward primer 5′- G TTTATTCCCAACGTAGCCGAGA -3′ and reverse primer 5′- C AGAGATGGCCAAGGCATTTA -3′), ptch1 (forward primer 5′CGAGACAAGCCCATCGACATTA -3′ and reverse primer 5′AGGGTCGTTGCTGACCCAAG -3′), smo (forward primer 5′- AAGGCCACCCTGCTCATCTG -3′ and reverse primer 5′AGGCCTTGGCGATCATCTTG -3′) and gli1 (forward primer 5′- AAGGCCCAATACATGCTGGTG -3′ and reverse primer 5′GACCGAAGGTGCGTCTTGAG -3′) were determined by using SYBR® Premix Ex Taq™ II (Tli RNaseH Plus) (Takara, Dalian, China), and carrying out the quantitative real-time PCR on an ABI 7500 RT-PCR system (Applied Biosystems). The levels of 18srRNA (forward primer 5′- CGCTTCCTTACCTGGTTGAT -3′ and reverse primer 5′- GAGCGACCAAAGGAACCATA -3′) RNA were used as an endogenous control (Dunning et al. 2010; Salhab et al. 2010; Adriaenssens et al. 2011). The relative gene expressions were calculated using the 2−ΔΔCt method.
Statistical analysis Statistical analysis was carried out by using SPSS Version 16.0 (SPSS Inc., Chicago, IL, USA). One-way analysis of variance (ANOVA) was done for all data, followed by Duncan’s test. The data analyzed by percentile data were arcsinetransformed before ANOVA analysis and P < 0.05 was considered significant.
RESULTS Maturation of mouse oocytes in the presence of cyclopamine or Shh During oocyte maturation, Shh was added to the culture media at a concentration of 0.02, 0.2 and 2 μg/ mL, respectively. The results showed that the presence of Shh or its inhibitor cyclopamine did not improved oocyte maturation when compared to the control (P > 0.05) (Table 1). The solvent of cyclopamine was dimethyl sulfoxide (DMSO), so a group in which only 0.1% DMSO was supplemented in the medium was set in the experiment. Immunostaining of the matured oocytes showed that either Shh or cyclopamine had no effects on metaphase chromosomal arrangement and spindle morphology (Fig. 1). All the samples from denuded oocytes have large cycle threshold (Ct) values (the overwhelming majority were over 32) when the gene Shh or Ptch1 or Smo or Gli1 was amplified by quanTable 1 Maturation of mouse oocytes incubated with the presence of Shh or cyclopamine
Treatment
Numbers of oocytes
Maturation rate (mean ± SE, %)
Control 0.1% dimethyl sulfoxide Sonic hedgehog (Shh) (0.02 μg/mL) Shh (0.2 μg/mL) Shh (2 μg/mL) Cyclopamine (1 μmol/L) Cyclopamine (10 μmol/L)
94 109 108
91.85 ± 4.52 89.67 ± 2.67 89.07 ± 2.09
103 105 103 109
92.35 ± 1.38 91.77 ± 4.21 90.30 ± 2.27 88.10 ± 2.07
Animal Science Journal (2014) ••, ••–••
3
titative real-time PCR, while the Ct values were between 14 and 21 when amplified by 18srRNA. Therefore, it was considered that four components of Hh signaling pathway shh, ptch1, smo and gli1, were barely expressed in denuded oocytes during the process of IVM of mouse oocytes, regardless of containing cyclopamine in the medium. Expressions of Shh and Ptch1 were higher in the cumulus cell surroundings at the GV stage oocytes or oocytes in vitro matured for 8 h, and then went down when the oocytes came to the MII stage (Fig. 2A,B). The expression of gli1 in cumulus cells was elevating from the beginning to 8 h of IVM, but declining from 8 h to 24 h when the oocytes reached the MII stage (Fig. 2D). For the samples from the control group, the expression of Smo was elevatory in the cumulus cells which in vitro matured for 8 h, compared to in the cumulus cells of GV stage oocytes, and then became lower in the cumulus cells of MII stage oocytes (Fig. 2C). However, when it was treated with cyclopamine, expression of Smo was lower in cumulus cells at 8 h of IVM, and elevated when the oocytes reached the MII stage (Fig. 2C). In cumulus cells, ptch1 and gli1 which are the target genes of Hh signaling, were less expressed when treated by 5 μmol/L cyclopamine compared to the control group and 0.1% DMSO group (P < 0.05) at 8 h of IVM, and the expression of gli1 was depressed when oocytes reached the MII as well (P < 0.05) (Fig. 2B,D).
Shh did not affect mouse embryo development After incubation of mouse zygotes with the addition of Shh, the percentages of two-cell embryos, four-cell embryos, morula and blastocyst development showed no obvious differences as compared to the controls (Table 2).
Cyclopamine decreased the mouse embryo development Addition of cyclopamine to the culture medium affected mouse embryonic development as showed in Table 3. In the treatment group of 1.0 μmol/L or 10.0 μmol/L cyclopamine, 0.1% DMSO was contained in the medium as the solvent. But in the group of 20.0 μmol/L or 50.0 μmol/L cyclopamine, the concentration of DMSO was 0.5% because of the solubility of cyclopamine. Excepting in percentage of two-cell embryos, the development of mouse embryo in the medium containing 0.5% DMSO is not different from the control group and 0.1% DMSO group. The cleavage rates were significantly lower in the 1.0 μmol/L (79.03%) or 10.0 μmol/L (82.33%) cyclopamine group in which the concentration of DMSO was 0.1%, compared to the 0.1% DMSO group (94.04%). The percentage of embryos developing to four-cell stage in 1.0 μmol/L (67.83%) or 10 μmol/L (70.71%) © 2014 Japanese Society of Animal Science
4 Y. LIU et al.
Figure 1 Meiotic apparatus of mouse MII oocytes cultured with cyclopamine. (A, B, C: control; D, E, F: 0.1% dimethyl sulfoxide (DMSO); G, H, I: 1 μmol/L cyclopamine; J, K, L: 10 μmol/L cyclopamine. A, D, G, J: 4′,6-diamidino-2-phenylindole (DAPI); B, E, H, K: α-tubulin; C, F, I, L: merged)
cyclopamine group was also lower than in the 0.1% DMSO (78.05%) group. The percentages of embryos developed to blastocyst in 1.0 μmol/L or 10.0 μmol/L or 20.0 μmol/L group were 36.3% or 35.02% or 31.19%, significantly lower than the control (57.1%, 46.26% and 42.66%), respectively. Only 20% of the embryos developed to blastocysts when the cyclopamine concentration was 50 μmol/L.
Expression of Hh pathway component during early embryonic development The expression of Shh gene was hardly detected in the mouse embryo from the stage of uncleaved zygote to © 2014 Japanese Society of Animal Science
blastocyst by quantitative real-time PCR in our experiment. The expression levels of ptch1 ascended progressively from the uncleaved zygote stage to blastocyst stage in the control group, but were decreased in blastocysts compared to morulas in the DMSO or cyclopamine treated groups (P < 0.05) (Fig. 3A). For smo gene, there was a peak expression level at the two-cell embryo stage, and declined from two-cell embryo stage to blastocyst stage (Fig. 3B). Gli1 was scarcely expressed in uncleaved zygotes or two-cell embryos of mouse, and was expressed highly in fourcell embryos (Fig. 3C). The expression of ptch1 and gli1 in mouse embryos was depressed with the treatment Animal Science Journal (2014) ••, ••–••
CYCLOPAMINE INHIBITING EMBRYO DEVELOPMENT
Relative Smo mRNA Levels
0.8 0.6 0.4 0.2
Relative Ptch1 mRNA Levels
control DMSO 5 µM cyclopamine
1.0
0
C
B
1.2
control DMSO 5 µM cyclopamine
3.0 2.5 2.0 1.5 1.0 0.5
1.6 control DMSO 5 µM cyclopamine
1.4 1.2 1.0 0.8 0.6 0.4 0.2 0
cumulus cumulus cell cumulus of oocytes cell of cell of oocytes at IVM for 8 h oocytes at MII stage GV stage
cumulus cumulus cell cumulus of oocytes cell of cell of oocytes at IVM for 8 h oocytes at MII stage GV stage
D 2.0 Relative Gli1 mRNA Levels
Relative Shh mRNA Levels
A
5
control DMSO 5 µM cyclopamine
1.8 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2
0
0 cumulus cumulus cell cumulus of oocytes cell of cell of oocytes at IVM for 8 h oocytes at MII stage GV stage
cumulus cumulus cell cumulus of oocytes cell of cell of oocytes at IVM for 8 h oocytes at MII stage GV stage
Figure 2 Expression of the component of hedgehog (Hh) signaling pathway in cumulus cells during the in vitro maturation (IVM) of mouse cumulus oocyte complexes (COCs) with or without cyclopamine. (A) Relative expression of sonic hedgehog (Shh) messenger RNA (mRNA). (B) Relative expression of Patched 1 (Ptch1) mRNA. (C) Relative expression of Smoothened (Smo) mRNA. (D) Relative expression of Gli1 mRNA. Table 2
In vitro development of mouse embryos with the presence of sonic hedgehog (Shh)
Shh treatment
Numbers of embryos in each group
Percentage of two-cell embryo (mean ± SE, %)
Percentage of four-cell embryo (mean ± SE, %)
Percentage of morula (mean ± SE, %)
Percentage of blastocyst (mean ± SE, %)
Control 0.5 μg/mL 2.0 μg/mL
144 146 156
74.88 ± 5.17 81.07 ± 5.15 77.37 ± 7.11
62.52 ± 4.80 61.63 ± 6.43 66.65 ± 9.00
56.25 ± 6.91 54.09 ± 8.58 57.95 ± 11.12
53.63 ± 7.40 46.70 ± 10.53 50.29 ± 10.40
of cyclopamine (P < 0.05) from the four-cell stage to blastocyst stage (Fig. 3A,C).
DISCUSSION Previous studies showed that mRNA of ihh, dhh, smo and ptch1 was expressed in mouse preantral follicle or antral follicle, and the receptors Ptch1 and Ptch2, and the transcript factor Gli was found in theca cells and Animal Science Journal (2014) ••, ••–••
corpora luteum (Wijgerde et al. 2005; Russell et al. 2007). Although in situ hybridization did not exclude the probability of the existence of the components of Hh pathway in oocytes in a lower level, the results of RT-PCR have proven that there was only ptch1 expressed in oocytes of different stages; Ihh, Dhh, Ptch2 and Smo did not express in denuded oocytes (Wijgerde et al. 2005). This is in accordance with our research. These results suggested that the mouse © 2014 Japanese Society of Animal Science
6 Y. LIU et al.
Table 3 In vitro development of mouse preimplantation embryos with the presence of cyclopamine
Treatment (μmol/L)
Numbers of embryos in each group
Percentage of two-cell embryo (mean ± SE, %)
Percentage of four-cell embryo (mean ± SE, %)
Percentage of morula (mean ± SE, %)
Percentage of blastocyst (mean ± SE, %)
Control 0.1% DMSO 0.5% DMSO 1.0 μmol/L Cyclopamine 10.0 μmol/L Cyclopamine 20.0 μmol/L Cyclopamine 50.0 μmol/L Cyclopamine
222 234 198 241 258 146 195
91.54 ± 1.21a 94.04 ± 4.57a 85.31 ± 5.20b 79.03 ± 9.45b 82.33 ± 7.05b 80.76 ± 7.17b 70.10 ± 2.81b
80.38 ± 3.32a 78.05 ± 6.00a 72.95 ± 7.69ab 67.83 ± 9.47b 70.71 ± 8.18b 62.86 ± 6.48bc 53.49 ± 7.09c
68.74 ± 4.57a 61.19 ± 7.02ab 63.43 ± 6.68ab 60.92 ± 8.38b 60.56 ± 8.36b 52.89 ± 7.16b 34.51 ± 7.67c
57.13 ± 6.13a 46.26 ± 4.36b 42.66 ± 6.03b 36.31 ± 4.09c 35.02 ± 7.00c 31.19 ± 9.11c 20.19 ± 6.08d
In the same column, different letters indicate significant differences (P < 0.05). DMSO, dimethyl sulfoxide.
70 60
control DMSO 5 µM cyclopamine
50 40 30 20 10
Relative Gli1 mRNA Levels
25
control DMSO 5 µM cyclopamine
20 15 10 5 0
0
C 180
B Relative Smo mRNA Levels
Relative Ptch1 mRNA Levels
A
control DMSO 5 µM cyclopamine
160 140 120 100 80 60 40 20 0
Figure 3 Expression of the component of hedgehog (Hh) signaling pathway in mouse embryos during in vitro culture with or without cyclopamine. (A) Relative expression of Patched 1 (Ptch1) messenger RNA (mRNA). (B) Relative expression of Smoothened (Smo) mRNA. (C) Relative expression of Gli1 mRNA.
oocytes may not respond to the Hh signals released by granulosa cells. Contrary to the mouse, studies in porcine revealed that Smo was not only found in granulosa cells, but was also detected in oocytes, and gli1 expressed in oocytes, cumulus cells, granulosa © 2014 Japanese Society of Animal Science
cells and theca cells of small size follicles (Nguyen et al. 2009). In the study of IVM in pigs, Nguyen et al. (2009) reported that addition of Shh in the culture media improved oocyte maturation by a cumulus cell Animal Science Journal (2014) ••, ••–••
CYCLOPAMINE INHIBITING EMBRYO DEVELOPMENT 7
independent manner, while the supplementation of Shh inhibitor cyclopamine decreased maturation. However, in the mouse the present results showed that mouse oocyte maturation was not affected when adding Shh or cyclopamine to the media. In developing mouse ovaries, the oocytes expressed Shh receptor Ptch1 but lack signal transducer Smo, while the surrounded granulosa cells were Ihh and Dhh positively stained (Wijgerde et al. 2005). In the in vitro culture of mouse follicles the recombinant Shh improved the proliferation of granulosa cells and the growth of preantral follicles (Russell et al. 2007). However, the Shh improvement of follicular growth could be blocked by cyclopamine (Russell et al. 2007). Our results indicated that several components of Hh signaling pathway were expressed in cumulus cells and the expression of the target genes of Hh signaling in cumulus cells were inhibited when treated by cyclopamine supplement. Granulosa cells can be considered as target cells of Hh pathway during follicle development and oocyte maturation. The developmental ability of mouse preimplantation embryos was inhibited when cyclopamine was supplemented in the medium, which is consistent with the porcine embryo development (Nguyen et al. 2010). The blastocyst development of the porcine embryos derived from Shh treated oocytes is higher than that from non-Shh treatment controls (Nguyen et al. 2011). Shh supplementation also increased porcine parthenogenetically activated or nuclear transfer embryos (Nguyen et al. 2010). However, cyclopamine negatively affected the porcine embryo development even in combination with Shh. In the present study, these results indicated that Shh did not improve mouse embryo development, but the addition of cyclopamine significantly decreased the cleavage rates and blastocyst development. In this study, we have not detected the expression of Shh mRNA during embryonic development; we suppose that another Hh homolog may exert in mouse early embryonic development. These results implied that mouse oocytes may not respond to Hh signals. The different effects of Shh on oocyte maturation and embryo development might be due to species differences. Inhibition of the Hh signaling by cyclopamine depressed the development of mouse embryos, which implied that Hh signaling is required for embryo development, but surplus Shh is less functional during mouse early embryonic development.
ACKNOWLEDGMENTS This work was supported by the China National Twelfth ‘Five Year’ Science and Technology Support Project (2011BAD28B04-03), two 863 Programs (2011AA100307-02 and 2013AA102505) and 973 Project (2012CB722306).
Animal Science Journal (2014) ••, ••–••
REFERENCES Adriaenssens T, Segers I, Wathlet S, Smitz J. 2011. The cumulus cell gene expression profile of oocytes with different nuclear maturity and potential for blastocyst formation. Journal of Assisted Reproduction and Genetics 28, 31–40. Ahn S, Joyner AL. 2004. Dynamic changes in the response of cells to positive hedgehog signaling during mouse limb patterning. Cell 118, 505–516. Bai CB, Auerbach W, Lee JS, Stephen D, Joyner AL. 2002. Gli2, but not Gli1, is required for initial Shh signaling and ectopic activation of the Shh pathway. Development 129, 4753–4761. Barsoum IB, Bingham NC, Parker KL, Jorgensen JS, Yao HH. 2009. Activation of the Hedgehog pathway in the mouse fetal ovary leads to ectopic appearance of fetal Leydig cells and female pseudohermaphroditism. Developmental Biology 329, 96–103. Chen D (ed.). 2000. Fertilization Biology: The Mechanism of Fertilization and Reproductive Engineering, 1st edn. Science Perss, Beijing. Dunning KR, Cashman K, Russell DL, Thompson JG, Norman RJ, Robker RL. 2010. Beta-oxidation is essential for mouse oocyte developmental competence and early embryo development. Biology of Reproduction 83, 909– 918. Huangfu D, Anderson KV. 2006. Signaling from Smo to Ci/Gli: conservation and divergence of Hedgehog pathways from Drosophila to vertebrates. Development 133, 3–14. Ikram MS, Neill GW, Regl G, Eichberger T, Frischauf AM, Aberger F, et al. 2004. GLI2 is expressed in normal human epidermis and BCC and induces GLI1 expression by binding to its promoter. Journal of Investigative Dermatology 122, 1503–1509. Ingham PW, McMahon AP. 2001. Hedgehog signaling in animal development: paradigms and principles. Genes & Development 15, 3059–3087. Lee J, Platt KA, Censullo P, Ruiz i Altaba A. 1997. Gli1 is a target of Sonic hedgehog that induces ventral neural tube development. Development 124, 2537–2552. Lee K, Jeong J, Kwak I, Yu CT, Lanske B, Soegiarto DW, et al. 2006. Indian hedgehog is a major mediator of progesterone signaling in the mouse uterus. Nature Genetics 38, 1204–1209. Marigo V, Johnson RL, Vortkamp A, Tabin CJ. 1996. Sonic hedgehog differentially regulates expression of GLI and GLI3 during limb development. Developmental Biology 180, 273–283. McMahon AP, Ingham PW, Tabin CJ. 2003. Developmental roles and clinical significance of hedgehog signaling. Current Topics in Developmental Biology 53, 1–114. Mich JK, Blaser H, Thomas NA, Firestone AJ, Yelon D, Raz E, Chen JK. 2009. Germ cell migration in zebrafish is cyclopamine-sensitive but Smoothened-independent. Developmental Biology 328, 342–354. Migone FF, Ren Y, Cowan RG, Harman RM, Nikitin AY, Quirk SM. 2012. Dominant activation of the hedgehog signaling pathway alters development of the female reproductive tract. Genesis 50, 28–40. Mo R, Freer AM, Zinyk DL, Crackower MA, Michaud J, Heng HH, et al. 1997. Specific and redundant functions of Gli2 and Gli3 zinc finger genes in skeletal patterning and development. Development 124, 113–123.
© 2014 Japanese Society of Animal Science
8 Y. LIU et al.
Morales CR, Fox A, El-Alfy M, Ni X, Argraves WS. 2009. Expression of Patched-1 and Smoothened in testicular meiotic and post-meiotic cells. Microscopy Research and Technique 72, 809–815. Nagy A, Gertsenstein M, Vintersten K, Behringer R (eds). 2003. Manipulating the Mouse Embryo:A Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory Press, New York. Nguyen NT, Lin DP, Siriboon C, Lo NW, Ju JC. 2010. Sonic Hedgehog improves in vitro development of porcine parthenotes and handmade cloned embryos. Theriogenology 74, 1149–1160. Nguyen NT, Lin DP, Yen SY, Tseng JK, Chuang JF, Chen BY, et al. 2009. Sonic hedgehog promotes porcine oocyte maturation and early embryo development. Reproduction Fertility and Development 21, 805–815. Nguyen NT, Lo NW, Chuang SP, Jian YL, Ju JC. 2011. Sonic hedgehog supplementation of oocyte and embryo culture media enhances development of IVF porcine embryos. Reproduction 142, 87–97. Nusslein-Volhard C, Wieschaus E. 1980. Mutations affecting segment number and polarity in Drosophila. Nature 287, 795–801. Pierucci-Alves F, Clark AM, Russell LD. 2001. A developmental study of the Desert hedgehog-null mouse testis. Biology of Reproduction 65, 1392–1402. Ren Y, Cowan RG, Harman RM, Quirk SM. 2009. Dominant activation of the hedgehog signaling pathway in the ovary alters theca development and prevents ovulation. Molecular Endocrinology 23, 711–723. Riobo NA, Manning DR. 2007. Pathways of signal transduction employed by vertebrate Hedgehogs. Biochemical Journal 403, 369–379.
© 2014 Japanese Society of Animal Science
Russell MC, Cowan RG, Harman RM, Walker AL, Quirk SM. 2007. The hedgehog signaling pathway in the mouse ovary. Biology of Reproduction 77, 226–236. Salhab M, Papillier P, Perreau C, Guyader-Joly C, Dupont J, Mermillod P, Uzbekova S. 2010. Thymosins beta-4 and beta-10 are expressed in bovine ovarian follicles and upregulated in cumulus cells during meiotic maturation. Reproduction Fertility and Development 22, 1206–1221. Spicer LJ, Sudo S, Aad PY, Wang LS, Chun SY, Ben-Shlomo I, et al. 2009. The hedgehog-patched signaling pathway and function in the mammalian ovary: a novel role for hedgehog proteins in stimulating proliferation and steroidogenesis of theca cells. Reproduction 138, 329–339. Taipale J, Cooper MK, Maiti T, Beachy PA. 2002. Patched acts catalytically to suppress the activity of Smoothened. Nature 418, 892–897. Watkins DN, Peacock CD. 2004. Hedgehog signalling in foregut malignancy. Biochemical Pharmacology 68, 1055– 1060. Wijgerde M, Ooms M, Hoogerbrugge JW, Grootegoed JA. 2005. Hedgehog signaling in mouse ovary: Indian hedgehog and desert hedgehog from granulosa cells induce target gene expression in developing theca cells. Endocrinology 146, 3558–3566. Yao HH, Whoriskey W, Capel B. 2002. Desert Hedgehog/ Patched 1 signaling specifies fetal Leydig cell fate in testis organogenesis. Genes & Development 16, 1433–1440. Zhang Y, Kalderon D. 2001. Hedgehog acts as a somatic stem cell factor in the Drosophila ovary. Nature 410, 599–604.
Animal Science Journal (2014) ••, ••–••
