Cytoprotective effects of opioids on irradiated oral epithelial cells Nada Charbaji, BSc1; Peter Rosenthal, PhD2; Monika Schäfer-Korting, PhD1; Sarah Küchler, PhD1 1. Institute for Pharmacy, Pharmacology and Toxicology, Freie University Berlin, and 2. Clinic of Radiation Oncology and Radiotherapy, Charité - University Medicine, Berlin, Germany
Reprint requests: Dr. S. Küchler, Institute for Pharmacy, Pharmacology and Toxicology, Freie Universität Berlin, Königin-Luise-Str. 2-4, 14195 Berlin, Germany. Tel: +49 30 838 55065; Fax: +49 30 838 53944; Email: [email protected] Manuscript received: April 25, 2013 Accepted in final form: August 28, 2013 DOI:10.1111/wrr.12115
ABSTRACT Oral mucositis is a common side effect of chemotherapy and radiation therapy accompanied with acute inflammation and ulceration of the oral mucosa. Opioids can improve the wound healing of dermal and oral tissue when applied locally. The aim of this study was to investigate if morphine exhibits cytoprotective effects on oral epithelial cells postirradiation. Hence, oral epithelial cells were exposed to increasing doses (3–30 Gy) of ionization radiation. We assessed the effects of the radiation on cell viability, proinflammatory cytokine release (interleukin [IL]-1α, IL-6), and matrix metalloproteinase (MMP-1, -8, and -9) expression. As expected, radiation significantly impaired cell viability and morphology and resulted in enhanced IL release. However, morphine-treated cells consistently showed higher cell viability postirradiation: 9.19 ± 1.16% after 24 hours and 7.45 ± 0.93% after 48 hours compared with the control. In terms of proinflammatory cytokines, the release of IL-1α and IL-6 was significantly reduced, too, being most pronounced at 48 hours postradiation. Additionally, we observed a significant reduction of MMP-1 and especially MMP-9 expression in morphine-treated cells. The results clearly indicate antiinflammatory as well as cytoprotective effects of morphine on irradiated oral epithelial cells. Interestingly, the protective effects of morphine are not related to a decrease in cell apoptosis or necrosis. Before final conclusions can be drawn, further studies in more complex systems in vitro and in vivo are required. Nevertheless, these findings further underline the high potential of opioids for the treatment of topical wounds and inflammatory conditions.
Oral mucositis (OM) is a common side effect of chemotherapy and radiation therapy accompanied with acute inflammation and ulceration of the oral mucosa. OM is developing as a consequence of epithelial damage and cellular death triggered by complex series of molecular and cellular events.1 The occurrence rate of OM is dependent on the malign underlying disease and the therapy regimen. The prevalence exceeds 90% in patients undergoing hematopoietic stem cell transplantation or radiation therapy for the treatment of cancers of the mouth and/or the oropharynx.2,3 Dependent on the severity of the symptoms, the patient’s morbidity may be increased and even the cessation of the therapy might be required.4 The local damage after radiation involves a combination of inflammatory processes and alteration of cellular proliferation involving the release of proinflammatory cytokines, growth factors, and adhesion molecules.5 Furthermore, fibrinogenesis and angiogenesis are directly inhibited.6 Ionizing radiation causes reduced proliferation of fibroblasts, atypical cell migration, and abnormalities in collagen synthesis.7,8 Changes in the extracellular matrix composition impair the healing time of the wounded tissue.9,10 Often opioids are systemically applied for the management of OM-associated severe pain.11 However, this requires efficient balancing between pain reduction and the undesirable Wound Rep Reg (2013) 21 883–889 © 2013 by the Wound Healing Society
side effects such as nausea, vomiting, mental clouding, constipation, and sedation.12 Hence, local opioid application is widely discussed to overcome this obstacle. The rational basis for this approach is the expression of opioid receptors outside of the central nervous system on peripheral sensory neurons, tissues, and cells such as keratinocytes, fibroblasts (for review, see:12–15), and oral epithelial cells.16 The activation of peripheral opioid receptors induces potent analgesic effects 17,18 and facilitates the wound healing and reepithelialization of topical wounds by stimulating the cell migration14,19,20 as shown repeatedly in vitro and in vivo. Furthermore, a functional role of opioids in the context of inflammation is well known.14,17,18 Opioids can interfere at several stages with the inflammatory cascade, both in somatic and visceral inflammation.14,21 Furthermore, in primary afferent neurons, opioid receptor activity is enhanced under inflammatory conditions and peripheral opioid receptors are up-regulated.22 Just recently, we demonstrated that opioids significantly improve the cell migration of oral epithelial cells via activating specifically the delta opioid receptor.16 Based on those results, we aimed to elucidate if and how morphine affects the cell viability, the inflammatory response, cytokine release, the expression of matrix metalloproteinases (MMPs), and cell apoptosis of oral epithelial cells after being subjected to irradiation. 883
Cytoprotective effects of morphine
MATERIALS AND METHODS
Charbaji et al.
TR146 cells, a human buccal tumor cell line (Imperial Cancer Research Technology, London, United Kingdom) were maintained and cultured as described elsewhere.16
cultures were taken 24 hours postirradiation using an invert microscope. The morphological changes of the cells were analyzed semi-quantitatively using the automatic cell image analysis software (CellProfiler, Broad Institute, Harvard University, Boston, MA).This software allows for an automatic analysis of the cell shape and size (major and minor cell axis length).23
Cell irradiation protocol
Cell viability
For cell irradiation, 60 × 103 TR146 cells were seeded in 12-well culture plates. After 24 hours, the cells were irradiated with the dosages 0 Gy, 3 Gy, 8 Gy, 12 Gy, and 30 Gy using a 6 MeV photon beam at a medical linear accelerator (Varian Clinac 600 CD, Palo Alto, CA; field size 40 × 40 cm2). During irradiation, the cell culture plates were kept in a water-equivalent environment. Therefore, dose inhomogeneity in the medium was less than 5% (Figure 1). Nonirradiated cultures were kept at room temperature during irradiation. Afterward, the cells were incubated with morphine (100 nM) for 24 and 48 hours at 37 °C and 5% CO2. Morphine hydrochloride was purchased from Fagron (Barsbüttel, Germany) and dissolved in phosphate-buffered saline (pH 7.4) with 0.4% bovine serum albumin (SigmaAldrich, Munich, Germany). The control group was not subjected to morphine incubation.
Mitochondrial dehydrogenase activity was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) reduction test in order to assess cell viability. Twenty-four hours and 48 hours postradiation, 100 μL/well of MTT solution (5 mg/mL) was added, and the cells were incubated at 37 °C and 5% CO2 for 4 hours. The supernatants were removed, 1 mL of dimethyl sulfoxide was added to dissolve the blue formazan salt, and optical density was measured using the FLUOstar Optima (BMG Labtech, Ortenberg, Germany), setting the absorbance to 540 nm.
Cells and cell culture
Cell imaging
To investigate the morphological changes of irradiated cells with and without morphine treatment, pictures of the cell
Fluorescence-activated cell sorting (FACS) analysis
To identify necrotic and apoptotic cell populations, FACS was performed (FACSCalibur, Becton Dickinson, Heidelberg, Germany). Apoptosis was determined using fluorescein isothiocyanate (FITC)-labeled Annexin V (Enzo Life Sciences, Lörrach, Germany). Dye exclusion of the nonvital dye promodium iodide (PI) (Sigma-Aldrich) was measured simultaneously. Morphine-treated and untreated cells were trypsinized and washed twice with binding buffer (10 mM HEPES/NaOH, pH 7.4, 140 mM NaCl, 2.5 mM CaCl2). Subsequently, cells were resuspended in binding buffer, followed by the exposure to Annexin V-FITC (final concentration 0.5 mg/mL) for 10 minutes in the dark at room temperature. Then, PI was added (1 μg/mL), and samples were analyzed by bivariate flow cytometry. The cell populations were separated into four groups: The cells stained with Annexin V but not with PI were classified as early apoptotic cells (lower right quadrant). The cells positive for Annexin V and PI were classified as late apoptotic cells (upper right quadrant). The cells that were negative for Annexin V but positive for PI were classified as necrotic cells (upper left quadrant). The cells that were negative for both Annexin V and PI were classified as normal viable cells (lower left quadrant). Reverse transcription-polymerase chain reaction
Figure 1. Relative dose distribution calculated in a CT-slice of the cell irradiation setup. In the center of the phantom material, the well chambers filled with medium are visible. The isodose line (100%) indicates the nominal dose of 3, 8, 12, or 30 Gy, respectively. CT, computed tomography.
884
Total RNA was isolated using the NucleoSpin® RNA II kit (Macherey-Nagel, Düren, Germany) as described by the manufacturer’s protocol. cDNA was synthesized using the FermentasAid First strand cDNA synthesis kit (Fermentas GmbH, St. Leon-Rot, Germany). Subsequently, 2 μL cDNA was subjected to quantitative real-time polymerase chain reaction (RT-PCR) using the LightCycler480 and the SYBR Green I PCR Master Mix (Roche Applied Sciences, Mannheim, Germany). The thermal cycle profile used was denaturing for 10 seconds at 95 °C, annealing primers for 10 seconds at 60 °C, and extending the primers for 10 seconds at 72 °C. The PCR amplification was performed at 45 cycles while Wound Rep Reg (2013) 21 883–889 © 2013 by the Wound Healing Society
Charbaji et al.
Cytoprotective effects of morphine
Table 1. Primer sequences used in RT-PCR Target/reference gene IL-1α forward IL-1α reverse IL-6 forward IL-6 reverse MMP-1 forward MMP-1 reverse MMP-8 forward MMP-8 reverse MMP-9 forward MMP-9 reverse YWHAZ forward YWHAZ reverse
Primer sequences (5'→3')
bp
CGCCAATGACTCAGAGGAAGA AGGGCGTCATTCAGGATGAA CACAGACAGCCACTCACCTC TTTTCTGCCAGTGCCTCTTT GGGAGATCATCGGGACAACTC GGGCCTGGTTGAAAAGCAT CAACCTACTGGACCAAGCACAC TGTAGCTGAGGATGCCTTCTCC CCTGGAGACCTGAGAACCAATC CCACCCGAGTGTAACCATAGC AGACGGAAGGTGCTGAGAAA GAAGCATTGGGGATCAAGAA
120 137 72 128 79 127
bp, base pairs; RT-PCR, real-time polymerase chain reaction.
monitoring the fluorescence. Primer sequences are given in Table 1. The mRNA expression levels of each target gene are presented as a ratio to the housekeeping gene YWHAZ. PCR product sizes were checked using a 2% agarose gel.
diation. Exemplary data are depicted in Table 2. Morphinetreated cells showed a tendency toward a smaller increase in size (Table 2). Cell viability
Interleukin (IL) release
The concentrations of the proinflammatory cytokines IL-1α and IL-6 were measured in the cell culture media 24 and 48 hours postradiation. Cytokine concentrations were determined using enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, MN) in accordance to the manufacturer’s protocol. Contents of the samples were calculated according to the standard curve, and the results are given in pg/mL.
MTT assay showed a significant decrease of cell viability after irradiation, which correlated well with the radiation
Statistics
All values (of at least three independent experiments) are expressed as mean ± standard deviation (SD). For statistical comparison of the untreated and morphine-treated cells, the paired t test was performed. *p ≤ 0.05 indicates statistical significance.
RESULTS Cell morphology
Clearly, dose-dependent changes of the cell morphology have been observed. Twelve gray irradiation induced a significant reduction of the cell colony formation (Figure 2). Irradiating the cells with 30 Gy induced drastic effects on the cell structure. The cells change to a flatter, unclear shape, and the cell colonies became significantly smaller. Morphine-treated cells seem to be more capable of forming larger colonies compared with the cells without morphine treatment and were capable of maintaining their original cell shape (Figure 2). Data evaluation using the cell image analysis software showed an increase of the major and minor cell axis lengths upon irraWound Rep Reg (2013) 21 883–889 © 2013 by the Wound Healing Society
Figure 2. Cell morphology of TR146 cells 24 hours postradiation with and without morphine treatment. The number of cells decreased with increasing radiation dosage. Cell morphology changed from defined cell structures to a larger, undefined, stretched, and irregular shape without morphine treatment. Scale bar 50 μm, magnification 100 ×. Morphinetreated cultures show higher cell counts.
885
Cytoprotective effects of morphine
Charbaji et al.
Table 2. Exemplary values of the major and minor axis length of irradiated cells with or without morphine treatment analyzed by the CellProfiler
0 Gy 0 Gy + Morphine 100 nM 3 Gy 3 Gy + Morphine 100 nM 30 Gy 30 Gy + Morphine 100 nM
Major axis length (mean ± SD)
Minor axis length (mean ± SD)
27.17 ± 9.45 30.87 ± 11.47 35.48 ± 15.64 27.85 ± 9.08 50.86 ± 18.41 40.44 ± 18.31
14.66 ± 4.95 14.57 ± 5.22 16.93 ± 5.71 14.93 ± 5.00 19.76 ± 7.22 15.64 ± 4.78
SD, standard deviation.
postirradiation were 90% (0 Gy), 88% (3 Gy), 87% (8 Gy), 84% (12 Gy), and 86% (30 Gy) for the cells without morphine treatment and 93% (0 Gy), 87% (3 Gy), 86% (8 Gy), 85% (12 Gy), and 86% (30 Gy) for the morphine-treated cells (data not shown). Although the percentage of viable cells decreased with increasing radiation dosage, the obtained results failed to be statistically significant. No effect of morphine was observed. Gene expression and release of the proinflammatory cytokines IL-1α and IL-6
Gene expression and cytokine release of IL-1α and IL-6 were evaluated after irradiation of the cells using quantitative RT-PCR and ELISA. Only IL-6 mRNA expression was up-regulated in response to the radiation; no effects were seen for IL-1α (Figure 4). After 48 hours, IL-6 mRNA expression was increased by 1.9-, 3-, and 4.3-fold as a result of irradiation with 3, 8, and 12 Gy, respectively (Figure 4). Morphine significantly reduced the radiation-induced up-regulation of IL-6 expression (p ≤ 0.05; Figure 4). In terms of cytokine release, a dose-dependent increase in IL-6 was detected after 24 hours and even more pronounced after 48 hours, whereas morphine-treated cells showed significantly reduced IL-6 levels (Figure 5). Similar results were obtained for IL-1α. However, increased release of the cytokine was only detected after 48 hours (Figure 5). Surprisingly, on the mRNA level, only minor effects on IL-1α expression were found. For nonirradiated cells, no differences
Figure 3. Cell viability decreased dose-dependently following irradiation of the cells. Morphine-treated cells showed higher cell viability compared with nontreated cells undergoing irradiation. Nonirradiated oral epithelial cells served as control. Mean ± SD, n = 3; * indicates statistically significant differences at p ≤ 0.05. SD, standard deviation.
dosage. Twenty-four hours postradiation, a significant reduction of cell viability of the cells irradiated with 12 Gy (75% viability left) was detected. For the morphine-treated cells, we measured a cell viability of 87% (Figure 3). Twenty-four hours after 30 Gy radiation, again the cell viability was significantly higher in the morphine-treated cells (60%) compared with the untreated cells (49%) (Figure 3). Similar results were obtained 48 hours postradiation. In general, morphine exposure consistently resulted in higher cell viabilities: 9.19 ± 1.16% after 24 hours and 7.45 ± 0.93% after 48 hours (mean values ± SD, regardless of the applied dosage). The effect was most pronounced at higher radiation dosages. Apoptosis/necrosis
To investigate the underlying mechanism of the reduced cell viability and to clarify if morphine exhibits its protective effects by interference with apoptosis or necrosis, FACS analysis was performed. After irradiating the oral epithelial cells, we used PI/Annexin V double staining to detect apoptotic and necrotic cells. The percentage of unstained cells (for both PI and Annexin V) representing viable cells 48 hours 886
Figure 4. Regulation of mRNA expression of the proinflammatory cytokines IL-1α and IL-6. TR146 cells were irradiated with a single dose of photon beam and subsequently incubated with 100 nM morphine for 24 or 48 hours, respectively. The data were normalized to the housekeeping gene YWHAZ. Mean ± SD, n = 3; * indicates statistically significant differences at p ≤ 0.05. IL, interleukin; SD, standard deviation. Wound Rep Reg (2013) 21 883–889 © 2013 by the Wound Healing Society
Charbaji et al.
Figure 5. IL-1α and IL-6 release of TR146 cells after irradiation. Incubation with 100 nM morphine resulted in a significant reduction of radiation-induced IL-1α and IL-6 release. The data were normalized to the housekeeping gene YWHAZ. Mean ± SD, n = 3; * indicates statistically significant differences at p ≤ 0.05. IL, interleukin; SD, standard deviation.
in gene expression and IL release were detected between morphine-treated and nontreated cells.
Cytoprotective effects of morphine
significantly—from complex biological events.24–26 Radiation therapy can activate a number of transcription factors. As a result, the expression of several genes is altered including those controlling the production of proinflammatory cytokines such as IL-1α, IL-6, and IL-8. Furthermore, in addition to the damage to the connective tissue, MMP such as MMP-1, -8, and -9 are activated.1,25,27 Just recently, we demonstrated that oral epithelial cells, TR146, and primary human oral keratinocytes express the three opioid receptors and that morphine facilitates the cell migration of these cells by activation of specifically the delta opioid receptor.16 Based on these findings, we now investigated whether the topical application of morphine postradiation has beneficial effects not only on cell migration and wound closure but also on the inflammatory cascade and the activation of MMPs. We opted for morphine as the representative substance for opioids as it was previously shown that μ-agonistic opioids give identical results.20 In this study, we used the oral epithelial cell line TR146, which despite being isolated from a squamous cell carcinoma of the buccal mucosa expresses all major markers of the epithelial basal membrane and of epithelial differentiation.28 We subjected the TR146 cells to different single doses of ionization radiation (3–30 Gy) that allowed us to investigate the effects of radiation from mild to very intensive treatment.29 Irradiating TR146 cells resulted in a significant morphological change of the cell shape (Figure 2) and a dosedependent reduction of cell viability (Figure 3). This was expected as after radiation, the DNA double strand breaks, and the antiproliferative effects of ionization radiation come into effect.30 The oral epithelial cells treated with morphine (100 nM) postirradiation showed significantly higher cell viabilities compared with the control cells (Figure 3). This is
Expression of MMP-1, MMP-8, and MMP-9
The gene expression of MMP-1, -8, and -9 and their regulation upon morphine treatment were investigated too. MMP-8 mRNA expression was not detected in TR146 cells either irradiated or nonirradiated (data not shown). MMP-9 was expressed only in traces in nonirradiated TR146 cells. The expression level was up-regulated 11-, 15-, and 20-fold 48 hours postirradiation for 8, 12, and 30 Gy, respectively (Figure 6). MMP-1 mRNA expression increased in TR146 cells in response to the radiation in a dose-dependent manner too. Forty-eight hours postirradiation, 3.7-, 4.3-, and 5.5-fold induction with 8, 12, and 30 Gy were detected, respectively (Figure 6). Applying 100 nM morphine postirradiation significantly reduced the radiation-induced up-regulation of the MMPs. The expression of MMP-9 was suppressed most effectively (Figure 6).
DISCUSSION For decades, the pathophysiology of OM was thought to be based only on the premise that cytotoxic therapies or irradiation target and damage the rapidly dividing cells of the oral epithelium. However, this concept has changed over the past years and is now replaced by the knowledge that OM results not only from direct cell injury but also—and even more Wound Rep Reg (2013) 21 883–889 © 2013 by the Wound Healing Society
Figure 6. Relative mRNA expression of MMP-1 and MMP-9 in TR146 cells after irradiation and subsequent incubation with or without 100 nM morphine for 24 or 48 hours, respectively. The data were normalized to the housekeeping gene YWHAZ. Mean ± SD, n = 3; * indicates statistically significant differences at p ≤ 0.05. MMP, matrix metalloproteinase; SD, standard deviation.
887
Cytoprotective effects of morphine
well in accordance with other studies describing that topically applied opioids modulate cellular proliferation and survival.31 Additionally, one recent publication of our group demonstrated that local application of morphine up-regulates Erk 1/2 MAPK in oral epithelial cells,16 which is crucial for the regulation of cell proliferation, differentiation, and meiosis.32,33 To elucidate potential anti-inflammatory effects of morphine postirradiation, the release of IL-1α and IL-6 was quantified. IL-1α plays a central role in the activation of keratinocytes that initiates the inflammatory process. IL-6 has a broad range of biological activities and is particularly involved in the immune response and the pathogenesis of many inflammatory diseases34 including OM.1 It has been shown that these proinflammatory cytokines are capable of further activation of transcription factors mainly contributing to the development of OM.26,34 In this study, significant increases of IL-1α and IL-6 release were detected postirradiation even at the lowest radiation dosage 3 Gy. These findings were expected and are well in accordance with other studies,35 although this group only tested doses up to 8 Gy. Morphine treatment postradiation successfully reduced these effects (Figure 5). The low release of IL-1α after 30 Gy irradiation is most likely due to the very low number of viable cells (45% cell viability) after this very high dosage as the amount of released cytokines directly correlates with the number of viable cells.36 Surprisingly, on the mRNA level, no regulation of IL-1α was detected (Figure 4), which might be due to the fact that the selected time points were not optimal for this cytokine, especially as we saw a significant increase in IL-1α release. Next, the expression of MMP-1, -8, and -9 was examined on the mRNA level postradiation. MMPs are mostly present in a nonactive form and are activated via a “cysteine switch.”37 These enzymes trigger injury within the tissue of the submucosa and disrupt the integrity between the epithelium and the basal membrane.1 They are also involved in the pathogenesis of multiple other inflammatory oral diseases. The role of MMP-1, MMP-8, and MMP-9 in OM is described in detail elsewhere,38,39 although as for today the exact role of MMPs is not understood completely. However, evidence is growing that the up-regulation of these endopeptidases mainly contributes and maintains the tissue damage in OM.38 Furthermore, up-regulation of MMP-9 seems to be directly related to a dysregulation of cell proliferation and differentiation and is involved in general damage onset.38 Interestingly, in our study, morphine treatment postirradiation suppressed MMP-9 expression most effectively. It is suggested that the downregulation of the pathologically elevated MMPs might be an option to avoid or limit the tissue destruction.40 Additionally, because of the effective suppression of MMPs, detrimental effects of the radiation on the epithelial lining might be reduced. Aside from its beneficial effects on IL release and MMP regulation, irradiation of the cells and subsequent morphine treatment only exhibited minor effects on cell apoptosis and necrosis. No significant differences in terms of apoptotic/ necrotic cell populations were found between morphinetreated and nontreated cells, clearly indicating that morphine does not interfere with this pathway. These findings substantiate the idea that morphine treatment may stimulate the cells’ proliferation, resulting in higher cell viabilities postirradiation. However, in one of our previously published studies, we did not see a proliferation-stimulating effect of morphine on 888
Charbaji et al.
oral epithelial cells.16 Nevertheless, such effects were described repeatedly by other groups.13,14,31 Because of these contradictory findings, no final conclusion can be drawn, and the underlying mechanism of the protective effects of morphine is still ambiguous. In clinical practice, irradiation regimens and dosages are adjusted to the underlying malign disease. For example, guidelines published by the Committee of the Scientific Medical Societies (Germany) recommend a total dose of 70 Gy applied as 1.8–2 Gy single doses, respectively, for the treatment of oral cancer.41 In our study, we did not perform repeated irradiation, but morphine exhibited sound antiinflammatory and cytoprotective effects already following single doses comparable with normal and high single dose irradiations. Future studies will be performed to investigate the impact of morphine after repeated irradiation, which mimics the clinical situation better. In conclusion, for the first time, we were able to show that morphine exhibits protective and anti-inflammatory effects on oral epithelial cells postradiation and that the up-regulation of MMPs can be suppressed efficiently. Taken together with previous findings such as facilitated cell migration, wound closure, and pain relief, local opioid treatment postradiation might be a new therapeutic approach to reduce the occurrence and severity of OM. Simultaneously, symptoms such as severe pain might be alleviated. Although further studies in more complex 3D in vitro tissues as well as animal studies are required, this study once more underlines the high potential of opioids for the topical treatment of wounds.
ACKNOWLEDGMENT Source of Funding: This work was partly supported by the European Funding for Regional Development (EFRE) project 20072013 2/08. Conflicts of Interest: The authors of this paper declare no conflict of interest.
REFERENCES 1. Sonis ST. Pathobiology of oral mucositis: novel insights and opportunities. J Support Oncol 2007; 5 (9 Suppl. 4): 3–11. 2. Silvermann S, Jr. Diagnosis and management of oral mucositis. J Support Oncol 2007; 5 (2 Suppl. 1): 13–21. 3. Bellm LA, Epstein JB, Rose-Ped A, Martin P, Fuchs HJ. Patient reports of complications of bone marrow transplantation. Support Care Cancer 2000; 8: 33–9. 4. Trotti A, Bellm LA, Epstein JB, Frame D, Fuchs HJ, Gwede CK et al. Mucositis incidence, severity and associated outcomes in patients with head and neck cancer receiving radiotherapy with or without chemotherapy: a systematic literature review. Radiother Oncol 2003; 66: 253–62. 5. Muller K, Meineke V. Radiation-induced alterations in cytokine production by skin cells. Exp Hematol 2007; 35 (4 Suppl. 1): 96–104. 6. Hall EJ, Astor M, Bedford J, Borek C, Curtis SB, Fry M et al. Basic radiobiology. Am J Clin Oncol 1988; 11: 220–52. 7. De Loecker W, Van der Schueren E, Stas ML, Doms D. The effects of x-irradiation on collagen metabolism in rat skin. Int J Radiat Biol Relat Stud Phys Chem Med 1976; 29: 351–8. Wound Rep Reg (2013) 21 883–889 © 2013 by the Wound Healing Society
Charbaji et al.
8. Rudolph R, Vande Berg J, Schneider JA, Fisher JC, Poolman WL. Slowed growth of cultured fibroblasts from human radiation wounds. Plast Reconstr Surg 1988; 82: 669–77. 9. Gorodetsky R, Mou XD, Fisher DR, Taylor JM, Withers HR. Radiation effect in mouse skin: dose fractionation and wound healing. Int J Radiat Oncol Biol Phys 1990; 18: 1077–81. 10. Goldschmidt H, Sherwin WK. Reactions to ionizing radiation. J Am Acad Dermatol 1980; 3: 551–79. 11. Eilers J, Million R. Clinical update: prevention and management of oral mucositis in patients with cancer. Semin Oncol Nurs 2011; 27: e1–16. 12. Stein C. Opioid receptors on peripheral sensory neurons. Adv Exp Med Biol 2003; 521: 69–76. 13. Rachinger-Adam B, Conzen P, Azad SC. Pharmacology of peripheral opioid receptors. Curr Opin Anaesthesiol 2011; 24: 408–13. 14. Stein C, Küchler S. Non-analgesic effects of opioids: peripheral opioid effects on inflammation and wound healing. Curr Pharm Des 2012; 18: 6053–69. 15. Bigliardi-Qi M, Sumanovski LT, Buchner S, Rufli T, Bigliardi PL. Mu-opiate receptor and beta-endorphin expression in nerve endings and keratinocytes in human skin. Dermatology 2004; 209: 183–9. 16. Charbaji N, Schäfer-Korting M, Küchler S. Morphine stimulates cell migration of oral epithelial cells by delta-opioid receptor activation. PLoS ONE 2012; 7: e42616. 17. Stein C, Hassan AH, Przewlocki R, Gramsch C, Peter K, Herz A. Opioids from immunocytes interact with receptors on sensory nerves to inhibit nociception in inflammation. Proc Natl Acad Sci U S A 1990; 87: 5935–9. 18. Schäfer M, Imai Y, Uhl GR, Stein C. Inflammation enhances peripheral mu-opioid receptor-mediated analgesia, but not mu-opioid receptor transcription in dorsal root ganglia. Eur J Pharmacol 1995; 279: 165–9. 19. Küchler S, Wolf NB, Heilmann S, Weindl G, Helfmann J, Yahya MM et al. 3D-wound healing model: influence of morphine and solid lipid nanoparticles. J Biotechnol 2010; 148: 24–30. 20. Wolf NB, Küchler S, Radowski MR, Blaschke T, Kramer KD, Weindl G et al. Influences of opioids and nanoparticles on in vitro wound healing models. Eur J Pharm Biopharm 2009; 73: 34–42. 21. Tegeder I, Geisslinger G. Opioids as modulators of cell death and survival—unraveling mechanisms and revealing new indications. Pharmacol Rev 2004; 56: 351–69. 22. Stein C, Lang LJ. Peripheral mechanisms of opioid analgesia. Curr Opin Pharmacol 2009; 9: 3–8. 23. Carpenter AE, Jones TR, Lamprecht MR, Clarke C, Kang IH, Friman O et al. CellProfiler: image analysis software for identifying and quantifying cell phenotypes. Genome Biol 2006; 7: R100. 24. Feller L, Essop R, Wood NH, Khammissa RA, Chikte UM, Meyerov R et al. Chemotherapy- and radiotherapy-induced oral mucositis: pathobiology, epidemiology and management. SADJ 2010; 65: 372–4.
Wound Rep Reg (2013) 21 883–889 © 2013 by the Wound Healing Society
Cytoprotective effects of morphine
25. Sonis S. The quest for effective treatments of mucositis. J Support Oncol 2011; 9: 170–1. 26. Sonis ST. The pathobiology of mucositis. Nat Rev Cancer 2004; 4: 277–84. 27. Scully C, Epstein J, Sonis S. Oral mucositis: a challenging complication of radiotherapy, chemotherapy, and radiochemotherapy: part 1, pathogenesis and prophylaxis of mucositis. Head Neck 2003; 25: 1057–70. 28. Rupniak HT, Rowlatt C, Lane EB, Steele JG, Trejdosiewicz LK, Laskiewicz B et al. Characteristics of four new human cell lines derived from squamous cell carcinomas of the head and neck. J Natl Cancer Inst 1985; 75: 621–35. 29. Branchi R, Fancelli V, De Salvador A, Giovannoni A. Cancer of the head and neck: general principles of radiobiology, radiotherapy and chemotherapy. Radiation damage. Minerva Stomatol 2003; 52: 411–9, 20–5. 30. Selzer E, Hebar A. Basic principles of molecular effects of irradiation. Wien Med Wochenschr 2012; 162: 47–54. 31. Chen YL, Law PY, Loh HH. The other side of the opioid story: modulation of cell growth and survival signaling. Curr Med Chem 2008; 15: 772–8. 32. Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, Berman K et al. Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr Rev 2001; 22: 153–83. 33. Huang C, Jacobson K, Schaller MD. MAP kinases and cell migration. J Cell Sci 2004; 117 (Pt 20): 4619–28. 34. Logan RM, Stringer AM, Bowen JM, Yeoh AS, Gibson RJ, Sonis ST et al. The role of pro-inflammatory cytokines in cancer treatment-induced alimentary tract mucositis: pathobiology, animal models and cytotoxic drugs. Cancer Treat Rev 2007; 33: 448–60. 35. Tobita T, Izumi K, Feinberg SE. Development of an in vitro model for radiation-induced effects on oral keratinocytes. Int J Oral Maxillofac Surg 2009; 39: 364–70. 36. Xu Q, Izumi K, Tobita T, Nakanishi Y, Feinberg SE. Constitutive release of cytokines by human oral keratinocytes in an organotypic culture. J Oral Maxillofac Surg 2009; 67: 1256– 64. 37. Nagase H. Activation mechanisms of matrix metalloproteinases. Biol Chem 1997; 378: 151–60. 38. Al-Dasooqi N, Gibson RJ, Bowen JM, Keefe DM. Matrix metalloproteinases: key regulators in the pathogenesis of chemotherapy-induced mucositis? Cancer Chemother Pharmacol 2009; 64: 1–9. 39. Sorsa T, Ding YL, Ingman T, Salo T, Westerlund U, Haapasalo M et al. Cellular source, activation and inhibition of dental plaque collagenase. J Clin Periodontol 1995; 22: 709–17. 40. Reddy MS, Geurs NC, Gunsolley JC. Periodontal host modulation with antiproteinase, anti-inflammatory, and bone-sparing agents. A systematic review. Ann Periodontol 2003; 8: 12– 37. 41. Wolff KD, Follmann M, Nast A. The diagnosis and treatment of oral cavity cancer. Dtsch Arztebl Int 2012; 109: 829–35.
889
Reprint requests: Dr. S. Küchler, Institute for Pharmacy, Pharmacology and Toxicology, Freie Universität Berlin, Königin-Luise-Str. 2-4, 14195 Berlin, Germany. Tel: +49 30 838 55065; Fax: +49 30 838 53944; Email: [email protected] Manuscript received: April 25, 2013 Accepted in final form: August 28, 2013 DOI:10.1111/wrr.12115
ABSTRACT Oral mucositis is a common side effect of chemotherapy and radiation therapy accompanied with acute inflammation and ulceration of the oral mucosa. Opioids can improve the wound healing of dermal and oral tissue when applied locally. The aim of this study was to investigate if morphine exhibits cytoprotective effects on oral epithelial cells postirradiation. Hence, oral epithelial cells were exposed to increasing doses (3–30 Gy) of ionization radiation. We assessed the effects of the radiation on cell viability, proinflammatory cytokine release (interleukin [IL]-1α, IL-6), and matrix metalloproteinase (MMP-1, -8, and -9) expression. As expected, radiation significantly impaired cell viability and morphology and resulted in enhanced IL release. However, morphine-treated cells consistently showed higher cell viability postirradiation: 9.19 ± 1.16% after 24 hours and 7.45 ± 0.93% after 48 hours compared with the control. In terms of proinflammatory cytokines, the release of IL-1α and IL-6 was significantly reduced, too, being most pronounced at 48 hours postradiation. Additionally, we observed a significant reduction of MMP-1 and especially MMP-9 expression in morphine-treated cells. The results clearly indicate antiinflammatory as well as cytoprotective effects of morphine on irradiated oral epithelial cells. Interestingly, the protective effects of morphine are not related to a decrease in cell apoptosis or necrosis. Before final conclusions can be drawn, further studies in more complex systems in vitro and in vivo are required. Nevertheless, these findings further underline the high potential of opioids for the treatment of topical wounds and inflammatory conditions.
Oral mucositis (OM) is a common side effect of chemotherapy and radiation therapy accompanied with acute inflammation and ulceration of the oral mucosa. OM is developing as a consequence of epithelial damage and cellular death triggered by complex series of molecular and cellular events.1 The occurrence rate of OM is dependent on the malign underlying disease and the therapy regimen. The prevalence exceeds 90% in patients undergoing hematopoietic stem cell transplantation or radiation therapy for the treatment of cancers of the mouth and/or the oropharynx.2,3 Dependent on the severity of the symptoms, the patient’s morbidity may be increased and even the cessation of the therapy might be required.4 The local damage after radiation involves a combination of inflammatory processes and alteration of cellular proliferation involving the release of proinflammatory cytokines, growth factors, and adhesion molecules.5 Furthermore, fibrinogenesis and angiogenesis are directly inhibited.6 Ionizing radiation causes reduced proliferation of fibroblasts, atypical cell migration, and abnormalities in collagen synthesis.7,8 Changes in the extracellular matrix composition impair the healing time of the wounded tissue.9,10 Often opioids are systemically applied for the management of OM-associated severe pain.11 However, this requires efficient balancing between pain reduction and the undesirable Wound Rep Reg (2013) 21 883–889 © 2013 by the Wound Healing Society
side effects such as nausea, vomiting, mental clouding, constipation, and sedation.12 Hence, local opioid application is widely discussed to overcome this obstacle. The rational basis for this approach is the expression of opioid receptors outside of the central nervous system on peripheral sensory neurons, tissues, and cells such as keratinocytes, fibroblasts (for review, see:12–15), and oral epithelial cells.16 The activation of peripheral opioid receptors induces potent analgesic effects 17,18 and facilitates the wound healing and reepithelialization of topical wounds by stimulating the cell migration14,19,20 as shown repeatedly in vitro and in vivo. Furthermore, a functional role of opioids in the context of inflammation is well known.14,17,18 Opioids can interfere at several stages with the inflammatory cascade, both in somatic and visceral inflammation.14,21 Furthermore, in primary afferent neurons, opioid receptor activity is enhanced under inflammatory conditions and peripheral opioid receptors are up-regulated.22 Just recently, we demonstrated that opioids significantly improve the cell migration of oral epithelial cells via activating specifically the delta opioid receptor.16 Based on those results, we aimed to elucidate if and how morphine affects the cell viability, the inflammatory response, cytokine release, the expression of matrix metalloproteinases (MMPs), and cell apoptosis of oral epithelial cells after being subjected to irradiation. 883
Cytoprotective effects of morphine
MATERIALS AND METHODS
Charbaji et al.
TR146 cells, a human buccal tumor cell line (Imperial Cancer Research Technology, London, United Kingdom) were maintained and cultured as described elsewhere.16
cultures were taken 24 hours postirradiation using an invert microscope. The morphological changes of the cells were analyzed semi-quantitatively using the automatic cell image analysis software (CellProfiler, Broad Institute, Harvard University, Boston, MA).This software allows for an automatic analysis of the cell shape and size (major and minor cell axis length).23
Cell irradiation protocol
Cell viability
For cell irradiation, 60 × 103 TR146 cells were seeded in 12-well culture plates. After 24 hours, the cells were irradiated with the dosages 0 Gy, 3 Gy, 8 Gy, 12 Gy, and 30 Gy using a 6 MeV photon beam at a medical linear accelerator (Varian Clinac 600 CD, Palo Alto, CA; field size 40 × 40 cm2). During irradiation, the cell culture plates were kept in a water-equivalent environment. Therefore, dose inhomogeneity in the medium was less than 5% (Figure 1). Nonirradiated cultures were kept at room temperature during irradiation. Afterward, the cells were incubated with morphine (100 nM) for 24 and 48 hours at 37 °C and 5% CO2. Morphine hydrochloride was purchased from Fagron (Barsbüttel, Germany) and dissolved in phosphate-buffered saline (pH 7.4) with 0.4% bovine serum albumin (SigmaAldrich, Munich, Germany). The control group was not subjected to morphine incubation.
Mitochondrial dehydrogenase activity was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) reduction test in order to assess cell viability. Twenty-four hours and 48 hours postradiation, 100 μL/well of MTT solution (5 mg/mL) was added, and the cells were incubated at 37 °C and 5% CO2 for 4 hours. The supernatants were removed, 1 mL of dimethyl sulfoxide was added to dissolve the blue formazan salt, and optical density was measured using the FLUOstar Optima (BMG Labtech, Ortenberg, Germany), setting the absorbance to 540 nm.
Cells and cell culture
Cell imaging
To investigate the morphological changes of irradiated cells with and without morphine treatment, pictures of the cell
Fluorescence-activated cell sorting (FACS) analysis
To identify necrotic and apoptotic cell populations, FACS was performed (FACSCalibur, Becton Dickinson, Heidelberg, Germany). Apoptosis was determined using fluorescein isothiocyanate (FITC)-labeled Annexin V (Enzo Life Sciences, Lörrach, Germany). Dye exclusion of the nonvital dye promodium iodide (PI) (Sigma-Aldrich) was measured simultaneously. Morphine-treated and untreated cells were trypsinized and washed twice with binding buffer (10 mM HEPES/NaOH, pH 7.4, 140 mM NaCl, 2.5 mM CaCl2). Subsequently, cells were resuspended in binding buffer, followed by the exposure to Annexin V-FITC (final concentration 0.5 mg/mL) for 10 minutes in the dark at room temperature. Then, PI was added (1 μg/mL), and samples were analyzed by bivariate flow cytometry. The cell populations were separated into four groups: The cells stained with Annexin V but not with PI were classified as early apoptotic cells (lower right quadrant). The cells positive for Annexin V and PI were classified as late apoptotic cells (upper right quadrant). The cells that were negative for Annexin V but positive for PI were classified as necrotic cells (upper left quadrant). The cells that were negative for both Annexin V and PI were classified as normal viable cells (lower left quadrant). Reverse transcription-polymerase chain reaction
Figure 1. Relative dose distribution calculated in a CT-slice of the cell irradiation setup. In the center of the phantom material, the well chambers filled with medium are visible. The isodose line (100%) indicates the nominal dose of 3, 8, 12, or 30 Gy, respectively. CT, computed tomography.
884
Total RNA was isolated using the NucleoSpin® RNA II kit (Macherey-Nagel, Düren, Germany) as described by the manufacturer’s protocol. cDNA was synthesized using the FermentasAid First strand cDNA synthesis kit (Fermentas GmbH, St. Leon-Rot, Germany). Subsequently, 2 μL cDNA was subjected to quantitative real-time polymerase chain reaction (RT-PCR) using the LightCycler480 and the SYBR Green I PCR Master Mix (Roche Applied Sciences, Mannheim, Germany). The thermal cycle profile used was denaturing for 10 seconds at 95 °C, annealing primers for 10 seconds at 60 °C, and extending the primers for 10 seconds at 72 °C. The PCR amplification was performed at 45 cycles while Wound Rep Reg (2013) 21 883–889 © 2013 by the Wound Healing Society
Charbaji et al.
Cytoprotective effects of morphine
Table 1. Primer sequences used in RT-PCR Target/reference gene IL-1α forward IL-1α reverse IL-6 forward IL-6 reverse MMP-1 forward MMP-1 reverse MMP-8 forward MMP-8 reverse MMP-9 forward MMP-9 reverse YWHAZ forward YWHAZ reverse
Primer sequences (5'→3')
bp
CGCCAATGACTCAGAGGAAGA AGGGCGTCATTCAGGATGAA CACAGACAGCCACTCACCTC TTTTCTGCCAGTGCCTCTTT GGGAGATCATCGGGACAACTC GGGCCTGGTTGAAAAGCAT CAACCTACTGGACCAAGCACAC TGTAGCTGAGGATGCCTTCTCC CCTGGAGACCTGAGAACCAATC CCACCCGAGTGTAACCATAGC AGACGGAAGGTGCTGAGAAA GAAGCATTGGGGATCAAGAA
120 137 72 128 79 127
bp, base pairs; RT-PCR, real-time polymerase chain reaction.
monitoring the fluorescence. Primer sequences are given in Table 1. The mRNA expression levels of each target gene are presented as a ratio to the housekeeping gene YWHAZ. PCR product sizes were checked using a 2% agarose gel.
diation. Exemplary data are depicted in Table 2. Morphinetreated cells showed a tendency toward a smaller increase in size (Table 2). Cell viability
Interleukin (IL) release
The concentrations of the proinflammatory cytokines IL-1α and IL-6 were measured in the cell culture media 24 and 48 hours postradiation. Cytokine concentrations were determined using enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, MN) in accordance to the manufacturer’s protocol. Contents of the samples were calculated according to the standard curve, and the results are given in pg/mL.
MTT assay showed a significant decrease of cell viability after irradiation, which correlated well with the radiation
Statistics
All values (of at least three independent experiments) are expressed as mean ± standard deviation (SD). For statistical comparison of the untreated and morphine-treated cells, the paired t test was performed. *p ≤ 0.05 indicates statistical significance.
RESULTS Cell morphology
Clearly, dose-dependent changes of the cell morphology have been observed. Twelve gray irradiation induced a significant reduction of the cell colony formation (Figure 2). Irradiating the cells with 30 Gy induced drastic effects on the cell structure. The cells change to a flatter, unclear shape, and the cell colonies became significantly smaller. Morphine-treated cells seem to be more capable of forming larger colonies compared with the cells without morphine treatment and were capable of maintaining their original cell shape (Figure 2). Data evaluation using the cell image analysis software showed an increase of the major and minor cell axis lengths upon irraWound Rep Reg (2013) 21 883–889 © 2013 by the Wound Healing Society
Figure 2. Cell morphology of TR146 cells 24 hours postradiation with and without morphine treatment. The number of cells decreased with increasing radiation dosage. Cell morphology changed from defined cell structures to a larger, undefined, stretched, and irregular shape without morphine treatment. Scale bar 50 μm, magnification 100 ×. Morphinetreated cultures show higher cell counts.
885
Cytoprotective effects of morphine
Charbaji et al.
Table 2. Exemplary values of the major and minor axis length of irradiated cells with or without morphine treatment analyzed by the CellProfiler
0 Gy 0 Gy + Morphine 100 nM 3 Gy 3 Gy + Morphine 100 nM 30 Gy 30 Gy + Morphine 100 nM
Major axis length (mean ± SD)
Minor axis length (mean ± SD)
27.17 ± 9.45 30.87 ± 11.47 35.48 ± 15.64 27.85 ± 9.08 50.86 ± 18.41 40.44 ± 18.31
14.66 ± 4.95 14.57 ± 5.22 16.93 ± 5.71 14.93 ± 5.00 19.76 ± 7.22 15.64 ± 4.78
SD, standard deviation.
postirradiation were 90% (0 Gy), 88% (3 Gy), 87% (8 Gy), 84% (12 Gy), and 86% (30 Gy) for the cells without morphine treatment and 93% (0 Gy), 87% (3 Gy), 86% (8 Gy), 85% (12 Gy), and 86% (30 Gy) for the morphine-treated cells (data not shown). Although the percentage of viable cells decreased with increasing radiation dosage, the obtained results failed to be statistically significant. No effect of morphine was observed. Gene expression and release of the proinflammatory cytokines IL-1α and IL-6
Gene expression and cytokine release of IL-1α and IL-6 were evaluated after irradiation of the cells using quantitative RT-PCR and ELISA. Only IL-6 mRNA expression was up-regulated in response to the radiation; no effects were seen for IL-1α (Figure 4). After 48 hours, IL-6 mRNA expression was increased by 1.9-, 3-, and 4.3-fold as a result of irradiation with 3, 8, and 12 Gy, respectively (Figure 4). Morphine significantly reduced the radiation-induced up-regulation of IL-6 expression (p ≤ 0.05; Figure 4). In terms of cytokine release, a dose-dependent increase in IL-6 was detected after 24 hours and even more pronounced after 48 hours, whereas morphine-treated cells showed significantly reduced IL-6 levels (Figure 5). Similar results were obtained for IL-1α. However, increased release of the cytokine was only detected after 48 hours (Figure 5). Surprisingly, on the mRNA level, only minor effects on IL-1α expression were found. For nonirradiated cells, no differences
Figure 3. Cell viability decreased dose-dependently following irradiation of the cells. Morphine-treated cells showed higher cell viability compared with nontreated cells undergoing irradiation. Nonirradiated oral epithelial cells served as control. Mean ± SD, n = 3; * indicates statistically significant differences at p ≤ 0.05. SD, standard deviation.
dosage. Twenty-four hours postradiation, a significant reduction of cell viability of the cells irradiated with 12 Gy (75% viability left) was detected. For the morphine-treated cells, we measured a cell viability of 87% (Figure 3). Twenty-four hours after 30 Gy radiation, again the cell viability was significantly higher in the morphine-treated cells (60%) compared with the untreated cells (49%) (Figure 3). Similar results were obtained 48 hours postradiation. In general, morphine exposure consistently resulted in higher cell viabilities: 9.19 ± 1.16% after 24 hours and 7.45 ± 0.93% after 48 hours (mean values ± SD, regardless of the applied dosage). The effect was most pronounced at higher radiation dosages. Apoptosis/necrosis
To investigate the underlying mechanism of the reduced cell viability and to clarify if morphine exhibits its protective effects by interference with apoptosis or necrosis, FACS analysis was performed. After irradiating the oral epithelial cells, we used PI/Annexin V double staining to detect apoptotic and necrotic cells. The percentage of unstained cells (for both PI and Annexin V) representing viable cells 48 hours 886
Figure 4. Regulation of mRNA expression of the proinflammatory cytokines IL-1α and IL-6. TR146 cells were irradiated with a single dose of photon beam and subsequently incubated with 100 nM morphine for 24 or 48 hours, respectively. The data were normalized to the housekeeping gene YWHAZ. Mean ± SD, n = 3; * indicates statistically significant differences at p ≤ 0.05. IL, interleukin; SD, standard deviation. Wound Rep Reg (2013) 21 883–889 © 2013 by the Wound Healing Society
Charbaji et al.
Figure 5. IL-1α and IL-6 release of TR146 cells after irradiation. Incubation with 100 nM morphine resulted in a significant reduction of radiation-induced IL-1α and IL-6 release. The data were normalized to the housekeeping gene YWHAZ. Mean ± SD, n = 3; * indicates statistically significant differences at p ≤ 0.05. IL, interleukin; SD, standard deviation.
in gene expression and IL release were detected between morphine-treated and nontreated cells.
Cytoprotective effects of morphine
significantly—from complex biological events.24–26 Radiation therapy can activate a number of transcription factors. As a result, the expression of several genes is altered including those controlling the production of proinflammatory cytokines such as IL-1α, IL-6, and IL-8. Furthermore, in addition to the damage to the connective tissue, MMP such as MMP-1, -8, and -9 are activated.1,25,27 Just recently, we demonstrated that oral epithelial cells, TR146, and primary human oral keratinocytes express the three opioid receptors and that morphine facilitates the cell migration of these cells by activation of specifically the delta opioid receptor.16 Based on these findings, we now investigated whether the topical application of morphine postradiation has beneficial effects not only on cell migration and wound closure but also on the inflammatory cascade and the activation of MMPs. We opted for morphine as the representative substance for opioids as it was previously shown that μ-agonistic opioids give identical results.20 In this study, we used the oral epithelial cell line TR146, which despite being isolated from a squamous cell carcinoma of the buccal mucosa expresses all major markers of the epithelial basal membrane and of epithelial differentiation.28 We subjected the TR146 cells to different single doses of ionization radiation (3–30 Gy) that allowed us to investigate the effects of radiation from mild to very intensive treatment.29 Irradiating TR146 cells resulted in a significant morphological change of the cell shape (Figure 2) and a dosedependent reduction of cell viability (Figure 3). This was expected as after radiation, the DNA double strand breaks, and the antiproliferative effects of ionization radiation come into effect.30 The oral epithelial cells treated with morphine (100 nM) postirradiation showed significantly higher cell viabilities compared with the control cells (Figure 3). This is
Expression of MMP-1, MMP-8, and MMP-9
The gene expression of MMP-1, -8, and -9 and their regulation upon morphine treatment were investigated too. MMP-8 mRNA expression was not detected in TR146 cells either irradiated or nonirradiated (data not shown). MMP-9 was expressed only in traces in nonirradiated TR146 cells. The expression level was up-regulated 11-, 15-, and 20-fold 48 hours postirradiation for 8, 12, and 30 Gy, respectively (Figure 6). MMP-1 mRNA expression increased in TR146 cells in response to the radiation in a dose-dependent manner too. Forty-eight hours postirradiation, 3.7-, 4.3-, and 5.5-fold induction with 8, 12, and 30 Gy were detected, respectively (Figure 6). Applying 100 nM morphine postirradiation significantly reduced the radiation-induced up-regulation of the MMPs. The expression of MMP-9 was suppressed most effectively (Figure 6).
DISCUSSION For decades, the pathophysiology of OM was thought to be based only on the premise that cytotoxic therapies or irradiation target and damage the rapidly dividing cells of the oral epithelium. However, this concept has changed over the past years and is now replaced by the knowledge that OM results not only from direct cell injury but also—and even more Wound Rep Reg (2013) 21 883–889 © 2013 by the Wound Healing Society
Figure 6. Relative mRNA expression of MMP-1 and MMP-9 in TR146 cells after irradiation and subsequent incubation with or without 100 nM morphine for 24 or 48 hours, respectively. The data were normalized to the housekeeping gene YWHAZ. Mean ± SD, n = 3; * indicates statistically significant differences at p ≤ 0.05. MMP, matrix metalloproteinase; SD, standard deviation.
887
Cytoprotective effects of morphine
well in accordance with other studies describing that topically applied opioids modulate cellular proliferation and survival.31 Additionally, one recent publication of our group demonstrated that local application of morphine up-regulates Erk 1/2 MAPK in oral epithelial cells,16 which is crucial for the regulation of cell proliferation, differentiation, and meiosis.32,33 To elucidate potential anti-inflammatory effects of morphine postirradiation, the release of IL-1α and IL-6 was quantified. IL-1α plays a central role in the activation of keratinocytes that initiates the inflammatory process. IL-6 has a broad range of biological activities and is particularly involved in the immune response and the pathogenesis of many inflammatory diseases34 including OM.1 It has been shown that these proinflammatory cytokines are capable of further activation of transcription factors mainly contributing to the development of OM.26,34 In this study, significant increases of IL-1α and IL-6 release were detected postirradiation even at the lowest radiation dosage 3 Gy. These findings were expected and are well in accordance with other studies,35 although this group only tested doses up to 8 Gy. Morphine treatment postradiation successfully reduced these effects (Figure 5). The low release of IL-1α after 30 Gy irradiation is most likely due to the very low number of viable cells (45% cell viability) after this very high dosage as the amount of released cytokines directly correlates with the number of viable cells.36 Surprisingly, on the mRNA level, no regulation of IL-1α was detected (Figure 4), which might be due to the fact that the selected time points were not optimal for this cytokine, especially as we saw a significant increase in IL-1α release. Next, the expression of MMP-1, -8, and -9 was examined on the mRNA level postradiation. MMPs are mostly present in a nonactive form and are activated via a “cysteine switch.”37 These enzymes trigger injury within the tissue of the submucosa and disrupt the integrity between the epithelium and the basal membrane.1 They are also involved in the pathogenesis of multiple other inflammatory oral diseases. The role of MMP-1, MMP-8, and MMP-9 in OM is described in detail elsewhere,38,39 although as for today the exact role of MMPs is not understood completely. However, evidence is growing that the up-regulation of these endopeptidases mainly contributes and maintains the tissue damage in OM.38 Furthermore, up-regulation of MMP-9 seems to be directly related to a dysregulation of cell proliferation and differentiation and is involved in general damage onset.38 Interestingly, in our study, morphine treatment postirradiation suppressed MMP-9 expression most effectively. It is suggested that the downregulation of the pathologically elevated MMPs might be an option to avoid or limit the tissue destruction.40 Additionally, because of the effective suppression of MMPs, detrimental effects of the radiation on the epithelial lining might be reduced. Aside from its beneficial effects on IL release and MMP regulation, irradiation of the cells and subsequent morphine treatment only exhibited minor effects on cell apoptosis and necrosis. No significant differences in terms of apoptotic/ necrotic cell populations were found between morphinetreated and nontreated cells, clearly indicating that morphine does not interfere with this pathway. These findings substantiate the idea that morphine treatment may stimulate the cells’ proliferation, resulting in higher cell viabilities postirradiation. However, in one of our previously published studies, we did not see a proliferation-stimulating effect of morphine on 888
Charbaji et al.
oral epithelial cells.16 Nevertheless, such effects were described repeatedly by other groups.13,14,31 Because of these contradictory findings, no final conclusion can be drawn, and the underlying mechanism of the protective effects of morphine is still ambiguous. In clinical practice, irradiation regimens and dosages are adjusted to the underlying malign disease. For example, guidelines published by the Committee of the Scientific Medical Societies (Germany) recommend a total dose of 70 Gy applied as 1.8–2 Gy single doses, respectively, for the treatment of oral cancer.41 In our study, we did not perform repeated irradiation, but morphine exhibited sound antiinflammatory and cytoprotective effects already following single doses comparable with normal and high single dose irradiations. Future studies will be performed to investigate the impact of morphine after repeated irradiation, which mimics the clinical situation better. In conclusion, for the first time, we were able to show that morphine exhibits protective and anti-inflammatory effects on oral epithelial cells postradiation and that the up-regulation of MMPs can be suppressed efficiently. Taken together with previous findings such as facilitated cell migration, wound closure, and pain relief, local opioid treatment postradiation might be a new therapeutic approach to reduce the occurrence and severity of OM. Simultaneously, symptoms such as severe pain might be alleviated. Although further studies in more complex 3D in vitro tissues as well as animal studies are required, this study once more underlines the high potential of opioids for the topical treatment of wounds.
ACKNOWLEDGMENT Source of Funding: This work was partly supported by the European Funding for Regional Development (EFRE) project 20072013 2/08. Conflicts of Interest: The authors of this paper declare no conflict of interest.
REFERENCES 1. Sonis ST. Pathobiology of oral mucositis: novel insights and opportunities. J Support Oncol 2007; 5 (9 Suppl. 4): 3–11. 2. Silvermann S, Jr. Diagnosis and management of oral mucositis. J Support Oncol 2007; 5 (2 Suppl. 1): 13–21. 3. Bellm LA, Epstein JB, Rose-Ped A, Martin P, Fuchs HJ. Patient reports of complications of bone marrow transplantation. Support Care Cancer 2000; 8: 33–9. 4. Trotti A, Bellm LA, Epstein JB, Frame D, Fuchs HJ, Gwede CK et al. Mucositis incidence, severity and associated outcomes in patients with head and neck cancer receiving radiotherapy with or without chemotherapy: a systematic literature review. Radiother Oncol 2003; 66: 253–62. 5. Muller K, Meineke V. Radiation-induced alterations in cytokine production by skin cells. Exp Hematol 2007; 35 (4 Suppl. 1): 96–104. 6. Hall EJ, Astor M, Bedford J, Borek C, Curtis SB, Fry M et al. Basic radiobiology. Am J Clin Oncol 1988; 11: 220–52. 7. De Loecker W, Van der Schueren E, Stas ML, Doms D. The effects of x-irradiation on collagen metabolism in rat skin. Int J Radiat Biol Relat Stud Phys Chem Med 1976; 29: 351–8. Wound Rep Reg (2013) 21 883–889 © 2013 by the Wound Healing Society
Charbaji et al.
8. Rudolph R, Vande Berg J, Schneider JA, Fisher JC, Poolman WL. Slowed growth of cultured fibroblasts from human radiation wounds. Plast Reconstr Surg 1988; 82: 669–77. 9. Gorodetsky R, Mou XD, Fisher DR, Taylor JM, Withers HR. Radiation effect in mouse skin: dose fractionation and wound healing. Int J Radiat Oncol Biol Phys 1990; 18: 1077–81. 10. Goldschmidt H, Sherwin WK. Reactions to ionizing radiation. J Am Acad Dermatol 1980; 3: 551–79. 11. Eilers J, Million R. Clinical update: prevention and management of oral mucositis in patients with cancer. Semin Oncol Nurs 2011; 27: e1–16. 12. Stein C. Opioid receptors on peripheral sensory neurons. Adv Exp Med Biol 2003; 521: 69–76. 13. Rachinger-Adam B, Conzen P, Azad SC. Pharmacology of peripheral opioid receptors. Curr Opin Anaesthesiol 2011; 24: 408–13. 14. Stein C, Küchler S. Non-analgesic effects of opioids: peripheral opioid effects on inflammation and wound healing. Curr Pharm Des 2012; 18: 6053–69. 15. Bigliardi-Qi M, Sumanovski LT, Buchner S, Rufli T, Bigliardi PL. Mu-opiate receptor and beta-endorphin expression in nerve endings and keratinocytes in human skin. Dermatology 2004; 209: 183–9. 16. Charbaji N, Schäfer-Korting M, Küchler S. Morphine stimulates cell migration of oral epithelial cells by delta-opioid receptor activation. PLoS ONE 2012; 7: e42616. 17. Stein C, Hassan AH, Przewlocki R, Gramsch C, Peter K, Herz A. Opioids from immunocytes interact with receptors on sensory nerves to inhibit nociception in inflammation. Proc Natl Acad Sci U S A 1990; 87: 5935–9. 18. Schäfer M, Imai Y, Uhl GR, Stein C. Inflammation enhances peripheral mu-opioid receptor-mediated analgesia, but not mu-opioid receptor transcription in dorsal root ganglia. Eur J Pharmacol 1995; 279: 165–9. 19. Küchler S, Wolf NB, Heilmann S, Weindl G, Helfmann J, Yahya MM et al. 3D-wound healing model: influence of morphine and solid lipid nanoparticles. J Biotechnol 2010; 148: 24–30. 20. Wolf NB, Küchler S, Radowski MR, Blaschke T, Kramer KD, Weindl G et al. Influences of opioids and nanoparticles on in vitro wound healing models. Eur J Pharm Biopharm 2009; 73: 34–42. 21. Tegeder I, Geisslinger G. Opioids as modulators of cell death and survival—unraveling mechanisms and revealing new indications. Pharmacol Rev 2004; 56: 351–69. 22. Stein C, Lang LJ. Peripheral mechanisms of opioid analgesia. Curr Opin Pharmacol 2009; 9: 3–8. 23. Carpenter AE, Jones TR, Lamprecht MR, Clarke C, Kang IH, Friman O et al. CellProfiler: image analysis software for identifying and quantifying cell phenotypes. Genome Biol 2006; 7: R100. 24. Feller L, Essop R, Wood NH, Khammissa RA, Chikte UM, Meyerov R et al. Chemotherapy- and radiotherapy-induced oral mucositis: pathobiology, epidemiology and management. SADJ 2010; 65: 372–4.
Wound Rep Reg (2013) 21 883–889 © 2013 by the Wound Healing Society
Cytoprotective effects of morphine
25. Sonis S. The quest for effective treatments of mucositis. J Support Oncol 2011; 9: 170–1. 26. Sonis ST. The pathobiology of mucositis. Nat Rev Cancer 2004; 4: 277–84. 27. Scully C, Epstein J, Sonis S. Oral mucositis: a challenging complication of radiotherapy, chemotherapy, and radiochemotherapy: part 1, pathogenesis and prophylaxis of mucositis. Head Neck 2003; 25: 1057–70. 28. Rupniak HT, Rowlatt C, Lane EB, Steele JG, Trejdosiewicz LK, Laskiewicz B et al. Characteristics of four new human cell lines derived from squamous cell carcinomas of the head and neck. J Natl Cancer Inst 1985; 75: 621–35. 29. Branchi R, Fancelli V, De Salvador A, Giovannoni A. Cancer of the head and neck: general principles of radiobiology, radiotherapy and chemotherapy. Radiation damage. Minerva Stomatol 2003; 52: 411–9, 20–5. 30. Selzer E, Hebar A. Basic principles of molecular effects of irradiation. Wien Med Wochenschr 2012; 162: 47–54. 31. Chen YL, Law PY, Loh HH. The other side of the opioid story: modulation of cell growth and survival signaling. Curr Med Chem 2008; 15: 772–8. 32. Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, Berman K et al. Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr Rev 2001; 22: 153–83. 33. Huang C, Jacobson K, Schaller MD. MAP kinases and cell migration. J Cell Sci 2004; 117 (Pt 20): 4619–28. 34. Logan RM, Stringer AM, Bowen JM, Yeoh AS, Gibson RJ, Sonis ST et al. The role of pro-inflammatory cytokines in cancer treatment-induced alimentary tract mucositis: pathobiology, animal models and cytotoxic drugs. Cancer Treat Rev 2007; 33: 448–60. 35. Tobita T, Izumi K, Feinberg SE. Development of an in vitro model for radiation-induced effects on oral keratinocytes. Int J Oral Maxillofac Surg 2009; 39: 364–70. 36. Xu Q, Izumi K, Tobita T, Nakanishi Y, Feinberg SE. Constitutive release of cytokines by human oral keratinocytes in an organotypic culture. J Oral Maxillofac Surg 2009; 67: 1256– 64. 37. Nagase H. Activation mechanisms of matrix metalloproteinases. Biol Chem 1997; 378: 151–60. 38. Al-Dasooqi N, Gibson RJ, Bowen JM, Keefe DM. Matrix metalloproteinases: key regulators in the pathogenesis of chemotherapy-induced mucositis? Cancer Chemother Pharmacol 2009; 64: 1–9. 39. Sorsa T, Ding YL, Ingman T, Salo T, Westerlund U, Haapasalo M et al. Cellular source, activation and inhibition of dental plaque collagenase. J Clin Periodontol 1995; 22: 709–17. 40. Reddy MS, Geurs NC, Gunsolley JC. Periodontal host modulation with antiproteinase, anti-inflammatory, and bone-sparing agents. A systematic review. Ann Periodontol 2003; 8: 12– 37. 41. Wolff KD, Follmann M, Nast A. The diagnosis and treatment of oral cavity cancer. Dtsch Arztebl Int 2012; 109: 829–35.
889
