http://informahealthcare.com/mor ISSN 1439-7595 (print), 1439-7609 (online) Mod Rheumatol, 2015; Early Online: 1–7 © 2015 Japan College of Rheumatology DOI: 10.3109/14397595.2015.1014141
ORIGINAL ARTICLE
Decreased expression of alpha-enolase inhibits the proliferation of hypoxia-induced rheumatoid arthritis fibroblasts-like synoviocytes Sha Sha Fan, Ming Zong, Hui Zhang, Ying Lu, Tian Bao Lu, and Lie Ying Fan
Mod Rheumatol Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
Department of Clinical Laboratory, Shanghai East Hospital, Tong Ji University, Shanghai, P. R. China Abstract
Keywords
Objectives. To investigate the effect of decreased alpha-enolase (ENO1) expression on rheumatoid arthritis fibroblasts-like synoviocytes (RA-FLSs) proliferation in response to hypoxia, and elucidate the possible mechanisms involved. Methods. RA-FLSs and osteoarthritis fibroblasts-like synoviocytes (OA-FLSs) were cultured in trigas incubators with different oxygen concentrations (3% O2, 7% O2, and 21% O2). 3% O2 (hypoxia) and 7% O2 conditions simulated intra-articular oxygen concentrations as observed in RA and healthy individual, respectively. 21% O2 represented oxygen condition for normal cell culture. ENO1-knockdown FLSs were established using ENO1-siRNA. The expression level of ENO1 was detected using reverse transcription polymerase chain reaction or RT-PCR and Western blot. Proliferation and apoptosis of RA-FLSs and OA-FLSs were assessed using 3-(4,5-dimethylthiazol-2yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2 H-tetrazolium or MTS assay and flow cytometry, respectively. Western blot analysis was used to detect key proteins involved in apoptosis. Results. ENO1 gene expression was remarkably upregulated, as well as its translation into protein, in RA-FLSs and OA-FLSs that were cultured in 3% O2 concentration. RA-FLSs and OA-FLSs that were cultured under hypoxic conditions hyperproliferated compared with similar cells under normaxic conditions. Neither 7% O2 nor 21% O2 condition had any significant effect on ENO1 expression. ENO1-siRNA-transfected FLSs, but not control-siRNA FLSs, showed markedly decreased proliferation. Additionally, ENO1 expression was found to promote significantly higher expression levels of the anti-apoptotic proteins Bcl-2, surviving, and cyclinB1, but inhibited the expression of cleaved caspase3. Conclusion. ENO1 may be crucial in the regulation of the proliferation and survival of synovial fibroblasts.
Alpha-enolase, Fibroblasts-like synoviocytes, Hypoxia, Proliferation, Rheumatoid arthritis
Introduction Synovial tissue from healthy individuals consists of 2–3 layers of cells, and is composed of two types of cells in relatively equal proportion: Type A or macrophage-like synovial cells and Type B or fibroblasts-like synoviocytes (FLSs). However, rheumatoid synovial tissue expands from 1–2 cells to about 10–20 layers of cells. This hypercellularity is due to an increase in both Type A and B cells which are present in the tissue structure. Lymphocytes and macrophages are often recruited and activated in the tissue structure, and together with the hyperplastic synovial FLSs, release inflammatory cytokines and enzymes which orchestrate the destruction of cartilage and bone [1]. Inadequate oxygenation, termed “hypoxia,” is thought to drive rheumatoid arthritis (RA)associated synovial angiogenesis through the expression of hypoxia-inducible molecules, including vascular endothelial growth factor [2]. The hypoxic nature of RA synovium was first revealed in 1970 using a Clark-type electrode to measure the oxygen tension in synovial fluid samples from patients. The concentration of oxygen in RA joint cavity was approximately 3%, while in healthy Correspondence to: Lieying Fan, PhD, Department of Clinical Laboratory, Shanghai East Hospital, Tong Ji University, 150 Ji Mo Road, Shanghai 200120, P. R. China. Tel: 021-61569170. Fax: 021-61569170. E-mail:[email protected]
History Received 5 December 2014 Accepted 28 January 2015 Published online 31 March 2015
individuals it was approximately 7% [3,4]. These values have been confirmed in other studies which employed different measurement techniques including nuclear magnetic resonance spectroscopy, pimonidazole, as well as video arthroscopy [5–7]. Several studies have also demonstrated that oxygen consumption in RA synovium is elevated, possibly due to the increased proliferative activity of synovial cells, and that glucose is also oxidized via an anaerobic pathway [8,9]. In the context of hypoxia, compensatory adaptation is mainly achieved through the glycolytic process to obtain the necessary energy for life’s activities [10]. Our group’s previous study [11] and that of Li et al [12], using proteomic analysis, found that alpha-enolase (ENO1) was overexpressed in RA-FLSs. Additionally, ENO1 was detected in RA joint, where it colocalized with citrullinated proteins [13]. ENO1 is a highly conserved, multifunctional protein that, in addition to its role in glycolysis, also binds plasminogen. It is known to be induced by hypoxia [14] and by pro-inflammatory stimuli [15], both of which are features of the synovial membrane microenvironment in RA. ENO1 is expressed during cell differentiation and is used as a marker of differentiation in the grading of tumors [16]. The overexpression of ENO1 and other enzymes in the glycolytic process during hypoxia sustain the high-energy requirement adaptation of tumor cells, and consequently increase their survival and proliferation [2,17,18], as well as their invasive and metastatic ability [19,20].
2 S. S. Fan et al. This study investigated the molecular characteristics of FLSs hyperproliferation in RA pathogenesis. We used tri-gas incubator to simulate intra-articular hypoxia microenvironment as observed in RA. We found that the expression of ENO1 gene in RA-FLSs was markedly enhanced when cultured at 3% O2 concentration (hypoxic), as compared with similar cells cultured under normoxic conditions. Our data series demonstrated that ENO1 was important for the hyperproliferation of RA-FLSs, thus RA pathogenesis, and that ENO1 may be an ideal therapeutic target for RA.
Materials and methods
Mod Rheumatol Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
Isolation and culture of FLSs Primary FLS cells were prepared from synovectomized tissues obtained from six patients with RA and six patients with osteoarthritis (OA) who were undergoing joint replacement surgery at the Shanghai East Hospital. The tissue samples were immediately placed in Roswell Park Memorial Institute (RPMI) 1640 medium and processed within 4 h for FLSs. Informed consent was obtained from each of the enrolled patient, and the study protocol was approved by the Ethics Committee of Shanghai East Hospital. The mean age of the RA patients was 58 years (two males and four females, age range: 48–74 years) and the mean age of OA patients was 60 years (three males and three females, age range: 68–77 years). Each patient had been diagnosed with the respective disease for at least 24 months. The patients had visible joint erosions by radiography of the hand, and they all met the diagnostic criteria of the American College of Rheumatology (formerly the American Rheumatism Association) for classification of RA and OA [21,22]. Synovial tissues were minced in RPMI 1640 medium and evenly spread at the bottom of cell culture flasks, and incubated at 37°C for 6 h. Upon removal of the old medium, the tissues were incubated in RPMI 164 medium supplemented with 10% fetal calf serum (complete medium) at 37°C in 5% CO2 atmosphere. Three out of the six seeded RA-FLSs (redesignated as N4, N16, and N19) and three out of the six seeded OA-FLSs (redesignated as C6, C8, and C11) thrived and were used for all subsequent experiments. The culture medium was replaced every 3 days until the primary cultures reached 70–80% confluence and then divided. The FLSs were further grown over 4–8 passages. To characterize the cytological phenotype of the synovial cultures, the cells were stained with mouse mAb against human CD14 and CD90 (9011-0149-025 and eBio5E10, respectively, eBioscience, San Diego, CA, USA) and showed 2.8% CD14 and 97.0% CD90 expression as measured by flow cytometry (Beckman Coulter, Fullerton, CA, USA). Cells at passages 5–8 were phenotypically homogenous by cytological observations. Hypoxic treatment Hypoxic conditions were simulated in a tri-gas incubator (Forma Scientific, Div. of Mallinckrodt, Inc, Marietta, Ohio). FLSs were cultured under 92% N2, 5% CO2, and 3% O2 gas-mixture condition at 37°C to simulate joint cavity hypoxic microenvironment of RA patients, or under 88% N2, 5% CO2, and 7% O2 gas-mixture condition at 37°C to simulate articular cavity oxygen concentration of healthy individuals. A normal culture gas-mixture condition with 21% O2 component was also set up as control. Quantitative RT-PCR analysis Total RNA was extracted from FLSs using TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Reverse transcription was performed using first-strand cDNA Synthesis Kit (Takara, Dalian, China) according to the manufacturer’s instructions. Real-time polymerase chain reaction (PCR) was performed using Premix Ex Taq SYBR Green PCR (Takara, Dalian, China) according to the manufacturer’s instructions on
Mod Rheumatol, 2015; Early Online: 1–7
an ABI PRISM 7500 (Applied Biosystems, Foster City, CA, USA). The sequences of primers used were ENO1—Forward: 5′ACTGCTATTGGGAAAGCTGGCTAC-3′, Reverse: 5′-CACTGT GAGATCATCCCCCACTAC-3’; and glyceraldehyde 3-phosphate dehydrogenase (GAPDH)—Forward: 5′- TGACTTCAACAGCGACACCCA 3′, Reverse: 5′- CACCCTGTTGCTGTAGCCA AA 3′. GAPDH served as an internal control. Western blot analysis Each RA-FLS and OA-FLS sample was lysed in boiled sample buffer containing 1% sodium dodecyl sulfate (SDS). The protein concentration in the supernatant was determined using the Bradford method (Bio-Rad, Hercules, CA, USA). Normalized amount of total protein (about 120 mg) of each sample was separated by 10% SDSpolyacrylamide gel electrophoresis or PAGE and transferred onto a nitrocellulose membrane. This was then immersed in blocking buffer (5% skimmed milk and 0.1% Tween-20 in phosphate-buffered saline [PBS], pH: 7.4) for 1 h at room temperature and subsequently incubated with the appropriate primary antibody in blocking buffer overnight at 4°C. Primary antibodies used included anti-ENO1 (ab155955), anti-caspase3 (ab32042), and anti-cleaved-caspase3 (ab13847) (all purchased from Abcam, Cambridge, MA, USA); antisurvivin (sc-17779), cyclinB1 (sc-752), and b-actin (sc-47778) (all purchased from Santa Cruz Biotechnology Inc, Santa Cruz, California, USA); and anti-Bcl2(#2876)(Cell Signal Technology Inc, CST, USA). After incubation, the membrane was washed and probed with horseradish peroxidase-labeled immunoglobulin G or IgG antibody in PBS (supplemented with 0.05% Tween-20 and 5% skimmed milk powder) for 30 min at room temperature. The proteins in the membrane were visualized using enhanced chemiluminescence (Amersham, Little Chalfont, Bucks, UK) and the bands were detected by autoradiography with X-ray film (Fujifilm, Japan). siRNA synthesis and transfection Predesigned siRNA duplexes (sense strand: 5′-CUCAAAGGCU GUUGAGCACAUCAAU-3′) targeting nucleotides 337–352 of the human ENO1 mRNA (RefSeq NM_001428) were purchased from Invitrogen (Invitrogen, Carlsbad, CA, USA). As a negative control, the scrambled sequence 5′-CCAGGG UUCCUAAUCGGAUUUGCUA-3′ which is without significant homology to any human gene was also designed and obtained from Invitrogen. RA-FLSs and OA-FLSs (N4, N16, N19 and C6, C8, C11, respectively, at passage 5) were separately seeded in 6-well plate (3 105 per well), 24-well plate (5 104 per well), and 96-well plate (3 103 per well) in RPMI 1640 complete medium. The cells were transfected with ENO1-siRNA (siENO1) on the first day and using Lipofectamine 2000 Transfection Reagent (Life Technologies Corporation, Carlsbad) on the next day according to the manufacturer’s protocol. At 6 h post transfection, the transfection medium was replaced with fresh complete culture medium. FLSs in 6-well plate and 24-well plate were harvested at 48 h post transfection for reverse transcription PCR (RT-PCR), Western blot (WB), and apoptosis analyses. FLSs in 96-well plate were used for proliferation studies by 3-(4,5-dimethylthiazol-2yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2 H-tetrazolium (MTS) assay at 24 h, 48 h, and 72 h post transfection. Cell proliferation assays After hypoxia induction and transfection, the medium in each well was replaced with 100 mL of fresh serum-free medium containing 20 mL of MTS (Promega, Madison, WI, USA) and incubated at 37°C for 4 h. The absorbance of the medium was measured at 490 nm. Each assay was performed in quadruplicate, with appropriate controls. All tests were repeated three times.
Decreased expression of alpha-enolase 3
DOI 10.3109/14397595.2015.1014141
Mod Rheumatol Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
Figure 1. Effect of hypoxia on the proliferation and ENO1 expression in RA-FLS and OA-FLS. (a) Effect of different oxygen concentrations on cell proliferation by MTS assay. (b) ENO1 mRNA expression level by qRT-PCR analysis and (c) ENO1 protein expression level by WB analysis in RA-FLS and OA-FLS. The data in (a) and (b) are mean SD obtained from three separate experiments. Data in (c) are representative of three separate experiments. *p 0.05.
Flow cytometry analysis of apoptosis RA-FLSs and OA-FLSs were trypsinized and collected for apoptosis assessment using Annexin V-FITC Apoptosis Detection Kit (eBioscience, San Diego, CA, USA). Briefly, FLSs were washed twice with cold PBS and resuspended in 500 mL of binding buffer (10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid or HEPES-NaOH at pH: 7.4, NaCl, and 2.5 mM CaCl2) at a density of 1 106 cells/ml. After the addition of
5 ml of Annexin V-FITC solution and propidium iodide (PI) (1 mg/ml), the cells were incubated for 15 min at room temperature and then analyzed on a flow cytometer (Beckman Coulter, Fullerton, CA, USA). Statistical analysis The data are expressed as mean standard deviation (SD) and all statistical analyses were performed using SPSS version 18.0
4 S. S. Fan et al.
Mod Rheumatol, 2015; Early Online: 1–7
Mod Rheumatol Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
Figure 2. Effect of ENO1 knockdown on the growth of RA-FLSs and OAFLSs. (a) ENO1 expression level following knockdown as measured by qRT-PCR and (b) and WB analysis. (c) The transfected cells were cultured under 3% O2 or 21% O2 condition and their proliferation rates were measured for 3 consecutive days. Absorbance was measured to directly reflect cell proliferation using MTS assay. The data in (a) are mean SD obtained from three separate experiments. Data in (b) are representative of three separate experiments. The data in (c) are mean SD obtained from single experiments performed in triplicate cultures. *p 0.05.
statistical software (SPSS Inc, Chicago, IL, USA). Analysis of variance or ANOVA followed by least significant difference or LSD multiple comparison test was used to compare the means of multiple groups. Two-tailed Student’s t-test was also used where appropriate. All experiments were repeated at least three times. Statistical significance was set at p 0.05.
Results Hypoxia promotes FLSs proliferation and induces ENO1 expression To investigate the effect of hypoxia on RA-FLS and OA-FLS proliferation, FLSs were cultured under conditions of different oxygen
Mod Rheumatol Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
DOI 10.3109/14397595.2015.1014141
Decreased expression of alpha-enolase 5
Figure 3. Effect of ENO1 knockdown on apoptosis of RA-FLSs and OA-FLSs. (a) Annexin V–PI flow cytometry analysis for apoptosis. (b) Bar graph data of the early apoptotic cells (lower-right quadrant). Data in (a) are representative of three separate experiments, and in (b) are mean SD obtained from three separate experiments, *p 0.05.
concentrations (3% O2, 7% O2, and 21% O2) for 48 h. FLSs were observed to vigorously grow under 3%O2 condition, with no such growth pattern seen in similar cells cultured in 7% O2 or 21% O2 condition (Figure 1a). Next, we analyzed the effect of hypoxia on the gene and protein expressions of ENO1 in RA-FLSs and OAFLSs using qRT-PCR (Figure 1b) and WB (Figure 1c), respectively. Compared with 21% O2, ENO1 mRNA was consistently upregulated in the hyperactive RA-FLSs cultured under 3%O2 condition but not under 7% O2 condition. OA-FLSs also demonstrated similar results as RA-FLSs (Figures 1a–c). ENO1-siRNA effectively attenuates hypoxia-induced hyperproliferation of FLSs RA-FLSs and OA-FLSs were transfected with ENO1-siRNA (siENO1) or control-siRNA (siC). The transfected cells were cultured under either 3% O2 or 21% O2 condition. The growth kinetics
of the transfected RA-FLSs were monitored for 3 consecutive days (Figure 2c). The expression levels of the corresponding ENO1 mRNA and protein were measured by quantitative RT-PCR (qRTPCR) (Figure 2a) and WB (Figure 2b), respectively. siENO1 effectively inhibited ENO1 gene expression, irrespective of the oxygen concentration of the culture environment (Figure 2a). This genetic activity directly correlated with the protein expression of ENO1 in the cells (Figure 2b). Corroboratively, the proliferative potential of RA-FLSs under both conditions (3% O2 and 21% O2) significantly reduced compared with that in siC-treated cells under similar conditions (Figure 2c). Similar observations were also made with OA-FLSs (Figures 2a–c). ENO1 knockdown promotes apoptosis of FLSs Following transfection, the number of early apoptotic FLS cells significantly increased, irrespective of oxygenation condition
Mod Rheumatol Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
6 S. S. Fan et al.
Mod Rheumatol, 2015; Early Online: 1–7
Figure 4. qRT-PCR and WB analyses for the detection of mRNA and protein expression levels, respectively, of apoptosis-related factors in RA-FLSs and OA-FLSs following siENO1 or siC transfection. The data are representative of three separate experiments.
(3%O2 or 21%O2), in siENO1-transfected cells as compared with their corresponding siC-transfected cells (Figure 3a and b). Both RA-FLSs and OA-FLSs showed similar outcomes (Figure 3a and b). ENO1 modulates apoptosis-related factors of FLSs to inhibit apoptosis qRT-PCR and WB analyses revealed that knocking down ENO1 yielded only marginal effect on the expression of caspase3 but significantly enhanced the expression of cleaved caspase3, its active form. On the contrary, the expression levels of Bcl-2, survivin, and cyclinB1 significantly reduced in all the cells cultured under the different oxygen conditions (3% O2 and 21% O2). However, the decline in expression levels of Bcl-2, survivin, and cyclinB1 were of varying degrees in the cells cultured in 3% O2 concentration. These data suggest that ENO1 may exert its anti-apoptosis effect by regulating the expression of certain apoptotic-related factors in FLSs, as observed in RA-FLSs and OA-FLSs (Figure 4).
Discussion Glycolysis is a compensatory process of energy metabolism during hypoxia. ENO1 is the most sensitive marker of pathological change and also the glycolytic enzyme found to be upregulated when cells are under anoxic condition for a long time; thus, it is a hypoxia stress protein [23]. Malignant cells adapt to hypoxia by modulating ENO1/myelin basic protein-1 levels as an induction mechanism for tumor cells to attain hyperglycolytic state. This important “feedback” mechanism may help transformed cells to escape the apoptotic cascade, and allowing for survival during limited glucose and oxygen availability [24]. Could RA-FLSs (and/or OA-FLSs) be employing similar mechanisms for survival? Research has indicated that RA-FLS population in RA is abundant due to an imbalance between cell proliferation, survival, and death [1]. However, current knowledge on the direct effect of ENO1 on the biological behavior of FLSs is extremely limited.
In this study, we found that RA-FLSs (and OA-FLSs) excellently thrived under hypoxic condition, and ENO1 gene and protein were markedly expressed in RA-FLSs (Figure 1). Gas-mixture condition of 7% O2 (oxygen concentration of intra-articular healthy individual) had no apparent effect on the proliferation of FLSs as well as the expression of ENO1 (Figures 1, 2a and b). These data suggest that hypoxia may be an inducer of the excessive proliferation of RA-FLSs (and OA-FLSs) and ENO1 is intimately linked with the proliferation phenomenon. To examine the specific role of ENO1 gene in RA-FLSs and OAFLSs proliferation, ENO1-siRNA (siENO1) was introduced into the cells. The inhibition of ENO1 by siENO1 effectively caused significant decline in RA-FLSs proliferation coupled with increased apoptosis of the cells, irrespective of the surrounding oxygen conditions (Figures 2c and 3). Control siRNA-treated FLS cells under similar conditions did not demonstrate such changes in the cells’ proliferation and apoptosis characteristics. OA-FLSs treated the same way as RA-FLSs showed similar proliferation and apoptosis characteristics. These strongly prompt that the overexpressed ENO1 is a crucial biological factor for the survival and hyperproliferation of FLSs. RA is characterized by hyperplastic synovial pannus tissue, which mediates destruction of cartilage and bone. The hyperplastic rheumatoid pannus is characterized by an overabundance of FLS [25]. However, the cellular excesses stem largely from an imbalance between proliferation and apoptosis of FLS [26]. Anomalies in pathways that promote invasiveness and cytokine secretion also favor the survival of FLSs by inducing the overexpression of anti-apoptotic molecules, such as apoptosis regulator Bcl-2 which is overexpressed in synovial samples from patients with RA [27], and decreasing or altering the response to ligation of apoptosis-regulating receptors [1]. Apoptosis is tightly regulated by anti- and pro-apoptotic molecules. Survivin is an important inhibitor of apoptosis that is undetectable in terminally differentiated adult tissues but overexpressed in cancer cells [28,29]. In the present study, we found that decreased expression of ENO1, by siENO1, caused significant reduction
Mod Rheumatol Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
DOI 10.3109/14397595.2015.1014141
in the expression levels of survivin, cyclinB1, and Bcl-2 but enhanced the expression of cleaved caspase3 in RA-FLSs and OA-FLSs. These demonstrate that the molecular mechanisms underlying ENO1 function may involve the activation of antiapoptosis signal pathways and the suppression of pro-apoptosis pathways. Therefore, ENO1 may play an important role in the promotion of rheumatoid synovial hyperplasia via the inhibition of FLSs apoptosis. Considering the vital function of ENO1 in RA-FLSs’ (and OA-FLSs) survival and proliferation, ENO1-targeted therapies could be considered to augment current treatment modalities. In clinical practice, methotrexate (MTX) is the first-line drug for RA patients. However, approximately 50% of the patients ultimately experience clinical resistance to MTX during prolonged therapy [30]. The occurrence of chemotherapy resistance is a challenge in cancer treatment as well but recently, it was shown that the use of a ENO1 small-molecule inhibitor could inhibit the proliferation, migration, and invasive potential of cancer cells; this inhibitory effect was even more pronounced under hypoxic conditions [31]. Additionally, following the suppression of ENO1 in the cancer cells by siRNA interference, radiotherapy, and chemotherapy sensitivities were markedly enhanced [32,33]. Therefore, we deduce that either ENO1 inhibitor alone or in combination with MTX may yield superior therapeutic effect in RA patients, especially in MTX-resistant patients, but further research is needed to ascertain this preposition. Considering that the molecular and growth inhibition observations due to ENO1 knockdown in RA-FLSs and OA-FLSs were similar, although these diseases are pathologically different, ENO1 activity may be restricted not only to the pathogenesis of RA, but also that of OA. In summary, our data strongly suggest that ENO1 may play a crucial role in the hyperproliferation of FLSs in the pathogenesis of RA. We have identified and demonstrated that ENO1 is highly expressed in RA-FLSs cultured under hypoxic conditions. ENO1 may therefore be an attractive target for the development of new therapies for RA.
Acknowledgements The study was supported by grants from the National Natural Science Foundation of China (No.81373203).
Conflict of interest None.
References 1. Bartok B, Firestein GS. Fibroblast-like synoviocytes: key effector cells in rheumatoid arthritis. Immunol Rev. 2010;233(1):233–55. 2. Konisti S, Kiriakidis S, Paleolog EM. Hypoxia–a key regulator of angiogenesis and inflammation in rheumatoid arthritis. Nat Rev Rheumatol. 2012;8(3):153–62. 3. Lund-Olesen K. Oxygen tension in synovial fluids. Arthritis Rheum. 1970;13(6):769–76. 4. Sivakumar B, Akhavani MA, Winlove CP, Taylor PC, Paleolog EM, Kang N. Synovial hypoxia as a cause of tendon rupture in rheumatoid arthritis. J Hand Surg Am. 2008;33(1):49–58. 5. Naughton DP, Haywood R, Blake DR, Edmonds S, Hawkes GE, Grootveld M. A comparative evaluation of the metabolic profiles of normal and inflammatory knee-joint synovial fluids by high resolution proton NMR spectroscopy. FEBS Lett. 1993;332(3):221–5. 6. Peters CL, Morris CJ, Mapp PI, Blake DR, Lewis CE, Winrow VR. The transcription factors hypoxia-inducible factor 1alpha and Ets-1 colocalize in the hypoxic synovium of inflamed joints in adjuvantinduced arthritis. Arthritis Rheum. 2004;50(1):291–6. 7. Ng CT, Biniecka M, Kennedy A, McCormick J, Fitzgerald O, Bresnihan B, et al. Synovial tissue hypoxia and inflammation in vivo. Ann Rheum Dis. 2010;69(7):1389–95. 8. Merry P, Grootveld M, Blake DR. Hypoxic-reperfusion injury in inflamed joints. Lancet. 1989;1(8645):1023.
Decreased expression of alpha-enolase 7 9. Naughton D, Whelan M, Smith EC, Williams R, Blake DR, Grootveld M. An investigation of the abnormal metabolic status of synovial fluid from patients with rheumatoid arthritis by high field proton nuclear magnetic resonance spectroscopy. FEBS Lett. 1993;317(1–2):135–8. 10. Gao J, Zhao R, Xue Y, Niu Z, Cui K, Yu F, et al. Role of enolase-1 in response to hypoxia in breast cancer: exploring the mechanisms of action. Oncol Rep. 2013;29(4):1322–32. 11. Zhang H, Fan LY, Zong M, Sun LS, Lu L. Proteins related to the functions of fibroblast-like synoviocytes identified by proteomic analysis. Clin Exp Rheumatol. 2012;30(2):213–21. 12. Li XJ, Xu M, Zhao XQ, Zhao JN, Chen FF, Yu W, et al. Proteomic analysis of synovial fibroblast-like synoviocytes from rheumatoid arthritis. Clin Exp Rheumatol. 2013;31(4):552–8. 13. Kinloch A, Tatzer V, Wait R, Peston D, Lundberg K, Donatien P, et al. Identification of citrullinated alpha-enolase as a candidate autoantigen in rheumatoid arthritis. Arthritis Res Ther. 2005;7(6):R1421–9. 14. Aaronson RM, Graven KK, Tucci M, McDonald RJ, Farber HW. Non-neuronal enolase is an endothelial hypoxic stress protein. J Biol Chem. 1995;270(46):27752–7. 15. Fontan PA, Pancholi V, Nociari MM, Fischetti VA. Antibodies to stre ptococcal surface enolase react with human alpha-enolase: implications in poststreptococcal sequelae. J Infect Dis. 2000;182(6):1712–21. 16. Sugio K, Sugaya M, Hanagiri T, Yasumoto K. [Tumor marker in primary lung cancer]. J UOEH. 2004;26(4):473–9. 17. Espana L, Martin B, Aragues R, Chiva C, Oliva B, Andreu D, Sierra A. Bcl-x(L)-mediated changes in metabolic pathways of breast cancer cells: from survival in the blood stream to organ-specific metastasis. Am J Pathol. 2005;167(4):1125–37. 18. Zhang D, Tai LK, Wong LL, Chiu LL, Sethi SK, Koay ES. Proteomic study reveals that proteins involved in metabolic and detoxification pathways are highly expressed in HER-2/neu-positive breast cancer. Mol Cell Proteomics. 2005;4(11):1686–96. 19. Wu F, Wang QM, Fan GC, Chen JZ, Chen HP. [Proteomic analysis of paclitaxel-induced apoptosis in MCF-7 human breast carcinoma cells]. Zhonghua Zhong Liu Za Zhi. 2006;28(6):418–21. 20. Dowling P, Meleady P, Dowd A, Henry M, Glynn S, Clynes M. Proteomic analysis of isolated membrane fractions from superinvasive cancer cells. Biochim Biophys Acta. 2007;1774(1):93–101. 21. Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF, Cooper NS, et al. The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum. 1988;31(3):315–24. 22. Altman RD. Criteria for the classification of osteoarthritis of the knee and hip. Scand J Rheumatol Suppl. 1987;65:31–9. 23. Semenza GL, Jiang BH, Leung SW, Passantino R, Concordet JP, Maire P, Giallongo A. Hypoxia response elements in the aldolase A, enolase 1, and lactate dehydrogenase A gene promoters contain essential binding sites for hypoxia-inducible factor 1. J Biol Chem. 1996;271(51):32529–37. 24. Sedoris KC, Thomas SD, Miller DM. Hypoxia induces differential translation of enolase/MBP-1. BMC Cancer. 2010;10:157. 25. Bottini N, Firestein GS. Duality of fibroblast-like synoviocytes in RA: passive responders and imprinted aggressors. Nat Rev Rheumatol. 2013;9(1):24–33. 26. Firestein GS, Yeo M, Zvaifler NJ. Apoptosis in rheumatoid arthritis synovium. J Clin Invest. 1995;96(3):1631–8. 27. Matsumoto S, Muller-Ladner U, Gay RE, Nishioka K, Gay S. Ultrastructural demonstration of apoptosis, Fas and Bcl-2 expression of rheumatoid synovial fibroblasts. J Rheumatol. 1996;23(8):1345–52. 28. Tanaka K, Iwamoto S, Gon G, Nohara T, Iwamoto M, Tanigawa N. Expression of survivin and its relationship to loss of apoptosis in breast carcinomas. Clin Cancer Res. 2000;6(1):127–34. 29. Blanc-Brude OP, Mesri M, Wall NR, Plescia J, Dohi T, Altieri DC. Therapeutic targeting of the survivin pathway in cancer: initiation of mitochondrial apoptosis and suppression of tumor-associated angiogenesis. Clin Cancer Res. 2003;9(7):2683–92. 30. Wolfe F. The epidemiology of drug treatment failure in rheumatoid arthritis. Baillieres Clin Rheumatol. 1995;9(4):619–32. 31. Jung DW, Kim WH, Park SH, Lee J, Kim J, Su D. A unique small molecule inhibitor of enolase clarifies its role in fundamental biological processes. ACS Chem Biol. 2013;8(6):1271–82. 32. Georges E, Bonneau AM, Prinos P. RNAi-mediated knockdown of alpha-enolase increases the sensitivity of tumor cells to antitubulin chemotherapeutics. Int J Biochem Mol Biol. 2011;2(4):303–8. 33. Song Y, Luo Q, Long H, Hu Z, Que T, Zhang X, et al. Alpha-enolase as a potential cancer prognostic marker promotes cell growth, migration, and invasion in glioma. Mol Cancer. 2014;13:65.
ORIGINAL ARTICLE
Decreased expression of alpha-enolase inhibits the proliferation of hypoxia-induced rheumatoid arthritis fibroblasts-like synoviocytes Sha Sha Fan, Ming Zong, Hui Zhang, Ying Lu, Tian Bao Lu, and Lie Ying Fan
Mod Rheumatol Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
Department of Clinical Laboratory, Shanghai East Hospital, Tong Ji University, Shanghai, P. R. China Abstract
Keywords
Objectives. To investigate the effect of decreased alpha-enolase (ENO1) expression on rheumatoid arthritis fibroblasts-like synoviocytes (RA-FLSs) proliferation in response to hypoxia, and elucidate the possible mechanisms involved. Methods. RA-FLSs and osteoarthritis fibroblasts-like synoviocytes (OA-FLSs) were cultured in trigas incubators with different oxygen concentrations (3% O2, 7% O2, and 21% O2). 3% O2 (hypoxia) and 7% O2 conditions simulated intra-articular oxygen concentrations as observed in RA and healthy individual, respectively. 21% O2 represented oxygen condition for normal cell culture. ENO1-knockdown FLSs were established using ENO1-siRNA. The expression level of ENO1 was detected using reverse transcription polymerase chain reaction or RT-PCR and Western blot. Proliferation and apoptosis of RA-FLSs and OA-FLSs were assessed using 3-(4,5-dimethylthiazol-2yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2 H-tetrazolium or MTS assay and flow cytometry, respectively. Western blot analysis was used to detect key proteins involved in apoptosis. Results. ENO1 gene expression was remarkably upregulated, as well as its translation into protein, in RA-FLSs and OA-FLSs that were cultured in 3% O2 concentration. RA-FLSs and OA-FLSs that were cultured under hypoxic conditions hyperproliferated compared with similar cells under normaxic conditions. Neither 7% O2 nor 21% O2 condition had any significant effect on ENO1 expression. ENO1-siRNA-transfected FLSs, but not control-siRNA FLSs, showed markedly decreased proliferation. Additionally, ENO1 expression was found to promote significantly higher expression levels of the anti-apoptotic proteins Bcl-2, surviving, and cyclinB1, but inhibited the expression of cleaved caspase3. Conclusion. ENO1 may be crucial in the regulation of the proliferation and survival of synovial fibroblasts.
Alpha-enolase, Fibroblasts-like synoviocytes, Hypoxia, Proliferation, Rheumatoid arthritis
Introduction Synovial tissue from healthy individuals consists of 2–3 layers of cells, and is composed of two types of cells in relatively equal proportion: Type A or macrophage-like synovial cells and Type B or fibroblasts-like synoviocytes (FLSs). However, rheumatoid synovial tissue expands from 1–2 cells to about 10–20 layers of cells. This hypercellularity is due to an increase in both Type A and B cells which are present in the tissue structure. Lymphocytes and macrophages are often recruited and activated in the tissue structure, and together with the hyperplastic synovial FLSs, release inflammatory cytokines and enzymes which orchestrate the destruction of cartilage and bone [1]. Inadequate oxygenation, termed “hypoxia,” is thought to drive rheumatoid arthritis (RA)associated synovial angiogenesis through the expression of hypoxia-inducible molecules, including vascular endothelial growth factor [2]. The hypoxic nature of RA synovium was first revealed in 1970 using a Clark-type electrode to measure the oxygen tension in synovial fluid samples from patients. The concentration of oxygen in RA joint cavity was approximately 3%, while in healthy Correspondence to: Lieying Fan, PhD, Department of Clinical Laboratory, Shanghai East Hospital, Tong Ji University, 150 Ji Mo Road, Shanghai 200120, P. R. China. Tel: 021-61569170. Fax: 021-61569170. E-mail:[email protected]
History Received 5 December 2014 Accepted 28 January 2015 Published online 31 March 2015
individuals it was approximately 7% [3,4]. These values have been confirmed in other studies which employed different measurement techniques including nuclear magnetic resonance spectroscopy, pimonidazole, as well as video arthroscopy [5–7]. Several studies have also demonstrated that oxygen consumption in RA synovium is elevated, possibly due to the increased proliferative activity of synovial cells, and that glucose is also oxidized via an anaerobic pathway [8,9]. In the context of hypoxia, compensatory adaptation is mainly achieved through the glycolytic process to obtain the necessary energy for life’s activities [10]. Our group’s previous study [11] and that of Li et al [12], using proteomic analysis, found that alpha-enolase (ENO1) was overexpressed in RA-FLSs. Additionally, ENO1 was detected in RA joint, where it colocalized with citrullinated proteins [13]. ENO1 is a highly conserved, multifunctional protein that, in addition to its role in glycolysis, also binds plasminogen. It is known to be induced by hypoxia [14] and by pro-inflammatory stimuli [15], both of which are features of the synovial membrane microenvironment in RA. ENO1 is expressed during cell differentiation and is used as a marker of differentiation in the grading of tumors [16]. The overexpression of ENO1 and other enzymes in the glycolytic process during hypoxia sustain the high-energy requirement adaptation of tumor cells, and consequently increase their survival and proliferation [2,17,18], as well as their invasive and metastatic ability [19,20].
2 S. S. Fan et al. This study investigated the molecular characteristics of FLSs hyperproliferation in RA pathogenesis. We used tri-gas incubator to simulate intra-articular hypoxia microenvironment as observed in RA. We found that the expression of ENO1 gene in RA-FLSs was markedly enhanced when cultured at 3% O2 concentration (hypoxic), as compared with similar cells cultured under normoxic conditions. Our data series demonstrated that ENO1 was important for the hyperproliferation of RA-FLSs, thus RA pathogenesis, and that ENO1 may be an ideal therapeutic target for RA.
Materials and methods
Mod Rheumatol Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
Isolation and culture of FLSs Primary FLS cells were prepared from synovectomized tissues obtained from six patients with RA and six patients with osteoarthritis (OA) who were undergoing joint replacement surgery at the Shanghai East Hospital. The tissue samples were immediately placed in Roswell Park Memorial Institute (RPMI) 1640 medium and processed within 4 h for FLSs. Informed consent was obtained from each of the enrolled patient, and the study protocol was approved by the Ethics Committee of Shanghai East Hospital. The mean age of the RA patients was 58 years (two males and four females, age range: 48–74 years) and the mean age of OA patients was 60 years (three males and three females, age range: 68–77 years). Each patient had been diagnosed with the respective disease for at least 24 months. The patients had visible joint erosions by radiography of the hand, and they all met the diagnostic criteria of the American College of Rheumatology (formerly the American Rheumatism Association) for classification of RA and OA [21,22]. Synovial tissues were minced in RPMI 1640 medium and evenly spread at the bottom of cell culture flasks, and incubated at 37°C for 6 h. Upon removal of the old medium, the tissues were incubated in RPMI 164 medium supplemented with 10% fetal calf serum (complete medium) at 37°C in 5% CO2 atmosphere. Three out of the six seeded RA-FLSs (redesignated as N4, N16, and N19) and three out of the six seeded OA-FLSs (redesignated as C6, C8, and C11) thrived and were used for all subsequent experiments. The culture medium was replaced every 3 days until the primary cultures reached 70–80% confluence and then divided. The FLSs were further grown over 4–8 passages. To characterize the cytological phenotype of the synovial cultures, the cells were stained with mouse mAb against human CD14 and CD90 (9011-0149-025 and eBio5E10, respectively, eBioscience, San Diego, CA, USA) and showed 2.8% CD14 and 97.0% CD90 expression as measured by flow cytometry (Beckman Coulter, Fullerton, CA, USA). Cells at passages 5–8 were phenotypically homogenous by cytological observations. Hypoxic treatment Hypoxic conditions were simulated in a tri-gas incubator (Forma Scientific, Div. of Mallinckrodt, Inc, Marietta, Ohio). FLSs were cultured under 92% N2, 5% CO2, and 3% O2 gas-mixture condition at 37°C to simulate joint cavity hypoxic microenvironment of RA patients, or under 88% N2, 5% CO2, and 7% O2 gas-mixture condition at 37°C to simulate articular cavity oxygen concentration of healthy individuals. A normal culture gas-mixture condition with 21% O2 component was also set up as control. Quantitative RT-PCR analysis Total RNA was extracted from FLSs using TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Reverse transcription was performed using first-strand cDNA Synthesis Kit (Takara, Dalian, China) according to the manufacturer’s instructions. Real-time polymerase chain reaction (PCR) was performed using Premix Ex Taq SYBR Green PCR (Takara, Dalian, China) according to the manufacturer’s instructions on
Mod Rheumatol, 2015; Early Online: 1–7
an ABI PRISM 7500 (Applied Biosystems, Foster City, CA, USA). The sequences of primers used were ENO1—Forward: 5′ACTGCTATTGGGAAAGCTGGCTAC-3′, Reverse: 5′-CACTGT GAGATCATCCCCCACTAC-3’; and glyceraldehyde 3-phosphate dehydrogenase (GAPDH)—Forward: 5′- TGACTTCAACAGCGACACCCA 3′, Reverse: 5′- CACCCTGTTGCTGTAGCCA AA 3′. GAPDH served as an internal control. Western blot analysis Each RA-FLS and OA-FLS sample was lysed in boiled sample buffer containing 1% sodium dodecyl sulfate (SDS). The protein concentration in the supernatant was determined using the Bradford method (Bio-Rad, Hercules, CA, USA). Normalized amount of total protein (about 120 mg) of each sample was separated by 10% SDSpolyacrylamide gel electrophoresis or PAGE and transferred onto a nitrocellulose membrane. This was then immersed in blocking buffer (5% skimmed milk and 0.1% Tween-20 in phosphate-buffered saline [PBS], pH: 7.4) for 1 h at room temperature and subsequently incubated with the appropriate primary antibody in blocking buffer overnight at 4°C. Primary antibodies used included anti-ENO1 (ab155955), anti-caspase3 (ab32042), and anti-cleaved-caspase3 (ab13847) (all purchased from Abcam, Cambridge, MA, USA); antisurvivin (sc-17779), cyclinB1 (sc-752), and b-actin (sc-47778) (all purchased from Santa Cruz Biotechnology Inc, Santa Cruz, California, USA); and anti-Bcl2(#2876)(Cell Signal Technology Inc, CST, USA). After incubation, the membrane was washed and probed with horseradish peroxidase-labeled immunoglobulin G or IgG antibody in PBS (supplemented with 0.05% Tween-20 and 5% skimmed milk powder) for 30 min at room temperature. The proteins in the membrane were visualized using enhanced chemiluminescence (Amersham, Little Chalfont, Bucks, UK) and the bands were detected by autoradiography with X-ray film (Fujifilm, Japan). siRNA synthesis and transfection Predesigned siRNA duplexes (sense strand: 5′-CUCAAAGGCU GUUGAGCACAUCAAU-3′) targeting nucleotides 337–352 of the human ENO1 mRNA (RefSeq NM_001428) were purchased from Invitrogen (Invitrogen, Carlsbad, CA, USA). As a negative control, the scrambled sequence 5′-CCAGGG UUCCUAAUCGGAUUUGCUA-3′ which is without significant homology to any human gene was also designed and obtained from Invitrogen. RA-FLSs and OA-FLSs (N4, N16, N19 and C6, C8, C11, respectively, at passage 5) were separately seeded in 6-well plate (3 105 per well), 24-well plate (5 104 per well), and 96-well plate (3 103 per well) in RPMI 1640 complete medium. The cells were transfected with ENO1-siRNA (siENO1) on the first day and using Lipofectamine 2000 Transfection Reagent (Life Technologies Corporation, Carlsbad) on the next day according to the manufacturer’s protocol. At 6 h post transfection, the transfection medium was replaced with fresh complete culture medium. FLSs in 6-well plate and 24-well plate were harvested at 48 h post transfection for reverse transcription PCR (RT-PCR), Western blot (WB), and apoptosis analyses. FLSs in 96-well plate were used for proliferation studies by 3-(4,5-dimethylthiazol-2yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2 H-tetrazolium (MTS) assay at 24 h, 48 h, and 72 h post transfection. Cell proliferation assays After hypoxia induction and transfection, the medium in each well was replaced with 100 mL of fresh serum-free medium containing 20 mL of MTS (Promega, Madison, WI, USA) and incubated at 37°C for 4 h. The absorbance of the medium was measured at 490 nm. Each assay was performed in quadruplicate, with appropriate controls. All tests were repeated three times.
Decreased expression of alpha-enolase 3
DOI 10.3109/14397595.2015.1014141
Mod Rheumatol Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
Figure 1. Effect of hypoxia on the proliferation and ENO1 expression in RA-FLS and OA-FLS. (a) Effect of different oxygen concentrations on cell proliferation by MTS assay. (b) ENO1 mRNA expression level by qRT-PCR analysis and (c) ENO1 protein expression level by WB analysis in RA-FLS and OA-FLS. The data in (a) and (b) are mean SD obtained from three separate experiments. Data in (c) are representative of three separate experiments. *p 0.05.
Flow cytometry analysis of apoptosis RA-FLSs and OA-FLSs were trypsinized and collected for apoptosis assessment using Annexin V-FITC Apoptosis Detection Kit (eBioscience, San Diego, CA, USA). Briefly, FLSs were washed twice with cold PBS and resuspended in 500 mL of binding buffer (10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid or HEPES-NaOH at pH: 7.4, NaCl, and 2.5 mM CaCl2) at a density of 1 106 cells/ml. After the addition of
5 ml of Annexin V-FITC solution and propidium iodide (PI) (1 mg/ml), the cells were incubated for 15 min at room temperature and then analyzed on a flow cytometer (Beckman Coulter, Fullerton, CA, USA). Statistical analysis The data are expressed as mean standard deviation (SD) and all statistical analyses were performed using SPSS version 18.0
4 S. S. Fan et al.
Mod Rheumatol, 2015; Early Online: 1–7
Mod Rheumatol Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
Figure 2. Effect of ENO1 knockdown on the growth of RA-FLSs and OAFLSs. (a) ENO1 expression level following knockdown as measured by qRT-PCR and (b) and WB analysis. (c) The transfected cells were cultured under 3% O2 or 21% O2 condition and their proliferation rates were measured for 3 consecutive days. Absorbance was measured to directly reflect cell proliferation using MTS assay. The data in (a) are mean SD obtained from three separate experiments. Data in (b) are representative of three separate experiments. The data in (c) are mean SD obtained from single experiments performed in triplicate cultures. *p 0.05.
statistical software (SPSS Inc, Chicago, IL, USA). Analysis of variance or ANOVA followed by least significant difference or LSD multiple comparison test was used to compare the means of multiple groups. Two-tailed Student’s t-test was also used where appropriate. All experiments were repeated at least three times. Statistical significance was set at p 0.05.
Results Hypoxia promotes FLSs proliferation and induces ENO1 expression To investigate the effect of hypoxia on RA-FLS and OA-FLS proliferation, FLSs were cultured under conditions of different oxygen
Mod Rheumatol Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
DOI 10.3109/14397595.2015.1014141
Decreased expression of alpha-enolase 5
Figure 3. Effect of ENO1 knockdown on apoptosis of RA-FLSs and OA-FLSs. (a) Annexin V–PI flow cytometry analysis for apoptosis. (b) Bar graph data of the early apoptotic cells (lower-right quadrant). Data in (a) are representative of three separate experiments, and in (b) are mean SD obtained from three separate experiments, *p 0.05.
concentrations (3% O2, 7% O2, and 21% O2) for 48 h. FLSs were observed to vigorously grow under 3%O2 condition, with no such growth pattern seen in similar cells cultured in 7% O2 or 21% O2 condition (Figure 1a). Next, we analyzed the effect of hypoxia on the gene and protein expressions of ENO1 in RA-FLSs and OAFLSs using qRT-PCR (Figure 1b) and WB (Figure 1c), respectively. Compared with 21% O2, ENO1 mRNA was consistently upregulated in the hyperactive RA-FLSs cultured under 3%O2 condition but not under 7% O2 condition. OA-FLSs also demonstrated similar results as RA-FLSs (Figures 1a–c). ENO1-siRNA effectively attenuates hypoxia-induced hyperproliferation of FLSs RA-FLSs and OA-FLSs were transfected with ENO1-siRNA (siENO1) or control-siRNA (siC). The transfected cells were cultured under either 3% O2 or 21% O2 condition. The growth kinetics
of the transfected RA-FLSs were monitored for 3 consecutive days (Figure 2c). The expression levels of the corresponding ENO1 mRNA and protein were measured by quantitative RT-PCR (qRTPCR) (Figure 2a) and WB (Figure 2b), respectively. siENO1 effectively inhibited ENO1 gene expression, irrespective of the oxygen concentration of the culture environment (Figure 2a). This genetic activity directly correlated with the protein expression of ENO1 in the cells (Figure 2b). Corroboratively, the proliferative potential of RA-FLSs under both conditions (3% O2 and 21% O2) significantly reduced compared with that in siC-treated cells under similar conditions (Figure 2c). Similar observations were also made with OA-FLSs (Figures 2a–c). ENO1 knockdown promotes apoptosis of FLSs Following transfection, the number of early apoptotic FLS cells significantly increased, irrespective of oxygenation condition
Mod Rheumatol Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
6 S. S. Fan et al.
Mod Rheumatol, 2015; Early Online: 1–7
Figure 4. qRT-PCR and WB analyses for the detection of mRNA and protein expression levels, respectively, of apoptosis-related factors in RA-FLSs and OA-FLSs following siENO1 or siC transfection. The data are representative of three separate experiments.
(3%O2 or 21%O2), in siENO1-transfected cells as compared with their corresponding siC-transfected cells (Figure 3a and b). Both RA-FLSs and OA-FLSs showed similar outcomes (Figure 3a and b). ENO1 modulates apoptosis-related factors of FLSs to inhibit apoptosis qRT-PCR and WB analyses revealed that knocking down ENO1 yielded only marginal effect on the expression of caspase3 but significantly enhanced the expression of cleaved caspase3, its active form. On the contrary, the expression levels of Bcl-2, survivin, and cyclinB1 significantly reduced in all the cells cultured under the different oxygen conditions (3% O2 and 21% O2). However, the decline in expression levels of Bcl-2, survivin, and cyclinB1 were of varying degrees in the cells cultured in 3% O2 concentration. These data suggest that ENO1 may exert its anti-apoptosis effect by regulating the expression of certain apoptotic-related factors in FLSs, as observed in RA-FLSs and OA-FLSs (Figure 4).
Discussion Glycolysis is a compensatory process of energy metabolism during hypoxia. ENO1 is the most sensitive marker of pathological change and also the glycolytic enzyme found to be upregulated when cells are under anoxic condition for a long time; thus, it is a hypoxia stress protein [23]. Malignant cells adapt to hypoxia by modulating ENO1/myelin basic protein-1 levels as an induction mechanism for tumor cells to attain hyperglycolytic state. This important “feedback” mechanism may help transformed cells to escape the apoptotic cascade, and allowing for survival during limited glucose and oxygen availability [24]. Could RA-FLSs (and/or OA-FLSs) be employing similar mechanisms for survival? Research has indicated that RA-FLS population in RA is abundant due to an imbalance between cell proliferation, survival, and death [1]. However, current knowledge on the direct effect of ENO1 on the biological behavior of FLSs is extremely limited.
In this study, we found that RA-FLSs (and OA-FLSs) excellently thrived under hypoxic condition, and ENO1 gene and protein were markedly expressed in RA-FLSs (Figure 1). Gas-mixture condition of 7% O2 (oxygen concentration of intra-articular healthy individual) had no apparent effect on the proliferation of FLSs as well as the expression of ENO1 (Figures 1, 2a and b). These data suggest that hypoxia may be an inducer of the excessive proliferation of RA-FLSs (and OA-FLSs) and ENO1 is intimately linked with the proliferation phenomenon. To examine the specific role of ENO1 gene in RA-FLSs and OAFLSs proliferation, ENO1-siRNA (siENO1) was introduced into the cells. The inhibition of ENO1 by siENO1 effectively caused significant decline in RA-FLSs proliferation coupled with increased apoptosis of the cells, irrespective of the surrounding oxygen conditions (Figures 2c and 3). Control siRNA-treated FLS cells under similar conditions did not demonstrate such changes in the cells’ proliferation and apoptosis characteristics. OA-FLSs treated the same way as RA-FLSs showed similar proliferation and apoptosis characteristics. These strongly prompt that the overexpressed ENO1 is a crucial biological factor for the survival and hyperproliferation of FLSs. RA is characterized by hyperplastic synovial pannus tissue, which mediates destruction of cartilage and bone. The hyperplastic rheumatoid pannus is characterized by an overabundance of FLS [25]. However, the cellular excesses stem largely from an imbalance between proliferation and apoptosis of FLS [26]. Anomalies in pathways that promote invasiveness and cytokine secretion also favor the survival of FLSs by inducing the overexpression of anti-apoptotic molecules, such as apoptosis regulator Bcl-2 which is overexpressed in synovial samples from patients with RA [27], and decreasing or altering the response to ligation of apoptosis-regulating receptors [1]. Apoptosis is tightly regulated by anti- and pro-apoptotic molecules. Survivin is an important inhibitor of apoptosis that is undetectable in terminally differentiated adult tissues but overexpressed in cancer cells [28,29]. In the present study, we found that decreased expression of ENO1, by siENO1, caused significant reduction
Mod Rheumatol Downloaded from informahealthcare.com by Emory University on 08/06/15 For personal use only.
DOI 10.3109/14397595.2015.1014141
in the expression levels of survivin, cyclinB1, and Bcl-2 but enhanced the expression of cleaved caspase3 in RA-FLSs and OA-FLSs. These demonstrate that the molecular mechanisms underlying ENO1 function may involve the activation of antiapoptosis signal pathways and the suppression of pro-apoptosis pathways. Therefore, ENO1 may play an important role in the promotion of rheumatoid synovial hyperplasia via the inhibition of FLSs apoptosis. Considering the vital function of ENO1 in RA-FLSs’ (and OA-FLSs) survival and proliferation, ENO1-targeted therapies could be considered to augment current treatment modalities. In clinical practice, methotrexate (MTX) is the first-line drug for RA patients. However, approximately 50% of the patients ultimately experience clinical resistance to MTX during prolonged therapy [30]. The occurrence of chemotherapy resistance is a challenge in cancer treatment as well but recently, it was shown that the use of a ENO1 small-molecule inhibitor could inhibit the proliferation, migration, and invasive potential of cancer cells; this inhibitory effect was even more pronounced under hypoxic conditions [31]. Additionally, following the suppression of ENO1 in the cancer cells by siRNA interference, radiotherapy, and chemotherapy sensitivities were markedly enhanced [32,33]. Therefore, we deduce that either ENO1 inhibitor alone or in combination with MTX may yield superior therapeutic effect in RA patients, especially in MTX-resistant patients, but further research is needed to ascertain this preposition. Considering that the molecular and growth inhibition observations due to ENO1 knockdown in RA-FLSs and OA-FLSs were similar, although these diseases are pathologically different, ENO1 activity may be restricted not only to the pathogenesis of RA, but also that of OA. In summary, our data strongly suggest that ENO1 may play a crucial role in the hyperproliferation of FLSs in the pathogenesis of RA. We have identified and demonstrated that ENO1 is highly expressed in RA-FLSs cultured under hypoxic conditions. ENO1 may therefore be an attractive target for the development of new therapies for RA.
Acknowledgements The study was supported by grants from the National Natural Science Foundation of China (No.81373203).
Conflict of interest None.
References 1. Bartok B, Firestein GS. Fibroblast-like synoviocytes: key effector cells in rheumatoid arthritis. Immunol Rev. 2010;233(1):233–55. 2. Konisti S, Kiriakidis S, Paleolog EM. Hypoxia–a key regulator of angiogenesis and inflammation in rheumatoid arthritis. Nat Rev Rheumatol. 2012;8(3):153–62. 3. Lund-Olesen K. Oxygen tension in synovial fluids. Arthritis Rheum. 1970;13(6):769–76. 4. Sivakumar B, Akhavani MA, Winlove CP, Taylor PC, Paleolog EM, Kang N. Synovial hypoxia as a cause of tendon rupture in rheumatoid arthritis. J Hand Surg Am. 2008;33(1):49–58. 5. Naughton DP, Haywood R, Blake DR, Edmonds S, Hawkes GE, Grootveld M. A comparative evaluation of the metabolic profiles of normal and inflammatory knee-joint synovial fluids by high resolution proton NMR spectroscopy. FEBS Lett. 1993;332(3):221–5. 6. Peters CL, Morris CJ, Mapp PI, Blake DR, Lewis CE, Winrow VR. The transcription factors hypoxia-inducible factor 1alpha and Ets-1 colocalize in the hypoxic synovium of inflamed joints in adjuvantinduced arthritis. Arthritis Rheum. 2004;50(1):291–6. 7. Ng CT, Biniecka M, Kennedy A, McCormick J, Fitzgerald O, Bresnihan B, et al. Synovial tissue hypoxia and inflammation in vivo. Ann Rheum Dis. 2010;69(7):1389–95. 8. Merry P, Grootveld M, Blake DR. Hypoxic-reperfusion injury in inflamed joints. Lancet. 1989;1(8645):1023.
Decreased expression of alpha-enolase 7 9. Naughton D, Whelan M, Smith EC, Williams R, Blake DR, Grootveld M. An investigation of the abnormal metabolic status of synovial fluid from patients with rheumatoid arthritis by high field proton nuclear magnetic resonance spectroscopy. FEBS Lett. 1993;317(1–2):135–8. 10. Gao J, Zhao R, Xue Y, Niu Z, Cui K, Yu F, et al. Role of enolase-1 in response to hypoxia in breast cancer: exploring the mechanisms of action. Oncol Rep. 2013;29(4):1322–32. 11. Zhang H, Fan LY, Zong M, Sun LS, Lu L. Proteins related to the functions of fibroblast-like synoviocytes identified by proteomic analysis. Clin Exp Rheumatol. 2012;30(2):213–21. 12. Li XJ, Xu M, Zhao XQ, Zhao JN, Chen FF, Yu W, et al. Proteomic analysis of synovial fibroblast-like synoviocytes from rheumatoid arthritis. Clin Exp Rheumatol. 2013;31(4):552–8. 13. Kinloch A, Tatzer V, Wait R, Peston D, Lundberg K, Donatien P, et al. Identification of citrullinated alpha-enolase as a candidate autoantigen in rheumatoid arthritis. Arthritis Res Ther. 2005;7(6):R1421–9. 14. Aaronson RM, Graven KK, Tucci M, McDonald RJ, Farber HW. Non-neuronal enolase is an endothelial hypoxic stress protein. J Biol Chem. 1995;270(46):27752–7. 15. Fontan PA, Pancholi V, Nociari MM, Fischetti VA. Antibodies to stre ptococcal surface enolase react with human alpha-enolase: implications in poststreptococcal sequelae. J Infect Dis. 2000;182(6):1712–21. 16. Sugio K, Sugaya M, Hanagiri T, Yasumoto K. [Tumor marker in primary lung cancer]. J UOEH. 2004;26(4):473–9. 17. Espana L, Martin B, Aragues R, Chiva C, Oliva B, Andreu D, Sierra A. Bcl-x(L)-mediated changes in metabolic pathways of breast cancer cells: from survival in the blood stream to organ-specific metastasis. Am J Pathol. 2005;167(4):1125–37. 18. Zhang D, Tai LK, Wong LL, Chiu LL, Sethi SK, Koay ES. Proteomic study reveals that proteins involved in metabolic and detoxification pathways are highly expressed in HER-2/neu-positive breast cancer. Mol Cell Proteomics. 2005;4(11):1686–96. 19. Wu F, Wang QM, Fan GC, Chen JZ, Chen HP. [Proteomic analysis of paclitaxel-induced apoptosis in MCF-7 human breast carcinoma cells]. Zhonghua Zhong Liu Za Zhi. 2006;28(6):418–21. 20. Dowling P, Meleady P, Dowd A, Henry M, Glynn S, Clynes M. Proteomic analysis of isolated membrane fractions from superinvasive cancer cells. Biochim Biophys Acta. 2007;1774(1):93–101. 21. Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF, Cooper NS, et al. The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum. 1988;31(3):315–24. 22. Altman RD. Criteria for the classification of osteoarthritis of the knee and hip. Scand J Rheumatol Suppl. 1987;65:31–9. 23. Semenza GL, Jiang BH, Leung SW, Passantino R, Concordet JP, Maire P, Giallongo A. Hypoxia response elements in the aldolase A, enolase 1, and lactate dehydrogenase A gene promoters contain essential binding sites for hypoxia-inducible factor 1. J Biol Chem. 1996;271(51):32529–37. 24. Sedoris KC, Thomas SD, Miller DM. Hypoxia induces differential translation of enolase/MBP-1. BMC Cancer. 2010;10:157. 25. Bottini N, Firestein GS. Duality of fibroblast-like synoviocytes in RA: passive responders and imprinted aggressors. Nat Rev Rheumatol. 2013;9(1):24–33. 26. Firestein GS, Yeo M, Zvaifler NJ. Apoptosis in rheumatoid arthritis synovium. J Clin Invest. 1995;96(3):1631–8. 27. Matsumoto S, Muller-Ladner U, Gay RE, Nishioka K, Gay S. Ultrastructural demonstration of apoptosis, Fas and Bcl-2 expression of rheumatoid synovial fibroblasts. J Rheumatol. 1996;23(8):1345–52. 28. Tanaka K, Iwamoto S, Gon G, Nohara T, Iwamoto M, Tanigawa N. Expression of survivin and its relationship to loss of apoptosis in breast carcinomas. Clin Cancer Res. 2000;6(1):127–34. 29. Blanc-Brude OP, Mesri M, Wall NR, Plescia J, Dohi T, Altieri DC. Therapeutic targeting of the survivin pathway in cancer: initiation of mitochondrial apoptosis and suppression of tumor-associated angiogenesis. Clin Cancer Res. 2003;9(7):2683–92. 30. Wolfe F. The epidemiology of drug treatment failure in rheumatoid arthritis. Baillieres Clin Rheumatol. 1995;9(4):619–32. 31. Jung DW, Kim WH, Park SH, Lee J, Kim J, Su D. A unique small molecule inhibitor of enolase clarifies its role in fundamental biological processes. ACS Chem Biol. 2013;8(6):1271–82. 32. Georges E, Bonneau AM, Prinos P. RNAi-mediated knockdown of alpha-enolase increases the sensitivity of tumor cells to antitubulin chemotherapeutics. Int J Biochem Mol Biol. 2011;2(4):303–8. 33. Song Y, Luo Q, Long H, Hu Z, Que T, Zhang X, et al. Alpha-enolase as a potential cancer prognostic marker promotes cell growth, migration, and invasion in glioma. Mol Cancer. 2014;13:65.
