Original Paper lntemational Journal of Cell Cloning 10:70-79 (1992)

Cytokine Gene Expression and Synthesis by Human Megakaryocytic Cells H a w Avraham", Edouard Vannier ', Sherry I: Chi", Charles A. Dinarellob, Jerome E. Groopman" "Division of Hematology/Oncology,New England Deaconess Hospital, Harvard Medical School, Boston, Massachusetts, USA; bDivision of Geographic Medicine and Infectious Diseases, Tufts University, School of Medicine. New England Medical Center, Boston, Massachusetts, USA. Keywords. Cytokines Megakaryocytes PCR Synthesis Expression Abstract. Cytokine expression and production by human megakaryocytic cells were studied using the CMK cell line as a model for cytokine gene expression by polymerase chain reaction (PCR) and for cytokine protein synthesis by specific radioimmunoassays. CMK cells at all stages of maturation were found to constitutively express moderate mRNA levels for tumor necrosis factor (TNF-a), transforming growth factor beta (TGFp), interleukin (IL)lp, and endothelial cell growth factor (ECGF) transcripts. After 6-h treatment with the phorbol ester PMA, gene expression for IL-la, granulocyte-macrophage colony-stimulating factor (GM-CSF), IL-3, and the IL-6 receptor were increased. After 24 h of exposure to PMA, levels for most cytokines declined to baseline, except for IL-6 which appeared as a new transcript. PMA-stimulated CMK lines synthesized low levels of TNF-a and IL-6, and higher levels of GMCSF, IL-lp, and IL-la protein. These observations suggest that cells of megakaryocytic lineage are capable of producing a repertoire of cytokines which could mediate an autocrine role as well as modulate the replication and function of other hematopoietic cells.

Introduction

Megakaryocytopoiesis appears to be regulated in part by several cytokines which modulate cell replication and differentiation [ 1 , 21. Interleukin (L) Correspondence: Dr. Hava Avraham, Division of Hematology/Oncology, New England Deaconess Hospital. I10 Francis Street, 4A, Boston, MA 02215, USA. Received August 1S, 1991; provisionally accepted September 13, 1991; accepted for publication October 11, 1991.

0737- 1454/92/$2.00/0 OAlphaMed Press

3 and granulocyte-macrophage colony-stimulating factor (GM-CSF) may increase proliferation of early committed megakaryocyte progenitors, thereby expanding the pool of cells which develop into mature human megakaryocytes and platelets [3, 41. The effects of GM-CSF and IL-3 are additive; that is, megakaryocytic colony formation by a combination of the two growth factors approximates the sum of colony formation by each growth factor alone IS]. These cytokines not only increase colony formation, but also increase the number of cells comprising individual megakaryocyte colony-forming unit (CFUMe&-derived colonies. Growth factors such as IL-6 and thrombopoietic stirnulatory factor (TSF) induce late megakaryocyte differentiation, enhancing endomitosis and platelet organelle and membrane development [ 1, 2, 6-91, IL-6 displays a wide range of in vitro biologic activities and is thought to play a role in inflammatory acute-phase and immunologic responses [ l o ] . T h e effects of IL-6 on megakaryocytopoiesis in vitro are multiple, including augmentation of megakaryocyte colony growth (in the presence of colony-stimulating factors) [ 111, growth of single megakaryocytes in agar (121, and increased megakaryocyte ploidy [ 131. Transforming growth factor beta (TGF-p) and platelet factor 4 [5] may inhibit thrombopoiesis by reducing megakaryocyte progenitor proliferation and endomitosis [ 141. Studies of cytokine gene expression, synthesis and regulation in human megakaryocytes have been hampered in part by difficulties in obtaining sufficient numbers of purified megakaryocytes. The recent establishment of permanent megakaryocytic cell lines allows for direct assessment of the potential repertoire of cytokine gene expression and protein production by cells of this lineage.

AvrahamNannier/ChdDinarello/Groopman

The CMK cell line, derived from a patient with megakaryoblastic leukemia, has properties of cells of megakaryocytic lineage, including surface expression of platelet glycoproteins Ib and IIb/IIIa, contains the alpha granule proteins platelet factor 4, platelet derived growth factor and von Willebrand’s factor, and undergoes endomitosis upon treatment with inducing agents such as the phorbol ester PMA [ 5 ] . Three different CMK clones, termed CMK-6, CMK and CMKl1-5 have been derived. These clones have been previously characterized as immature (CMK-6), mature (CMK), and more mature (CMK11-5), based on expression of surface platelet glycoproteins and platelet factor 4 [ 15, 161. The kinetics of cytokine expression and production by CMK cells following PMA induction was analyzed using these three clones. The CMK megakaryocytic cells produced a wide repertoire of cytokines, including tumor necrosis factor TNF-a, IL-Ip, IL-la, IL-6, and GM-CSF. Production of these cytokines could play a role in autocrine modulation of megakaryocytopoiesis as well as affect the proliferation and differentiation of other hematopoietic cells.

Materials and Methods

Cell Culture The CMK cell lines were a generous gift of Dr 1: Suto (Chiba University, Japan). Three different clones of the CMK cells were available for study. These clones were termed CMK, CMK-6 and CMKl l-5. The CMK cell lines were carried in RPMI 1640 medium containing 10% fetal calf serum (FCS) (GIBCO; Grand Island, NY), L-glutamine, penicillin and streptomycin [I71 and were assayed and shown to be free of mycoplasma. Preparation of PMA-treated CMK Cells PMA (Sigma; St. Louis, MO) was dissolved in dimethylsulfoxide (DMSO) and stored at - 80°C. Just before use, PMA was diluted in the RPMI culture medium and added to the liquid culture at 10 ng/ml at 37°C in a 5% CO, humidified atmosphere for 3,6, 24 or 48 h. Flow Cytornetry Cells (5 x 10s) were exposed to monoclonal antibodies ( 4 T , 30 min), washed three times and followed by fluorescein-conjugated goat anti-mouse Ig (Boehringer-Mannheim; Indianapolis, IN) ( 1 5 0 dilution in HBSS with 0.1% BSA; 4 ° C 20 min) and

71

fixed in 1% paraformaldehyde in phosphate buffered saline (PBS). Cytokine Analysis To assay expression of specific cytokine genes, total cellular RNA was extracted from the CMK cell lines, with or without PMA treatment (10 ng/ml), or as a control from CMK cells treated with DMSO in the same concentration that was used to dilute PMA. The RNA was extracted by the guanidine isothiocyanate procedure, followed by ultra-centrifugation through a CsCl cushion [ 181. Total RNA was run on a 1.2% formaldehyde agarose gel, and the intact RNA was visualized by ethidium bromide staining. Reverse transcription (RT) of RNA was performed using 2pg of total RNA from each sample, and PCR assays for each primer set were performed according to Clontech’s Cytokine Mapping PRIMATE methods (Clontech Laboratories, Inc.; Palo Alto, CA). The following human primer sets were used: IL-la (816bp); IL-Ip (811bp); IL-3 (450bp); IL-6 (636bp) endothelial cell growth factor (ECGF-462bp); granulocyte macrophage colonystimulating factor (GM-CSF-420bp); TNF-a (691bp); p actin primer set (584bp, 300bp, 100bp); IL-6 receptor (1323bp); and TGF-p (283bp). (See Table I). The PCR products for each set were analyzed on a 2% agarose gel (BRL; Bethesda, MD). The amplified DNA bands were visualized with a UV transilluminator. Amplified DNA could be detected at the expected size by ethidium bromide staining of the gel. Internal reaction standards for PCR controls were performed for each set of primers, which included RNA with or without primers, primers without RNA, and mRNA with actin primers. These studies for cytokine expression provide qualitative information only and a readout of mRNAs being produced by CMK cells at a given point in time for the presence or absence of the examined cytokines. All the primer stocks and total preparation of RNAs were analyzed to exclude contamination by cellular DNA. First Strand DNA Synthesis First strand DNA was synthesized at 37°C for 1 h in a final volume of 10 pl with oligo-dT as primers; 4.5 pl RNA in DEPC-dH,O, 2.0 pl 5 x buffer (250 mM Tris-Hcl, pH 8,3 375 mM KCI, 50 mM dithiothreitol, 15 mM MgCI,, and 250 pg/ml actinomycin D), 0.5 pl RNasin (40 U/pl) (Promega; Madison, WI), 1.0 p1 dNTP (dATP, dCTP, dGTP, dTTP

Cytokine Expression and Human Megakaryocytic Cells

72

TABLE I CYTOKINE

FRAGMENT SIZE

PRIMER

(bases) ILI --a-5' ILI-U-3'

816

ATGGCCAAAGTTCGAGACATG CTACGCCTGGTIlTCCAGTATCTGAAAGTCAGT

ILI-P-5' ILI-P-3'

81 I

ATGGCAGAAGTACCTAAGCTC TTAGGAAGACACAAATTGCATGGTGAACTCAGT

IL3-5' IL3-3'

450

ATGAGCCGCCTGCCCGTCCTG AAGATCGCGAGGCTCAAAGTCGTCTGTTG

IL6-5' IL6-3'

639

ATG AACTCCTTCTCCACAAGC CTACATTTGCCGAAGAGCCCTCAGGCTGGACTG

TNF--a-5' TNF--a-3'

69 1

ATGAGCACTGAAAGCATGATC TCACAGGGCAATGATCCCAAAGTAG ACCTGCCC

TGF-P 1-5' TGF-PI-3'

283

AACATGATCGTGCGCTCCTGCAAGTGCAGC

GM-CSF-5' GM-CSF-3'

420

AAGGAATAGTGCAGACAGGCAGGA

IL-6 RECEPTOR-5' IL-6 RECEPTOR-3'

ATGTGGCTGCAGAGCCTGCTGC CTGGCTCCCAGCAGTCAAAGGG

1393

CAAGGCGCTGCCCTGCGCAG TCTGTATTGCTGATGTCATAAGGGC

ECGF-5' ECGF-3'

462

ATGGCTGAAGGGGAAATCACCAC CAGAAGAGACTGGCAGGGGGAG

P-ACTIN, S'PRIMERS

500 300 100

ATGGATG ATGATATCGCCGCG GAGGAGCACCCCGTGCTGCTGA GAAATCGTGCGTGACATTAAG CTAGAAGCATTTGCGGTGGACGATGGAGGGGCC

3'PRIMER

mix, 10 mM each) (Pharmacia; Piscataway, NJ), 1.0 ~1 oligo-dT, 1.O p,1 Moloney murine leukemia virus (MMLV) reverse transcriptase (200 U/ml) (Boehringer-Mannheim; Chicago, IL). Polymerase Chain Reaction

Eighty ~1 of PCR mix was added to 10 ~1 of first-strand cDNA. PCR mix contains: 53.5 p,1 sterile water, 10 ~ 1 1 x0 reaction buffer, 16 ~1 of dNTP mix (each at 1.25 mM) and 0.5 ~1 (2.5 units) of the Thermus aquaticus thermostable DNA polymerase (Cetus-Perkin Elmer; Emeryville, CA). PCR reaction buffer (lox) contains: 500 mM KCI, 100 mM 0.1% gelatin. Five p1 of each primer was added to give a final primer concentration of 1 p.M, and the mixture was then subjected to PCR amplification using the Perkin-Elmer thermal cycler set for 40 cycles. The temperatures used for PCR were: Dena-

ture 94"C, 1 min; primer anneal 55"C, 2 min; primer extension 72"C, 3 min. Normally, I-minute ramp times were used between these temperatures. Cytokine Assays For cytokine assays, CMK cells were grown in RPMI 1640 containing 1% FCS, at a density of 5 x 106/ml.Following PMA stimulation at 3, 24 or 48 h, cell suspensions were centrifuged for 10 min at 1200 rpm. Supernatants and cell pellets were assayed for cytokine production. The cell pellets were subjected to 3 freeze-thaw cycles [19]. This procedure is optimal for recovery and measurement of total (cellassociated and secreted) cytokines by specific RIAs as described for TNF-a [20], IL-1P [21], IL-6 [22], and GM-CSF [19]. The sensitivities (defined as 95% binding) of RIAs for TNF-a, IL-IP, IL-la.IL-6 and GM-CSF were 42 13,32 3,28 f 7 , 2 2 2,25 * 4 pg/ml, respectively.

*

*

*

AvrahamNannier/Chi/Dinarello/Groopman

73

Flow Cytometric Measurement of DNA Content of CMK Cells CMK cells were seeded at 2 x 105 cells and fed again after two days. Cells were harvested after 5 days, and the nuclei were isolated, stained with propidium iodide, and analyzed on a Becton Dickinson FACS Analyzer (Mountain View, CA) as previously described [ 141. Freshly prepared lymphocytes were used to mark the position of the 2N cells.

Results

Characterization of CMK Megakaryocytic Cell Lines The results of cell surface antigen analysis of CMK clones are summarized in Table 11. Less than 5% of the cells reacted with the FITC conjugated secondary antibody alone and were referenced as negative staining. Lymphoid surface antigens were uniformly absent, as were those of granulocytes, monocytes and macrophages. With respect to the platelet-specific antigens GpIb and GpIIbflIIa, these structures were expressed at respective levels of 7% and 7 1% in the less mature CMK-6 cells, 11% and 86% in the CMK cells, and 16% and 94% of the more mature CMK11-5 cells as assayed by flow cytometry. Nearly all the cultured cells expressed the HLA class I antigen.

Effect of PMA on Growth and Differentiation of CMK Cells CMK clones proliferated logarithmically and reached a plateau on the sixth day of liquid culture (Fig. 1). PMA-treated CMK cells lost their proliferative capacity and showed morphologic characteristics of mature megakaryocytes with multilobular nuclei. The expression of GpIIb/IIIa was increased to about 95% - 100% upon PMA stimulation, indicating that the three CMK clones underwent a differentiation process. Nonspecific antibody binding did not increase concomitantly as shown by similar fluorescence distributions of control or PMA-treated cells incubated with antibodies against CD34 or CD9 (data not shown). Cells treated with PMA also exhibited a change in ploidy (Fig. 2). Cells treated with PMA at 5 ng/ml for 16 h had an apparent shift out of the 2N peak to 4N and 8N levels. Therefore, PMA treatment led to an increase in the percentages of cells at the 4N and 8N ploidy levels. We also observed a very small percentage of cells at 16N following PMA treatment. Cytokine Expression by CMK Cells The effects of PMA on cytokine gene expression in the three CMK clones were studied using PCR analysis. Total RNA from CMK-6, CMK and CMKl1-5 cells was used as a template for reverse transcriptase reactions. PCR mapping was performed using specific primers for each cytokine. CMK11-5, CMK and CMK-6 cells were found to constitutively

TABLE 11. Surface Antigen Characterization of the CMK Cell Lines

Surface Marker

Monoclonal Antibody

Main Cellular Reactivity**

CMK-6

CMK

CMKII-5

CD34 CD9 CDla CD15 CD3 CD4

Mylo Anti CD9 Leu 6 MY1 Leu 4 Leu 3a

Negative Negative Negative Negative Negative 60.8*10%

Negative Negative Negative Negative Negative 79.2r8%

Negative Negative Negative Negative Negative 65.5*7%

CD16 Platelet GPIIbnIIa

3G8 7E3

Progenitor Cells Pre-B, M, Plt Thy, DC, b subset G , M, Pan-Myeloid cells T T subset receptor, class Il/HIV NK and neutrophils Plt

CD42b

GPIb

Plt

Negative 7 1.6*9% (89*9%)"' 7*8% (14*4%)"'

Negative 86.0*10% (95*5%)"' 11i7% (19*4%)"'

Negative 94.5i78 (99+6%)"' 16i5% (22+5%)"'

' "Negative" denotes < *' "*

10% positive cells. Values represent the averages of three or more separate determinations. Abbreviations: BIB cells; M/monocytes; PWplatelets; Thy/thymocytes; DC/dendritic cells; Glgranulocytes; TIT cells; NWnatural killer cells; RBClred blood cells. The numbers in parenthesis are the values of positive cells upon stimulation with PMA [(lOng/ml) for 24hl.

Cytokine Expression and Human Megakaryocytic Cells

express moderate levels of specific mRNAs for TNFa,TGF-P, IL-lp, and ECGF (Fig. 3). The expression of other cytokines was negative (data not shown). The same PCR results were obtained when total R N A from control cultures of DMSO treated or untreated CMK-6, CMK, and CMK11-5 cells was used as a template (data not shown). After 6 h of PMA treatment, CMK-6 expressed a wider repertoire of cytokines which included ILl a , IL-3, GM-CSF, and IL-6 receptor (Fig. 4). After 24 h, the level of expression was markedly decreased, except for IL-la and IL-lp, but a new transcript for IL-6 appeared. After 48 h of PMA stimulation, only the TNF-a, TGF-P, and ECGF RNA transcripts were present (data not shown). CMK cells of intermediate maturation showed a wider array of cytokine expression compared to the less mature CMK-6 cells. After 3 h of PMA stimulation, new RNA transcripts were present for IL-3 and GM-CSF (Fig 4). After 6 h, the cells expressed additional mRNAs for IL-la, IL-lp, GM-CSF, and IL-6 receptors. The level of expressed cytokines was sharply decreased after 24 h of PMA induction, and PCR mapping showed RNA transcripts for IL-6 and IL-la. At 48 h of PMA stimulation, TNF-a, ECGF and TGF-P specific transcripts were detected (data not shown).

]

F??A

] PMA 1

2

3

4

5

6

7

Day of Culture Effect of PMA on proliferation of Fig. 1. CMK clones in liquid culture. Cells were initially cultured at concentration of lo5cells/ml with the addition of 10% FCS in the presence or absence of PMA(10 ng/ml). ( 0 ) CMKl I-5, (A) CMK and (m) CMK-6.

CMK6

1

CMK

CMKI 1-5

Ploidy % of cells 2N

!N

I

8N 4N

2N

,

2N

/ 4N

100

200

4,A, 100

200

100

200

Log DNA Content Fig. 2.

DNA histograms of untreated control CMK cells and cells treated with PMA. Treatment with PMA

results in a shift of cells out of 2N into 4N and 8N ploidy level.

75

Fig. 3. Mapping of untreated CMK-6, CMK and CMKIl-5 cells for cytokine expression. Cells (10 x lo6) were prepared and mapped as described in Materials and Methods. Constitutive expression for TNF-a. TGF-P, IL- 1p, and ECGF was detected for CMK-6, CMK, and CMKl l-5. The positive control of p-actin primers with RNA for untreated cells is indicated. Fig. 4A. Mapping for cytokine expression of IL-la, IL-16, IL-3 and GM-CSF of unstimulated and stimulated CMK cells with PMA. Cells (I0 x I@) were prepared and mapped as described in Material and Methods. Lane A indicates RNA of untreated cells; lane B indicates RNA for 3 h post stimulation with PMA; lane C indicates RNA for 6 h post stimulation with PMA; and lane D indicates RNA for 24 h post stimulation with PMA.

For CMKl15 cells, the PCR mapping (Fig. 4) showed similar results as CMK. All PCR standard controls were negative. The p-actin primer for each RNA tested was positive (Figs. 3, 4). Cytokine Production by CMK Clones Supernatant and cell-associated fractions of the three CMK clones stimulated with PMA were assayed for TNF-a IL- 1p, IL- 1a,IL-6 and GM-CSF proteins by RIAs. None of these cytokines was readily detectable in cultures of the unstimulated CMK clones (data not shown). Following 3 h of exposure to PMA, a moderate level of IL-lp protein was detected in the three clones; CMKIl-5 cells also produced detectable I L - l a (Fig. 5). Both IL-lp and L-la were cellassociated and not secreted. After 24 h of PMA stimulation, high concentrations of GM-CSF were detected in the supernatants of all three CMK cell cultures (Fig. 6). Most of the GM-CSF was secreted rather than cell-associated. Moderate levels of TNFa and IL-6 were also secreted by the three CMK clones. TNF-(Y levels were also detectable in the

16

Cytokine Expression and Human Megakaryocytic Cells

Fig. 4B. Mapping of CMK-6 cells for cytokine expression of IL-6, and IL-6 receptor (left panel). Cells (10 x lo6) were prepared and mapped as described in Material and Methods. Lane A indicates RNA of untreated cells; lane B indicates RNA for 3 h post stimulation with PMA; lane C indicates RNA for 6 h post stimulation with PMA; and lane D indicates RNA for 24 h post stimulation with PMA.

Fig. 4C. Mapping for p-actin primer set. Cells (10 x 109 were prepared and mapped as described in Material and Methods.

AvrahamNannier/Chi/Dinarello/Groopman

77

PMA Stimulated - 3 h SECRETED

E

\ 4

9

2

0 0 1 CMK-6 CMK CMK11-5

Fig. 5. Production of TNF-a, IL- 1p, IL- la, IL-6 and GM-CSF by CMK clones after 3 h of PMA treatment. CMK clones were stimulated by PMA (10 ng/ ml) for 3 h and assayed for cytokine production in super-

natants and cell pellets.

Fig. 6. Production of TNF-a, L I P , IL-la, IL-6 and GM-CSF by CMK clones after 24 h of PMA treatment. CMK clones were stimulated by PMA (10 ng/ ml) for 24 h and assayed at 24 h for cytokine production in supematants and cell pellets.

cell-associated fraction of these three CMK clones. After 48 h of exposure to PMA, I L - l a and IL-Ip were found in supernatants as well as in pellets of the three CMK clones, indicating a slow process of secretion of IL-I by these megakaryocytic cell lines (Fig. 7 ) . Supernatants of all CMK clones contained low levels of TNF-a and IL-6. The cell-associated fractions of these cultures did not contain detectable amounts of TNF-a or IL-6. High levels of GM-CSF were still found in the supernatants of C M K l l - 5 cells, whereas supernatants of CMK-6 and CMK cells after 48 h of PMA treatment contained less GM-CSF than those with 24 h of PMA treatment.

Discussion We studied the expression of cytokines by cells of megakaryocytic lineage using the PCR technique and the permanent human megakaryocytic cell line CMK as a model. The PCR is a rapid and highly sensitive method able to analyze the array of mRNAs made by a relatively small number of cells in culture. CMK cells responded to PMA treatment by increasing expression of several cytokine and cytokine receptor genes. Of particular note, the CMK clones expressed and produced IL-6 and expressed the IL-6 receptor, as has been observed recently in primary human megakaryocytes [27]. We did not observe constitutive production of IL-6, while Fuse et al. recently reported that CMK cells may elaborate low levels of IL-6 which increased with IL-lp stimulation [ 161. The differences between our results

Fig. 7. Production of TNF-a, IL-lp, IL-la, IL-6 and GM-CSF by CMK clones after 48 h of PMA treatment. CMK clones were stimulated by PMA (10 ngl ml) for 48 h and assayed at 48 h for cytokine production

in supernatants and cell pellets. and those of Fuse et al. may be due to differences in culture conditions and/or changes in the CMK cells. Similarly, we detected expression of IL-3 mRNA upon PMA stimulation while Komatsu et al. did not [17]. Our CMK cells clearly were diploid (39% to 67%) while the cells studied previously were 4N or greater [ 171. This may indicate a change in this cell line. Furthermore, the CMK clones were found to constitutively express moderate levels of TNF-a, TGF-P, and ECGF. PMA induction markedly increased expression of a wider repertoire of cytokines

78

than expected, suggesting that cells of megakaryocytic lineage may have a very broad range of responsiveness to certain stimuli in terms of gene activation. Synthesis of GM-CSF and IL- 1a greatly increased in response to PMA with moderate increases in IL-6, IL-1 p and TNF-a production. Interestingly, activated platelets have previously been noted to express both IL-la and IL-lp activity [28]. After 24 h exposure to PMA, expression of most cytokines declined to baseline, while E - 6 was expressed in all three clones, indicating a late expression of this cytokine. This cytokine has been shown to have effects on maturation of committed megakaryocytes in vitro [ 131; its late expression by PMA-induced CMK cells may indicate that the more mature megakaryocytes produce a cytokine capable of further driving their terminal differentiation. In this regard, it is noteworthy that cell growth ceased upon PMA treatment and cytokine induction. It appears that cytokines synthesized by cells of megakaryocytic lineage may regulate their growth and maturation, suggesting an autocrine mechanism may be operative in this hematopoietic pathway. Furthermore, cytokines produced by megakaryocytes could act upon other hematopoietic elements as well as nonhematopoietic stromal cells within the bone marrow. Two hematopoietic growth factors, GM-CSF and IL-3, have a substantial stimulatory effect on human megakaryocyte progenitor cell growth (CFUMeg) in vitro [24]. IL-3 and GM-CSF have been observed to enhance proliferation of CMK cells [ 171. This is consistent with previous reports that IL-3 promotes maturation of single megakaryocytes and that highly purified small megakaryocytes respond to GM-CSF [l]. IL-6 can act on maturing megakaryocytes to promote their differentiation [ 13,251. IL-la and IL-6 are capable of potentiating the colony-stimulating ability of IL-3 for early hematopoietic precursors [26]. The effect of IL-la on hematopoiesis has been attributed in part to its ability to cause stromal cells to elaborate a number of cytokines, including granulocyte (G)-CSF, GM-CSF, or IL-6, which might then more directly influence hematopoietic progenitor cell proliferation. Growth inhibitory cytokines have also been identified. TNF-a appears to suppress erythropoiesis in vitro, whereas TGF-P inhibits megakaryocyte progenitor proliferation and endomitosis [ 141. Observations made in permanent cell lines ultimately need to be verified in primary cells of similar lineage using physiological stimuli. In general, transformed hematopoietic cells have proven to be useful models in studying cytokine biology and have re-

Cytokine Expression and Human Megakaryocytic Cells flected the capacity of the primary hematopoietic cells to produce and respond to regulatory molecules. Examples include production of alpha interferons by KG-I myeloid cells, of IL-1 by U937 monocytic cells, and of GM-CSF, gamma interferon, IL-2 and IL-3 by T-cell lines [26]. These permanent cell lines were derived from patients with hematologic neoplasms, similar to the derivation of CMK megakaryocytic cells from a patient with megakaryoblastic leukemia [ 161. The observation that CMK cells express a number of cytokines not previously reported as products of megakaryocytes, such as GM-CSF, IL-3, and TNF-a, provides the basis to study the capacity of primary and leukemic megakaryocytes to express and synthesize these particular regulatory proteins. We speculate that our observations made in the CMK cell lines will be recapitulated in future studies of primary cells based on the similarities in expression of IL- 1a,IL- 1p, IL-6, the IL-6 receptor, TGF-a, TGF-p, and ECGF in both CMK cells and primary megakaryocytes andlor platelets.

Acknowledgments Supported in part by grants from the NIH, HL33774, HL42112, AI29847, HL41374, AI62534, HL43501, CAOl235 and the Department of Defense, DAMD 17-90-C-0 106. We thank Mrs. Patricia A. Grynkiewicz for preparation of the manuscript.

References Hoffman R. Regulation of megakaryocytopoiesis. Blood 1989;74:1196. Gewirtz AM. Human megakaryocytopoiesis. Semin Hematol 1986;23:27. Teramura M, Katahiia L, Hoshino S, Motoji T, Oshimi K. Mizoguchi H. Clonal growth of human megakaryocyte progenitors in serum-free cultures: effect of recombinant human interleukin 3. Exp Hematol 1988;16:843. Bruno E, Briddell E, Hoffman R. Effect of recombinant and purified hernatopoietic growth factors on human megakaryocyte colony formation. Exp Hematol 1988;16:371. GewirtzAM. Hoffman R. Human megakaryocyte production: Cell biology and clinical considerations. Hematology/Oncology clinics of North America 1990;4(1):43. Ishibashi T, Kimura H, Shikama Y,et al. Interleukin6 is a potent thrombopoietic factor in vivo in mice. Blood 1989;74:1241.

AvrahamNannier/Chi/DinarelIo/Groopman 7 Greenberg SM, Kuter DJ, Rosenberg RD. In vitro stimulation of megakaryocyte maturation by megakaryocyte stimulatory factor. J Biol Chem 1987;262:3269.

8 McDonald Tp. Regulation of megakaryocytopoiesis by thrombopoietin. Ann. NY. Acad Sci 1988;509:1. 9 Williams N, Eger RR, Jackson HM, Nelson DJ. Two factor requirements for murine megakaryocyte colony formation. J Cell Physiol 1982;110:101. 10 Kishimoto T. The biology of interleukin-6. Blood 1989;74: 1. I I Warren MK, Conroy LB, Rose JS. The role of interleukin-6 and interleukin- 1 in megakaryocyte development. Exp Hematol 1989;17: 1095. 12 Williams N, DeGiorgio T, Banu N, Withy R, Hirano T, Kishimoto T. Recombinant interleukin-6 stimulates immature murine megakaryocytes. Exp Hematol 1990;18:69. 13 Ishibashi T, Kimura H, Uchida T, Kariyone S , Friese P, Burstein SA. Human interleukin-6 is a direct promoter of maturation of megakaryocytes in vitro. Proc Natl Acad Sci USA 1989;86:5953. 14 Greenberg SH, Chandraselahar C, Golan DE, Handin RI. Transforming growth factor p inhibits endomitosis in the Dami human megakaryocytic cell line. Blood 1990;76:533. 15

Adachi M, Ryo R, Sat0 T, Yamaguchi N. Platelet factor 4 gene expression in a human megakaryocytic leukemia cell line (CMK) and its differentiated subclone (CMK 11-5). Exp Hematol 1991; 19:923927.

16 Fuse A, Kakuda H, Shima Y, Damme JV, Billian A, Sato T. Interleulun-6, a possible autocrine growth and differentiation factor for the human megakaryocytic cell line, CMK. Br J Haematol 1991;77:32-36. 17 Komatsu N, Suda T, Moroi M, et al. Growth and differentiation of a human megakaryoblastic cell line, CMK. Blood 1989;74:42. 18 Maniatis T, Fritsch EF, Sambrook J. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory. Cold Spring Harbor, N.Y. 1982:185.

79 19 Katzen NA, Vannier EG, Segal GM, Klempner MS, Dinarello CA. Comparison of granulocyte-macrophage colony-stimulating factor and interleukin- 1 production from human peripheral blood mononuclear cells as measured by specific radioimmunoassays. 1991; (Submitted to Blood). 20 Van der Meer JWM, Endres S , Lonneman G, et al. Concentrations of immunoreactive human tumor necrosis factor alpha produced by human monuclear cells in vitro. Leukocyte Biol 1988;43:216. 21 Lisi PJ, Chu CW, Koch GA, Endres S, Lonnemann G , Dinarello CA. Development and use of a radioimmunoassay for human interleukin- 1 beta. Lymphokine Res 1987;6:229. 22

Schindler R. Mancilla L, Endres S, Ghorbani R, Clark SC, Dinarello CA. Correlations and interactions in the production of IL-6, IL-1and TNF in human blood monuclear cells. tL-6 suppresses L1 and TNE Blood 1990;75:40.

23

Endres S. Ghorbani R, Lonnemann G , van der Meer JMW, Dinarello CA. Measurement of immunoreactive interleukin-I beta from human monuclear cells. Clin Immunol Immunopathol 1988;49:424.

24 Bruno E, Miller ME, Hoffman R. Interacting cytokines regulate in vitro human megakaryocytopoiesis. Blood 1989;73:671. 25

Asano S, Okano A, Ozawr K, et al. In vivo effects of recombinant human interleukin-6 in primates. Stimulated production of platelets. Blood 1990;75: 1602.

26 Groopman JE, Molina JM, Scadden DT. The hematopoietic growth factors. N Engl J Med 1989;32 1:1449. 27

Navarro S , Debili N, LeLouedic JP, Breton-Gonus J. Doly J, Vainchenker W. IL-6 and its receptor are expressed by human megakaryocytes: In vitro effects on proliferation and endoreplication. Blood 1991;77(3):461.

28

Santoro SA, Platt FM, Unamue ER. Activated platelets express IL-1activity. J Immunol 1989;143:4015.