217
Mutation Research, 263 (1991) 217-222 © 1991 Elsevier Science Publishers B.V. 0165-7992/91/$ 03.50 ADONIS 016579929100066S MUTLET 0513
Damage distribution and mutation spectrum: the case of 8-methoxypsoralen plus UVA in mammalian cells E v e l y n e Sage I a n d A n d e r s B r e d b e r g 2 I CNRS URA 1292, Institut Curie, Section de Biologie, F-75231 Paris Cedex 05 (France) and 2Department of Medical Biology, University of Lund, General Hospital, S-214 01 Maim6 (Sweden) (Received 18 March 1991) (Revision received 27 March 1991) (Accepted 28 March 199 I)
Keywords: Damage distribution; Mutation spectrum; Furocoumarins
Summary We determined the distribution of monoadducts and biadducts induced in the supFtRNA gene carried by the shuttle vector pZ189, after exposure to 8-methoxypsoralen (8-MOP) plus a double UVA (365 nm) irradiation. These data were compared to our previously published 8-MOP-photoinduced mutation spectrum obtained after propagation of the damaged shuttle vector in mammalian cells. One mutational hot spot in an ATAT/TATA sequence is targeted at a hot spot of biaddition. A second hot spot is not related to the presence of photoadducts either at or near the site. Moreover, it is located in a sequence which can be defined as 'mutation-prone'. Mutations occurring at GC base pairs are not targeted at sites of photoaddition, and may result from a decrease in fidelity of DNA polymerase when copying the damaged vector.
Furocoumarins photoreact with DNA by cycloaddition to pyrimidines (mainly thymine), which induces monoadducts, biadducts which yield interstrand crosslinks, and ultimately mutations (Ben-Hur and Song, 1984). Since these compounds are widely used in the treatment of various dermatological disorders, it is important to understand the basis for their mutagenic potential. This motivated a recent study which characterized the Correspondence: Evelyne Sage, Institut Curie-Biologie, CNRS URA 1292, 26 rue d'Ulm, F-75231 Paris Cedex 05 (France).
DNA sequence alterations induced by a furocoumarin derivative, 8-methoxypsoralen (8-MOP), in mammalian cells. The genetic target used was the supF tRNA gene of Escherichia coli carried on the extrachromosomal shuttle vector pZ189. This investigation shed light on the respective roles of mono- and bi-adducts in 8-MOP-induced mutagenesis. Here we expand this analysis by characterizing the spectrum of 8-MOP-induced damage in the same target gene, and discuss the correlation between mono- and bi-adducts, and mutations.
218
Material and methods
The photoreaction of plasmid pZ189 with 8 - M O P (product of Sigma Chemical Co.) was as described by Bredberg and Nachmansson (1987). Briefly, pZ189 (50 #g/ml) was exposed to 8-MOP (20/~g/ml) for 30 min in the dark, then UVA (365 nm) irradiated at a fluence of 0.55 k J / m 2, which induces mainly monoadducts. Unreacted 8-MOP was eliminated and the DNA reirradiated at a fluence of 33 k J / m 2 in order to convert a fraction of monoadducts to interstrand crosslinks. Untreated D N A or D N A exposed to 33 k J / m 2 UVA served as control. Treated or untreated plasmid D N A was double-restricted and 32p 5 '-end-labeled at the EcoRI site (top strand) or XholI site (bottom strand). Photoadducts were revealed as termination sites after digestion of the DNA with 4.5 units of T4 D N A polymerase 3 ' - 5 ' exonuclease, in the absence of d N T P (Sage and Moustacchi, 1987), followed by electrophoresis of digested products on sequencing gels alongside a M a x a m & Gilbert ladder. The photoreversion of crosslinks by UVC before running digested samples on the gel allowed the detection of all sites of photoadducts, i.e., monoadducts plus biadducts (Sage and Moustacchi, 1987). In the absence of the photoreversion of crosslinks only sites of monoadducts were revealed, since crosslinked molecules migrate as doublestranded DNA. The frequency of photolesions at each site was calculated after counting the radioactivity in gel slices corresponding to bands on an autoradiogram. The photoadduct frequencies in Fig. 1 were derived from the mean values of three experiments. Results
The shuttle vector pZ189 was exposed to 8-MOP plus double UVA irradiation, passaged through Veto or Raji cells, and the mutation spectrum in the target supF t R N A gene was determined (Bredberg and Nachmansson, 1987). In order to better understand the mechanisms that transform 8-MOP-induced D N A damage into stable mutations, the photoadduct distribution in the target
gene was determined. We took advantage o| blockage of the 3 ' - 5 ' exonuclease associated with T4 D N A polymerase by furocoumarin biadducts as well as monoadducts (Sage and Moustacchi, 1987; Boyer et al., 1988). Fig. I shows the photoadduct distribution on plasmid DNA which received 2 UVA doses after dark exposure to 8-MOP. (DNA treated in the same manner was shuttled in cells to determine the mutation spectrum.) The number ol photoadducts per DNA fragment was about 0.11 for the upper strand (EcoRI-Sau3A1) and 0.16 for the lower strand (XhoII-EcoRI) as estimated according to a Poisson distribution. The sites and frequencies of 8-MOP photobinding are in good agreement with our previous data (Sage and Moustacchi, 1987). 8-MOP photoreacts mainly with T in 5 ' - T p A . As expected, the repeated AT site, i.e., A T A T / T A T A , is a hot spot for photoadduct formation in supF and mainly interstrand crosslinks are formed. All 5 ' - T p A sites reacted, whereas 5 ' - A P T and runs of T were unreactive. The previously published mutation spectrum is also shown in Fig. 1. In addition a number of mutants characterized after the initial study are included. From the comparison between mutation and photoaddition spectra, 3 main observations can be made. (1) One of the 2 mutation hot spots correlates with the unique hot spot for photoadducts (mainly interstrand crosslinks). This site is located at the Pribnow box of the gene. (2) One mutation at position 135 arises at a site where photoadducts (mainly monoadducts) occur. (3) The other mutational hot spot does not correlate with the presence of any photoadduct at or near the site. In general, the correlation between mutation sites and sites of photoaddition is rather poor. Most 8-MOP photobinding arises in the pre-tRNA or regulatory region of the gene. Discussion
Biadducts are more mutagenic than monoadducts A second high UVA dose which transforms furan-side monoadducts located in a 5 ' - T p A context in interstrand crosslinks is a prerequisite for the severalfold increase in the mutation frequency
219 -35 region
I
Prlbnow box
I
IA
i
A
O|
pre-tRNA
I
!
[]
A
o.
o=
C6T ARC AC'I-rTACAG CGGC8CGT CATTT GAT A I G A T 6C GCCCC 8CI-ICC CGATA AGGGA GCAGGCCAGTA A A A OC GCATT6T6AAATBTCGCC6CBCA[~TAAACTATACTACG CGGGGCGAAGGGCTATTCCCTCGTCCG6 TCAT-fTTCG
begin tRNA I
ol
[]
0.
G
~
®
[]
®A
ArrACC(:6r611T606Orr CI:t:GA6C66CCAAA666A6CA6ACTCTAAA'rCT6tCGTCA'rC6ACTTC6AA66 "TAAT6G GC ACC,AC CC CA A66fiCTC 6C CG 6TT-r CC CT C6 T CT 6AG6T'I-r AGACGGCAGTAGCT 6AA GC'I-I'CC |o ,~ 6o -N ° ,;o ,,o T T
r
C TT T TTC 6AATC cl-rC CCCC ACCAC CA AA EiCTT AG GAA 6G 6G 6IGGTG 6T Fig. 1.8-MOP-induced photoadduct distribution and mutation spectrum in the supF t R N A gene o f E. coli. The D N A was exposed to 20 #g/ml of 8-MOP, received a first U V A dose of 0.55 kJ / m 2 and was reirradiated at a dose o f 33 kJ/ m z (see detailed protocol in
Material and Methods). Full bars represent sites and frequencies of biadducts, dotted bars represent sites and frequencies of monoadducts.
induced by 8-MOP plus a first UVA exposure in pZ189 (Bredberg and Nachmansson, 1987). This emphasized the fact that mutations were mainly due to biadducts. Determination of the frequency o f both types of photoadducts in the supF target confirms this hypothesis. The hot spot at A T A T is correlated with the presence of biadducts. Nevertheless, the single mutation at position 135 indicates that monoadducts are also potentially mutagenic lesions. The more potent mutagenicity o f biadducts as compared to monoadducts is not limited to the shuttle vector system, indeed it is observed in a variety of cells (Sladek et al., 1989; Cassier et al., 1984; Papadopoulo and Averbeck, 1985; Papadopoulo and Moustacchi, 1990). Monoadducts are believed to be repaired by a relatively error-free process (Vos and Hanawalt, 1987). This suggests tolerance of the unrepaired monoadducts over generations, perhaps as a result o f bypass by DNA polymerase during replication or repair. Monoadducts have been shown to be bypassed by DNA polymerase I of E. coil in an in
vitro nick-translation assay, but not when located in a single-stranded DNA template (Piette and Hearst, 1983). Bypass of monoadducts has also been reported in yeast (Chanet et al., 1985). Furthermore, it may be that in many cases, depending on the sequence context, the polymerase inserts an A opposite the monoadducted T, in a similar manner to T < > T cyclobutanepyrimidine dimers induced by 254-nm UVC light as emphasized by Brash et al. (1987). In contrast, interstrand crosslinks constitute an absolute block for DNA polymerase, and may therefore be repaired in an error-prone manner.
Mutations at most o f the sites of photoadduct formation would not inactivate supF function Most of the sites of photoadducts are located in the pre-tRNA gene or in the regulatory region. According to Kraemer and Seidman (1989), mutated supF genes have been recovered at only a few positions in that region, and except for the Pribnow box, none has been found at sites of 8-MOP
220
photoadducts. Photoadducts in this region may lead to silent changes, or may not give rise to mutation because of insertion of the correct base opposite the lesion. In view of the sequence specificity of the photoreaction.of 8-MOP with DNA, it was hypothesized that the T A T A box would constitute an excellent target for 8-MOP photoaddition and consequently for 8-MOP-induced mutation (Sage and Moustacchi, 1987; Bredberg and Nachmansson, 1987). This finds confirmation here. The sequence of the supF tRNA gene is not a good target for furocoumarins, even though it contains many T. The only 5 ' - T p A site of the gene is hit, and this correlates well with mutation at position 135 located in the anticodon of the tRNA. Mainly monoadducts are formed in this AT-rich sequence, but one cannot exclude that mutation is due to biadducts induced at a low frequency. Targeted mutations at A T base pairs As already mentioned, the mutational hot spot at position 45-46 of the A T A T / T A T A Site correlates well with the presence of biadducts involving the 2 mutated T, which lead to interstrand crosslinks. Little is known about the mechanisms that produce mutations from psoralen-induced crosslinks in mammalian cells. Repair of crosslinks is a multistep process. Several of these steps have been elucidated in E. coli in the past few years (Cole et al., 1978; Van Houten et al., 1986; Cheng et al., 1988; Sladek et al., 1989a,b). Included sequentially are incision by UvrABC endonuclease, digestion by the 5' exonuclease of DNA polymerase I, homologous recombination by RecA involving strand exchange and DNA repair synthesis, excision of the crosslink, a second step of repair synthesis and finally ligation. More importantly, Sladek et al. (1989b) demonstrated that in SOSinduced cells, UvrABC incision is an obligatory step for mutagenesis by psoralen crosslinks, and that homologous recombination reduces the yield o f point mutations. In our system, recombination between shuttle vector molecules at the site of biadducts is unlikely, since it would require a break in the input DNA at the target sequence. Moreover, intermolecular recombination between substrates
similar to pZ189 transfected in mammalian cells has been shown to be mainly non-conservative (Seidman, 1987). Thus, the observed point mutations are likely to occur after the incision step, by misincorporation at the level of DNA polymerase readthrough, a process that would normally compete with recombinational repair (Sladek et al., 1989). Furthermore it seems that the polymerase(s) does not insert the same nucleotide when copying the leading strand or the lagging strand (T--,A transversions on the leading strand, mainly T--,C transitions on the lagging strand, see mutations at positions 45, 46 and 135). This may also be due to the positioning of the psoralen molecule in the double helix and preferential incision of the furan side or pyrone side of the biadduct. These observations lead to the suggestion that in mammalian cells there is a pathway for the repair of psoralen crosslinks independent of recombination, which may consist of mutagenic (error-prone) gap filling by DNA polymerases. This repair pathway may be the main process operating on episomal DNA, since the removal of crosslinks is considerably lower in episomal plasmid as compared to genomic DNA in human cells (Dean, 1989). Mutations at GC base pairs A number of mutations arise at GC base pairs (Table 1), as in the mutation spectra induced by angelicin and 8-MOP plus UVA in the lacI gene of E. coli (Yatagai and Glickman, 1986; Miller and Eisenstadt, 1987; Yatagai et al., 1987). From Fig. 1, these base substitution events are not
TABLE 1 PUVA-1NDUCED
POINT
MUTATIONS
IN THE
GENE Transitions
TA~CG CG~TA
3 10
Transversions
GC~CG GC-'TA TA-'AT TA~GC
4 4 3 0
Deletion
AT base pair
1
supF
221 targeted at sites of photoadducts, and are also unlikely to reflect less prevalent adducts. Photoadducts at C positions are rare and occur mainly in CA or AC sequences (Boyer et al., 1988). Could other types of cryptic damage constitute premutagenic lesions? Some furocoumarins have the potential to induce photooxidative lesions in DNA at G positions, via a type I mechanism (G radical) or a type II mechanism (singlet oxygen) (Sage et al., 1989). These DNA lesions lead to sites sensitive to hot alkali and to DNA repair enzymes recognizing oxidative damage. Nevertheless, in vitro, 8-MOP does not induce such photooxidation (Sage et al., 1989). It is not likely that mutations at GC base pairs are targeted at such photolesions induced by 8-MOP. Some of these base substitutions are also recovered spontaneously and after UV or some other damaging agents, e.g., positions 43 and 164. One possibility is that activated oxygen species produced by normal cellular metabolism damage the shuttle vector during transport into the nucleus. Another possible explanation for the presence of these mutations at GC base pairs is a decreased fidelity of the DNA polymerases during the repair synthesis of psoralen photoadducts (Yatagai and Glickman, 1986). The presence of a number of double mutations (Fig. 1) favors this hypothesis (Seidman et al., 1987). Mutation hot spot at T C C T T C C C C C is "untargeted" This mutation hot spot induced by 8-MOP plus UVA cannot be explained by the presence of a photoadduct at or near that sequence. This sequence is of particular interest since mutational hot spots also arise at that site, spontaneously or after treatment of pZ189 by UVC (254 nm), H202, acetylaminofluorene (AAF) and to a lesser extent by benzo[a]pyrenediolepoxide (BPDE), 1-nitrosopyrene (NOP), UVB (313 nm) (Kraemer and Seidman, 1989, and references therein). Except for AAF, BPDE and NOP which bind to G (although not with an especially high frequency at this sequence), mutation at this site may not always be due to lesions directly induced by the damaging agent. Moreover, a similar sequence, TCCT, is also
a UVC-induced hot spot in the eukaryotic APRT gene and in simian virus 40 (Drobetsky et al., 1987; Bourre et al., 1989). As mentioned above, mutation at such sites may have common premutagenic lesions, i.e., oxidative damage produced with a higher frequency at this site through various pathways. However, runs of pyrimidines are also the main target sequences for UVC-induced mutation in the lacI gene of E. coli (Schaaper et al., 1987). Although UVC-induced lesions form preferentially in pyrimidine runs, the high frequency of mutation in these sequences may also be related to certain DNA conformations which may inhibit repair (Sage et al., 1991). Moreover, Brash et al. (1987) highlight the possible role of DNA sequence context in the induction of mutation, which led to the proposal of the 'pass/fail' model to explain the lack of correlation at certain sites between DNA lesions and mutations. Indeed, this site at position 168-169 falls into the category where the pass/fail ratio may be atypically large, meaning that most of the events would be polymerase readthrough opposite an even rarer lesion (sometimes resulting in mutation), instead of termination events resulting in cell death. The results presented here indicate that, while some 8-MOP plus UVA-induced mutations occur at damage hot spots, others may be untargeted. In addition, the 8-MOP-induced mutational spectrum shares similarities with other spectra in pZ 189, particularly with respect to the frequency of events at position 168-169, which may be contained within a mutation-prone sequence. This underscores the importance of DNA context in the fixation of heritable mutations in mammalian cells.
Acknowledgements This work was supported by grants from the Association pour la Recherche sur le Cancer (No. 6381) and the Swedish Cancer Society (No. 2365). Dr. E. Drobetsky is thanked for valuable discussions and critical reading of the manuscript. We thank Dr, K. Kraemer for his encouragement in the completion of this work.
222
References Ben-tlur, E., and P.S. Song (1984) The photochemistry and photobiology of furocoumarins (psoralens), Adv. Radiat. Biol., 11, 131-171. Bourre, F., A. Benoit and A. Sarasin (1989) Respective roles of pyrimidine dimer and pyrimidine (6-4) pyrimidone photoproducts in UV mutagenesis of simian virus 40 DNA in mammalian cells, J. Virol., 63, 4520-4523. Boyer, V., E. Moustacchi and E. Sage (1988) Sequence specificity in the photoreaction of various psoralen derivatives with DNA: role in biological activity, Biochemistry, 27, 3011-3018. Brash, D.E., S. Seetharam, K.H. Kraemer, M.M. Seidman and A. Bredberg (1987) Photoproduct frequency is not the major determinant of UV base substitution hot spots or cold spots in human cells, Proc. Natl. Acad. Sci. (U.S.A.), 84, 3782-3786. Bredberg, A., and N. Nachmansson (1987) Psoralen adducts in a shuttle vector plasmid propagated in primate cells: high mutagenicity of DNA crosslinks, Carcinogenesis, 8, 1923-1927. Cassier, C., R. Chanet and E. Moustacchi (1984) Mutagenic and recombinogenic effects of DNA cross-links induced in yeast by 8-methoxypsoralen photoaddition, Photochem. Photobiol., 39, 799-803. Chanet, R., C. Cassier and E. Moustacchi (1985) Genetic control of the bypass of monoadducts and of the repair of cross[inks photoinduced by 8-methoxypsoralen in yeast, Mutation Res., 145, 145-155. Cheng, S., B. Van Houten, H. Gamper, A. Sancar and J.E. Hearst (1988) Use of psoralen-modified oligonudeotides to trap three-stranded RecA-DNA complexes and repair of these crosslinked complexes by ABC excinuclease, J. Biol. Chem., 263, 15110-15117. Cole, R.S., R.R. Sinden, G.H. Yoakum and S. Broyles (1978) On the mechanism for repair of crosslinked DNA in E. coli treated with psoralen plus light, in: P.C. Hanawalt, E.C. Friedberg and C.F. Fox (Eds.), 1CN-UCLA Symposia on Molecular and Cellular Biology, Vol. IX, Liss, New York, pp. 287-290. Dean, S.W. (1989) Repair of 8-metboxypsoralen + UVAinduced damage in specific sequences in chromosomal and episomal DNA in human cells, Carcinogenesis, 10, 1253-1256. Drobetsky, E.A., A.J. Grosovsky and B.W. Glickman (1987) The specificity of UV-induced mutations at an endogenous locus in mammalian cells, Proc. Natl. Acad. Sci. (U.S.A.), 84, 9103-9107. Kraemer, K.H., and M.M. Seidman (1989) Use of supF, an Escherichia coil tyrosine suppressor tRNA gene, as a mutagenic target in shuttle-vector plasmids, Mutation Res., 220, 61-72. Miller, S., and E. Eisenstadt (1987) Suppressible base substitution mutation induced by angelicin (isopsoralen) in the
Escherichia coil lacl gene: implication for the mechanism ol SOS mutagenesis, J. Bacteriol., 169, 2724-2729. Piette, J.G., and J.E. Hearst (1983) Termination sites of the in vitro nick-translation reaction on DNA that had photoreacted with psoralen, Proc. Natl. Acad. Sci. (U .S.A.L 80, 5540-5544. Sage, E., and E. Moustacchi (1987) Sequence context effect on 8-methoxypsoralen photobinding to defined DNA fragments, Biochemistry, 26, 3307-3314. Sage, E., T. Le Doan, V. Boyer, D,E. Helland, L. Kittler, C. Hdl~ne and E. Moustacchi (1989) Oxidative DNA damage photo-induced by 3-carbethoxypsoralen and other furocoumatins: mechanism of photo-oxidation and recognition by repair enzymes, J. Mol. Biol., 209, 297-314. Sage, E., E. Cramb and B.W. Glickman (1991) UV damage distribution in the lacl gene of Escherichia coli analysed with various probes on an automated DNA sequencer: correlation with mutation spectrum, Submitted. Schaaper, R.M., R.L. Dunn and B.W. Glickman (1987) Mechanisms of UV-induced mutation: mutational spectra in the E. coil lacl gene for a wild type and an excision-repairdeficient strain, J. MoI. Biol., 198, 187-202. Seidman, M.M. (1987) Intermolecular homologous recombination between transfected sequences in mammalian cells is primarily nonconservative, Mol. Cell. Biol., 7, 3561-3565. Seidman, M.M., A. Bredberg, S. Seetharam and K.H. Kraemer (1987) Multiple point mutations in a shuttle vector propagated in human ceils: evidence for an error-prone DNA polymerase activity, Proc. Natl. Acad. Sci. (U.S.A.), 84, 4944-4948. Sladek, F.M., M.M. Munn, W.D. Rupp and P. HowardFlanders (1989a) In vitro repair of psoralen-DNA crosslinks by RecA, UvrABC, and the 5'-exonuclease of DNA polymerase l, J. Biol. Chem., 264, 6755-6765. Sladek, F.M., A. Melian and P. Howard-Flanders (1989b) Incision by UvrABC excinuclease is a step in the path to mutagenesis by psoralen crosslinks in Escherichia coli, Proc. Natl. Acad. Sci. (U.S.A.), 86, 3982-3986. Van Houten, B., H. Gamper, S.R. Holbrook, J .E. Hearst and A. Sancar (1986) Action mechanism of ABC excision nuclease on a DNA substrate containing a psoralen crosslink at a defined position, Proc. Natl. Acad. Sci. (U.S.A.), 83, 8077-808 l. Vos, J.M., and P. Hanawalt (1987) Processing of psoralen adducts in an active human gene: repair and replication of DNA containing monoadducts and interstrand crosslinks, Cell, 50, 789-799. Yatagai, F., and B.W. Glickman (1986) Mutagenesis by 8-methoxypsoralen plus near-UV treatment: analysis of specificity in the lacl gene of Escherichia coil, Mutation Res., 163,209-224. Yatagai, F., M.J. Horsfall and B.W. Glickman (1987) Defect in excision repair alters the mutational specificity of PUVA treatment in the lacl gene of Escherichia coil, J. Mol. Biol., 194, 601-607. Communicated by E. Moustacchi
Mutation Research, 263 (1991) 217-222 © 1991 Elsevier Science Publishers B.V. 0165-7992/91/$ 03.50 ADONIS 016579929100066S MUTLET 0513
Damage distribution and mutation spectrum: the case of 8-methoxypsoralen plus UVA in mammalian cells E v e l y n e Sage I a n d A n d e r s B r e d b e r g 2 I CNRS URA 1292, Institut Curie, Section de Biologie, F-75231 Paris Cedex 05 (France) and 2Department of Medical Biology, University of Lund, General Hospital, S-214 01 Maim6 (Sweden) (Received 18 March 1991) (Revision received 27 March 1991) (Accepted 28 March 199 I)
Keywords: Damage distribution; Mutation spectrum; Furocoumarins
Summary We determined the distribution of monoadducts and biadducts induced in the supFtRNA gene carried by the shuttle vector pZ189, after exposure to 8-methoxypsoralen (8-MOP) plus a double UVA (365 nm) irradiation. These data were compared to our previously published 8-MOP-photoinduced mutation spectrum obtained after propagation of the damaged shuttle vector in mammalian cells. One mutational hot spot in an ATAT/TATA sequence is targeted at a hot spot of biaddition. A second hot spot is not related to the presence of photoadducts either at or near the site. Moreover, it is located in a sequence which can be defined as 'mutation-prone'. Mutations occurring at GC base pairs are not targeted at sites of photoaddition, and may result from a decrease in fidelity of DNA polymerase when copying the damaged vector.
Furocoumarins photoreact with DNA by cycloaddition to pyrimidines (mainly thymine), which induces monoadducts, biadducts which yield interstrand crosslinks, and ultimately mutations (Ben-Hur and Song, 1984). Since these compounds are widely used in the treatment of various dermatological disorders, it is important to understand the basis for their mutagenic potential. This motivated a recent study which characterized the Correspondence: Evelyne Sage, Institut Curie-Biologie, CNRS URA 1292, 26 rue d'Ulm, F-75231 Paris Cedex 05 (France).
DNA sequence alterations induced by a furocoumarin derivative, 8-methoxypsoralen (8-MOP), in mammalian cells. The genetic target used was the supF tRNA gene of Escherichia coli carried on the extrachromosomal shuttle vector pZ189. This investigation shed light on the respective roles of mono- and bi-adducts in 8-MOP-induced mutagenesis. Here we expand this analysis by characterizing the spectrum of 8-MOP-induced damage in the same target gene, and discuss the correlation between mono- and bi-adducts, and mutations.
218
Material and methods
The photoreaction of plasmid pZ189 with 8 - M O P (product of Sigma Chemical Co.) was as described by Bredberg and Nachmansson (1987). Briefly, pZ189 (50 #g/ml) was exposed to 8-MOP (20/~g/ml) for 30 min in the dark, then UVA (365 nm) irradiated at a fluence of 0.55 k J / m 2, which induces mainly monoadducts. Unreacted 8-MOP was eliminated and the DNA reirradiated at a fluence of 33 k J / m 2 in order to convert a fraction of monoadducts to interstrand crosslinks. Untreated D N A or D N A exposed to 33 k J / m 2 UVA served as control. Treated or untreated plasmid D N A was double-restricted and 32p 5 '-end-labeled at the EcoRI site (top strand) or XholI site (bottom strand). Photoadducts were revealed as termination sites after digestion of the DNA with 4.5 units of T4 D N A polymerase 3 ' - 5 ' exonuclease, in the absence of d N T P (Sage and Moustacchi, 1987), followed by electrophoresis of digested products on sequencing gels alongside a M a x a m & Gilbert ladder. The photoreversion of crosslinks by UVC before running digested samples on the gel allowed the detection of all sites of photoadducts, i.e., monoadducts plus biadducts (Sage and Moustacchi, 1987). In the absence of the photoreversion of crosslinks only sites of monoadducts were revealed, since crosslinked molecules migrate as doublestranded DNA. The frequency of photolesions at each site was calculated after counting the radioactivity in gel slices corresponding to bands on an autoradiogram. The photoadduct frequencies in Fig. 1 were derived from the mean values of three experiments. Results
The shuttle vector pZ189 was exposed to 8-MOP plus double UVA irradiation, passaged through Veto or Raji cells, and the mutation spectrum in the target supF t R N A gene was determined (Bredberg and Nachmansson, 1987). In order to better understand the mechanisms that transform 8-MOP-induced D N A damage into stable mutations, the photoadduct distribution in the target
gene was determined. We took advantage o| blockage of the 3 ' - 5 ' exonuclease associated with T4 D N A polymerase by furocoumarin biadducts as well as monoadducts (Sage and Moustacchi, 1987; Boyer et al., 1988). Fig. I shows the photoadduct distribution on plasmid DNA which received 2 UVA doses after dark exposure to 8-MOP. (DNA treated in the same manner was shuttled in cells to determine the mutation spectrum.) The number ol photoadducts per DNA fragment was about 0.11 for the upper strand (EcoRI-Sau3A1) and 0.16 for the lower strand (XhoII-EcoRI) as estimated according to a Poisson distribution. The sites and frequencies of 8-MOP photobinding are in good agreement with our previous data (Sage and Moustacchi, 1987). 8-MOP photoreacts mainly with T in 5 ' - T p A . As expected, the repeated AT site, i.e., A T A T / T A T A , is a hot spot for photoadduct formation in supF and mainly interstrand crosslinks are formed. All 5 ' - T p A sites reacted, whereas 5 ' - A P T and runs of T were unreactive. The previously published mutation spectrum is also shown in Fig. 1. In addition a number of mutants characterized after the initial study are included. From the comparison between mutation and photoaddition spectra, 3 main observations can be made. (1) One of the 2 mutation hot spots correlates with the unique hot spot for photoadducts (mainly interstrand crosslinks). This site is located at the Pribnow box of the gene. (2) One mutation at position 135 arises at a site where photoadducts (mainly monoadducts) occur. (3) The other mutational hot spot does not correlate with the presence of any photoadduct at or near the site. In general, the correlation between mutation sites and sites of photoaddition is rather poor. Most 8-MOP photobinding arises in the pre-tRNA or regulatory region of the gene. Discussion
Biadducts are more mutagenic than monoadducts A second high UVA dose which transforms furan-side monoadducts located in a 5 ' - T p A context in interstrand crosslinks is a prerequisite for the severalfold increase in the mutation frequency
219 -35 region
I
Prlbnow box
I
IA
i
A
O|
pre-tRNA
I
!
[]
A
o.
o=
C6T ARC AC'I-rTACAG CGGC8CGT CATTT GAT A I G A T 6C GCCCC 8CI-ICC CGATA AGGGA GCAGGCCAGTA A A A OC GCATT6T6AAATBTCGCC6CBCA[~TAAACTATACTACG CGGGGCGAAGGGCTATTCCCTCGTCCG6 TCAT-fTTCG
begin tRNA I
ol
[]
0.
G
~
®
[]
®A
ArrACC(:6r611T606Orr CI:t:GA6C66CCAAA666A6CA6ACTCTAAA'rCT6tCGTCA'rC6ACTTC6AA66 "TAAT6G GC ACC,AC CC CA A66fiCTC 6C CG 6TT-r CC CT C6 T CT 6AG6T'I-r AGACGGCAGTAGCT 6AA GC'I-I'CC |o ,~ 6o -N ° ,;o ,,o T T
r
C TT T TTC 6AATC cl-rC CCCC ACCAC CA AA EiCTT AG GAA 6G 6G 6IGGTG 6T Fig. 1.8-MOP-induced photoadduct distribution and mutation spectrum in the supF t R N A gene o f E. coli. The D N A was exposed to 20 #g/ml of 8-MOP, received a first U V A dose of 0.55 kJ / m 2 and was reirradiated at a dose o f 33 kJ/ m z (see detailed protocol in
Material and Methods). Full bars represent sites and frequencies of biadducts, dotted bars represent sites and frequencies of monoadducts.
induced by 8-MOP plus a first UVA exposure in pZ189 (Bredberg and Nachmansson, 1987). This emphasized the fact that mutations were mainly due to biadducts. Determination of the frequency o f both types of photoadducts in the supF target confirms this hypothesis. The hot spot at A T A T is correlated with the presence of biadducts. Nevertheless, the single mutation at position 135 indicates that monoadducts are also potentially mutagenic lesions. The more potent mutagenicity o f biadducts as compared to monoadducts is not limited to the shuttle vector system, indeed it is observed in a variety of cells (Sladek et al., 1989; Cassier et al., 1984; Papadopoulo and Averbeck, 1985; Papadopoulo and Moustacchi, 1990). Monoadducts are believed to be repaired by a relatively error-free process (Vos and Hanawalt, 1987). This suggests tolerance of the unrepaired monoadducts over generations, perhaps as a result o f bypass by DNA polymerase during replication or repair. Monoadducts have been shown to be bypassed by DNA polymerase I of E. coil in an in
vitro nick-translation assay, but not when located in a single-stranded DNA template (Piette and Hearst, 1983). Bypass of monoadducts has also been reported in yeast (Chanet et al., 1985). Furthermore, it may be that in many cases, depending on the sequence context, the polymerase inserts an A opposite the monoadducted T, in a similar manner to T < > T cyclobutanepyrimidine dimers induced by 254-nm UVC light as emphasized by Brash et al. (1987). In contrast, interstrand crosslinks constitute an absolute block for DNA polymerase, and may therefore be repaired in an error-prone manner.
Mutations at most o f the sites of photoadduct formation would not inactivate supF function Most of the sites of photoadducts are located in the pre-tRNA gene or in the regulatory region. According to Kraemer and Seidman (1989), mutated supF genes have been recovered at only a few positions in that region, and except for the Pribnow box, none has been found at sites of 8-MOP
220
photoadducts. Photoadducts in this region may lead to silent changes, or may not give rise to mutation because of insertion of the correct base opposite the lesion. In view of the sequence specificity of the photoreaction.of 8-MOP with DNA, it was hypothesized that the T A T A box would constitute an excellent target for 8-MOP photoaddition and consequently for 8-MOP-induced mutation (Sage and Moustacchi, 1987; Bredberg and Nachmansson, 1987). This finds confirmation here. The sequence of the supF tRNA gene is not a good target for furocoumarins, even though it contains many T. The only 5 ' - T p A site of the gene is hit, and this correlates well with mutation at position 135 located in the anticodon of the tRNA. Mainly monoadducts are formed in this AT-rich sequence, but one cannot exclude that mutation is due to biadducts induced at a low frequency. Targeted mutations at A T base pairs As already mentioned, the mutational hot spot at position 45-46 of the A T A T / T A T A Site correlates well with the presence of biadducts involving the 2 mutated T, which lead to interstrand crosslinks. Little is known about the mechanisms that produce mutations from psoralen-induced crosslinks in mammalian cells. Repair of crosslinks is a multistep process. Several of these steps have been elucidated in E. coli in the past few years (Cole et al., 1978; Van Houten et al., 1986; Cheng et al., 1988; Sladek et al., 1989a,b). Included sequentially are incision by UvrABC endonuclease, digestion by the 5' exonuclease of DNA polymerase I, homologous recombination by RecA involving strand exchange and DNA repair synthesis, excision of the crosslink, a second step of repair synthesis and finally ligation. More importantly, Sladek et al. (1989b) demonstrated that in SOSinduced cells, UvrABC incision is an obligatory step for mutagenesis by psoralen crosslinks, and that homologous recombination reduces the yield o f point mutations. In our system, recombination between shuttle vector molecules at the site of biadducts is unlikely, since it would require a break in the input DNA at the target sequence. Moreover, intermolecular recombination between substrates
similar to pZ189 transfected in mammalian cells has been shown to be mainly non-conservative (Seidman, 1987). Thus, the observed point mutations are likely to occur after the incision step, by misincorporation at the level of DNA polymerase readthrough, a process that would normally compete with recombinational repair (Sladek et al., 1989). Furthermore it seems that the polymerase(s) does not insert the same nucleotide when copying the leading strand or the lagging strand (T--,A transversions on the leading strand, mainly T--,C transitions on the lagging strand, see mutations at positions 45, 46 and 135). This may also be due to the positioning of the psoralen molecule in the double helix and preferential incision of the furan side or pyrone side of the biadduct. These observations lead to the suggestion that in mammalian cells there is a pathway for the repair of psoralen crosslinks independent of recombination, which may consist of mutagenic (error-prone) gap filling by DNA polymerases. This repair pathway may be the main process operating on episomal DNA, since the removal of crosslinks is considerably lower in episomal plasmid as compared to genomic DNA in human cells (Dean, 1989). Mutations at GC base pairs A number of mutations arise at GC base pairs (Table 1), as in the mutation spectra induced by angelicin and 8-MOP plus UVA in the lacI gene of E. coli (Yatagai and Glickman, 1986; Miller and Eisenstadt, 1987; Yatagai et al., 1987). From Fig. 1, these base substitution events are not
TABLE 1 PUVA-1NDUCED
POINT
MUTATIONS
IN THE
GENE Transitions
TA~CG CG~TA
3 10
Transversions
GC~CG GC-'TA TA-'AT TA~GC
4 4 3 0
Deletion
AT base pair
1
supF
221 targeted at sites of photoadducts, and are also unlikely to reflect less prevalent adducts. Photoadducts at C positions are rare and occur mainly in CA or AC sequences (Boyer et al., 1988). Could other types of cryptic damage constitute premutagenic lesions? Some furocoumarins have the potential to induce photooxidative lesions in DNA at G positions, via a type I mechanism (G radical) or a type II mechanism (singlet oxygen) (Sage et al., 1989). These DNA lesions lead to sites sensitive to hot alkali and to DNA repair enzymes recognizing oxidative damage. Nevertheless, in vitro, 8-MOP does not induce such photooxidation (Sage et al., 1989). It is not likely that mutations at GC base pairs are targeted at such photolesions induced by 8-MOP. Some of these base substitutions are also recovered spontaneously and after UV or some other damaging agents, e.g., positions 43 and 164. One possibility is that activated oxygen species produced by normal cellular metabolism damage the shuttle vector during transport into the nucleus. Another possible explanation for the presence of these mutations at GC base pairs is a decreased fidelity of the DNA polymerases during the repair synthesis of psoralen photoadducts (Yatagai and Glickman, 1986). The presence of a number of double mutations (Fig. 1) favors this hypothesis (Seidman et al., 1987). Mutation hot spot at T C C T T C C C C C is "untargeted" This mutation hot spot induced by 8-MOP plus UVA cannot be explained by the presence of a photoadduct at or near that sequence. This sequence is of particular interest since mutational hot spots also arise at that site, spontaneously or after treatment of pZ189 by UVC (254 nm), H202, acetylaminofluorene (AAF) and to a lesser extent by benzo[a]pyrenediolepoxide (BPDE), 1-nitrosopyrene (NOP), UVB (313 nm) (Kraemer and Seidman, 1989, and references therein). Except for AAF, BPDE and NOP which bind to G (although not with an especially high frequency at this sequence), mutation at this site may not always be due to lesions directly induced by the damaging agent. Moreover, a similar sequence, TCCT, is also
a UVC-induced hot spot in the eukaryotic APRT gene and in simian virus 40 (Drobetsky et al., 1987; Bourre et al., 1989). As mentioned above, mutation at such sites may have common premutagenic lesions, i.e., oxidative damage produced with a higher frequency at this site through various pathways. However, runs of pyrimidines are also the main target sequences for UVC-induced mutation in the lacI gene of E. coli (Schaaper et al., 1987). Although UVC-induced lesions form preferentially in pyrimidine runs, the high frequency of mutation in these sequences may also be related to certain DNA conformations which may inhibit repair (Sage et al., 1991). Moreover, Brash et al. (1987) highlight the possible role of DNA sequence context in the induction of mutation, which led to the proposal of the 'pass/fail' model to explain the lack of correlation at certain sites between DNA lesions and mutations. Indeed, this site at position 168-169 falls into the category where the pass/fail ratio may be atypically large, meaning that most of the events would be polymerase readthrough opposite an even rarer lesion (sometimes resulting in mutation), instead of termination events resulting in cell death. The results presented here indicate that, while some 8-MOP plus UVA-induced mutations occur at damage hot spots, others may be untargeted. In addition, the 8-MOP-induced mutational spectrum shares similarities with other spectra in pZ 189, particularly with respect to the frequency of events at position 168-169, which may be contained within a mutation-prone sequence. This underscores the importance of DNA context in the fixation of heritable mutations in mammalian cells.
Acknowledgements This work was supported by grants from the Association pour la Recherche sur le Cancer (No. 6381) and the Swedish Cancer Society (No. 2365). Dr. E. Drobetsky is thanked for valuable discussions and critical reading of the manuscript. We thank Dr, K. Kraemer for his encouragement in the completion of this work.
222
References Ben-tlur, E., and P.S. Song (1984) The photochemistry and photobiology of furocoumarins (psoralens), Adv. Radiat. Biol., 11, 131-171. Bourre, F., A. Benoit and A. Sarasin (1989) Respective roles of pyrimidine dimer and pyrimidine (6-4) pyrimidone photoproducts in UV mutagenesis of simian virus 40 DNA in mammalian cells, J. Virol., 63, 4520-4523. Boyer, V., E. Moustacchi and E. Sage (1988) Sequence specificity in the photoreaction of various psoralen derivatives with DNA: role in biological activity, Biochemistry, 27, 3011-3018. Brash, D.E., S. Seetharam, K.H. Kraemer, M.M. Seidman and A. Bredberg (1987) Photoproduct frequency is not the major determinant of UV base substitution hot spots or cold spots in human cells, Proc. Natl. Acad. Sci. (U.S.A.), 84, 3782-3786. Bredberg, A., and N. Nachmansson (1987) Psoralen adducts in a shuttle vector plasmid propagated in primate cells: high mutagenicity of DNA crosslinks, Carcinogenesis, 8, 1923-1927. Cassier, C., R. Chanet and E. Moustacchi (1984) Mutagenic and recombinogenic effects of DNA cross-links induced in yeast by 8-methoxypsoralen photoaddition, Photochem. Photobiol., 39, 799-803. Chanet, R., C. Cassier and E. Moustacchi (1985) Genetic control of the bypass of monoadducts and of the repair of cross[inks photoinduced by 8-methoxypsoralen in yeast, Mutation Res., 145, 145-155. Cheng, S., B. Van Houten, H. Gamper, A. Sancar and J.E. Hearst (1988) Use of psoralen-modified oligonudeotides to trap three-stranded RecA-DNA complexes and repair of these crosslinked complexes by ABC excinuclease, J. Biol. Chem., 263, 15110-15117. Cole, R.S., R.R. Sinden, G.H. Yoakum and S. Broyles (1978) On the mechanism for repair of crosslinked DNA in E. coli treated with psoralen plus light, in: P.C. Hanawalt, E.C. Friedberg and C.F. Fox (Eds.), 1CN-UCLA Symposia on Molecular and Cellular Biology, Vol. IX, Liss, New York, pp. 287-290. Dean, S.W. (1989) Repair of 8-metboxypsoralen + UVAinduced damage in specific sequences in chromosomal and episomal DNA in human cells, Carcinogenesis, 10, 1253-1256. Drobetsky, E.A., A.J. Grosovsky and B.W. Glickman (1987) The specificity of UV-induced mutations at an endogenous locus in mammalian cells, Proc. Natl. Acad. Sci. (U.S.A.), 84, 9103-9107. Kraemer, K.H., and M.M. Seidman (1989) Use of supF, an Escherichia coil tyrosine suppressor tRNA gene, as a mutagenic target in shuttle-vector plasmids, Mutation Res., 220, 61-72. Miller, S., and E. Eisenstadt (1987) Suppressible base substitution mutation induced by angelicin (isopsoralen) in the
Escherichia coil lacl gene: implication for the mechanism ol SOS mutagenesis, J. Bacteriol., 169, 2724-2729. Piette, J.G., and J.E. Hearst (1983) Termination sites of the in vitro nick-translation reaction on DNA that had photoreacted with psoralen, Proc. Natl. Acad. Sci. (U .S.A.L 80, 5540-5544. Sage, E., and E. Moustacchi (1987) Sequence context effect on 8-methoxypsoralen photobinding to defined DNA fragments, Biochemistry, 26, 3307-3314. Sage, E., T. Le Doan, V. Boyer, D,E. Helland, L. Kittler, C. Hdl~ne and E. Moustacchi (1989) Oxidative DNA damage photo-induced by 3-carbethoxypsoralen and other furocoumatins: mechanism of photo-oxidation and recognition by repair enzymes, J. Mol. Biol., 209, 297-314. Sage, E., E. Cramb and B.W. Glickman (1991) UV damage distribution in the lacl gene of Escherichia coli analysed with various probes on an automated DNA sequencer: correlation with mutation spectrum, Submitted. Schaaper, R.M., R.L. Dunn and B.W. Glickman (1987) Mechanisms of UV-induced mutation: mutational spectra in the E. coil lacl gene for a wild type and an excision-repairdeficient strain, J. MoI. Biol., 198, 187-202. Seidman, M.M. (1987) Intermolecular homologous recombination between transfected sequences in mammalian cells is primarily nonconservative, Mol. Cell. Biol., 7, 3561-3565. Seidman, M.M., A. Bredberg, S. Seetharam and K.H. Kraemer (1987) Multiple point mutations in a shuttle vector propagated in human ceils: evidence for an error-prone DNA polymerase activity, Proc. Natl. Acad. Sci. (U.S.A.), 84, 4944-4948. Sladek, F.M., M.M. Munn, W.D. Rupp and P. HowardFlanders (1989a) In vitro repair of psoralen-DNA crosslinks by RecA, UvrABC, and the 5'-exonuclease of DNA polymerase l, J. Biol. Chem., 264, 6755-6765. Sladek, F.M., A. Melian and P. Howard-Flanders (1989b) Incision by UvrABC excinuclease is a step in the path to mutagenesis by psoralen crosslinks in Escherichia coli, Proc. Natl. Acad. Sci. (U.S.A.), 86, 3982-3986. Van Houten, B., H. Gamper, S.R. Holbrook, J .E. Hearst and A. Sancar (1986) Action mechanism of ABC excision nuclease on a DNA substrate containing a psoralen crosslink at a defined position, Proc. Natl. Acad. Sci. (U.S.A.), 83, 8077-808 l. Vos, J.M., and P. Hanawalt (1987) Processing of psoralen adducts in an active human gene: repair and replication of DNA containing monoadducts and interstrand crosslinks, Cell, 50, 789-799. Yatagai, F., and B.W. Glickman (1986) Mutagenesis by 8-methoxypsoralen plus near-UV treatment: analysis of specificity in the lacl gene of Escherichia coil, Mutation Res., 163,209-224. Yatagai, F., M.J. Horsfall and B.W. Glickman (1987) Defect in excision repair alters the mutational specificity of PUVA treatment in the lacl gene of Escherichia coil, J. Mol. Biol., 194, 601-607. Communicated by E. Moustacchi
