Decreased levels of the androgen receptor in the mature rat phallus are associated with decreased levels of androgen receptor messenger ribonucleic acid.

00l3-7227/91/1292-1093$03.00/0 Endocrinology Copyright ^ 1991 by The Endocrine Society

Vol. 129, No. 2 Printed in U.S.A.

Decreased Levels of the Androgen Receptor in the Mature Rat Phallus Are Associated with Decreased Levels of Androgen Receptor Messenger Ribonucleic Acid* KAREN K. TAKANE, JEAN D. WILSON, AND MICHAEL J. McPHAULf Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, Texas 752358857

ABSTRACT. Growth of the penis at sexual maturation is under the control of androgens, but growth ceases as the organ reaches adult size despite continued high levels of circulating androgen. Previous studies have shown that the cessation of penile growth is associated with a decrease in the quantity of androgen receptor, as detected by ligand binding and immunological methods. In the current studies we demonstrate that the decreased androgen receptor levels correlate with a decrease in androgen receptor mRNA content in the penile corpus and os, but not in the glans penis. These findings suggest that modulation of androgen receptor mRNA levels in the body of the penis may be important to the control of androgen-dependent growth

D

in the tissue, and that the control of androgen receptor mRNA levels differs among the different cell types that comprise the penis. To explore the mechanisms controlling androgen receptor expression, we examined the transcription initiation site of the rat androgen receptor gene in ventral prostate and in three compartments of the penis: the corpus, the urethra, and the glans penis. The same promoter is employed in all preparations, suggesting that the different patterns of androgen receptor mRNA expression in these tissues with age are controlled by factors that modulate the activity of the same promoter. (Endocrinology 129: 1093-1100, 1991)

expression in the rat phallus at different times during development and identify the androgen receptor gene promoter that is employed in tissues that show different patterns of androgen receptor expression.

EVELOPMENT of the male internal and external genitalia is dependent on the actions of testosterone and dihydrotestosterone (1). In some tissues, such as the prostates of dog and man, androgen-mediated growth continues throughout life, while in other tissues, such as the penis, growth is controlled by androgens only during a portion of the lifespan. Thus, growth of the penis ceases after puberty despite the continued presence of high levels of circulating androgens. The loss of androgen responsiveness is correlated with a decline in the levels of androgen receptor, as detected by assays of ligand binding (2, 3). Furthermore, immunological studies of androgen receptor using specific polyclonal antibodies indicate that the androgen receptor diminishes in specific compartments in the developing rat phallus, particularly the os and corpus (4). In the present study we examine the levels of androgen receptor mRNA

Materials and Methods Chemicals

Received January 15, 1991. * This work was supported by NIH Grant DK-03892, a Basil O'Connor Award from the March of Dimes, the Medical Life and Health Insurance Medical Research Fund, the Welch Foundation, the Charles E. Culpeper Foundation, Inc., the Perot Family Foundation, and Institutional Grant BRSG 2-S07-RR-07175-14 from the Biomedical Research Support Grant Program, Division of Research Resources, NIH. t Culpeper Medical Scholar. To whom requests for reprints should be addressed.

Zetaprobe was obtained from Bio-Rad Laboratories (Richmond, CA). The Bluescript SK(M13+) and KS(M13+) plasmids and the T3 and T7 RNA polymerases were obtained from Stratagene (La Jolla, CA). Taql DNA polymerase was purchased from Perkin-Elmer Corp. (Norwalk, CT). RNAsin and RQl-DNAse were sold by Promega Corp. (Madison, WI). [32P] UTP (SA, 800 Ci/mmol) and [32P]dCTP (SA, 3000 Ci/mmol) were purchased from Amersham Corp. (Arlington Heights, IL). Ribonuclease-A (type III) and ribonuclease-Tj (grade IV) were obtained from Sigma Chemical Co. (St. Louis, MO). Guanidinium isothiocyanate (GTC) was purchased from Fluka Chemical Corp. (Ronkonkoma, NY). Cesium chloride was obtained from Bethesda Research Laboratories (Gaithersburg, MD). RNA isolation and purification RNA was prepared using two different protocols. In the first, male Holtzman Sprague-Dawley rats (Harlan Sprague-Dawley, Inc., Madison, WI) of varying ages were killed under ether

1093

The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 18 June 2014. at 12:11 For personal use only. No other uses without permission. . All rights reserved.

ANDROGEN RECEPTOR mRNA IN THE RAT PHALLUS

1094

anesthesia, and the penis, ventral prostate, and lungs were removed and homogenized separately in 7 vol 6 M GTC containing 25 mM sodium citrate, pH 7.0, and 0.1 M /3-mercaptoethanol and centrifuged over a 5.7-M cesium chloride step gradient (5). The second technique employed a modification of the guanidinium/hot phenol method (6). In brief, tissue was homogenized in 7 vol 5.2 M GTC, 50 mM Tris (pH 7.5), 10 mM EDTA, 2% sarkosyl, and 0.01% /3-mercaptoethanol; heated to 60 C; added to an equal volume of phenol; and sheared through an 18-gauge needle. After extraction with chloroform-isoamyl alcohol (24:1), the aqueous phase was precipitated with ethanol. This RNA pellet was dissolved in digestion buffer [40 mM Tris (pH 7.9), 10 mM NaCl, and 6 mM MgCl2], incubated with RNAse-free DNAse (10 U/ml, final concentration) for 1 h at 37 C, and reprecipitated with sodium acetate and ethanol. This pellet was resuspended in 0.1 M Tris, pH 7.4, containing 50 mM NaCl, 10 mM EDTA, 0.2% sodium dodecyl sulfate (SDS), and 200 Mg/ml proteinase-K and incubated at 37 C for 1 h. The solution was again heated to 60 C and reextracted twice with 60 C phenol-chloroform. The purified RNA was precipitated with sodium acetate-ethanol and collected. Estimation of RNA recovery RNA recoveries were assessed by addition of 106 cpm of a synthetic, uniformly labeled RNA transcript, 3.1 kilobases (kb) long, to the tissue samples immediately before homogenization in both RNA preparation protocols. The radioactivity contained in the purified RNA pellets was counted to determine the fraction of radioactive probe recovered. The GTC/CsCl protocol permitted the isolation of intact high mol wt RNA, as assayed by Northern analysis. However, recovery using this method consistently averaged between 20-30%. For the phallus specimens, recoveries were 21% (3 weeks) and 19% (10 weeks). For the prostate, recoveries were 28% (3 weeks) and 33% (10 weeks). Using the GTC/hot phenol method, recoveries of 80100% of the radiolabeled tracer RNA were obtained (96% and 76% for the 3- and 10-week-old penis and 100% and 74% for the 3- and 10-week-old prostate, respectively). These recoveries were obtained on specimens prepared in parallel with the experimental samples described in the text. When the integrity of the tracer recovered using both techniques was examined by analyzing a sample of the recovered RNA (with the added radiolabeled tracer) on a Northern blot, greater than 90% of the radioactivity was present as intact radiolabeled tracer (results not shown). Northern analysis Total RNA was analyzed by Northern analysis after electrophoresis on formaldehyde agarose gels, as described by Sambrook et al. (6). Equal amounts of RNA per sample were loaded. After the transfer of RNA onto Zetaprobe was complete, the RNA was covalently cross-linked to the Zetaprobe membrane using the Stratalinker UV-cross-linker (Stratagene Cloning Systems, La Jolla, CA). The membrane was prehybridized in 0.5 M sodium phosphate (pH 7.2), 1 mM EDTA, 7% SDS, and 100 Mg/ml poly(A)+ RNA at 65 C for at least 2 h. Hybridization of the labeled probe to the RNA was performed in the same buffer. The hybridized

Endo M991 Vol 129-No 2

filter was washed successively in 40 mM sodium phosphate (pH 7.2), 1 mM EDTA, and 5% SDS at 60 C twice for 1 h each time, then in the same Na phosphate-EDTA buffer containing 1% SDS at 60 C twice for 1 h each time. The filter was exposed to x-ray film at -70 C. Generation of hybridization probes specific for the rat androgen receptor mRNA Portions of exon 1 (El) and exon 8 (E8) of the rat androgen receptor gene were amplified using the polymerase chain reaction. To isolate a segment of exon 1 from genomic DNA, oligonucleotide primers (33-mers) were synthesized (Applied Biosystems, Foster City, CA) based on the previously reported nucleotide sequence (7, 8): El-I s : 5'-AC GAATTC AAAGCAGTGTCTGTGTCCATGGGGT-3' El-I as : 5'-AC GGATCC AGCAGTCTCTTCAGTGCCTTTGCCC-3' El-I s and El-I as flank a 201-basepair (bp) segment of the rat androgen receptor that is contained on exon 1 of the rat androgen receptor gene. El-I s and El-I ns contain artificial EcoRl and 5amHI restriction sites, respectively, at their termini. The polymerase chain reaction protocol was modified from that of Saiki et al. (9), as described by Marcelli et al. (10). Using a 1-^g sample of rat genomic DNA and amplifying for 35 cycles, the products were electrophoresed and isolated from a 2% low melting temperature agarose gel and ligated into appropriately digested Bluescript plasmid vector. This plasmid containing the segment of exon 1 was designated BS-RatAREl. The same technique was employed to generate a probe specific for exon 8 of the androgen receptor using the oligonucleotides E8-l s and E8-l as : E8-l s :

5'-AC GAATTC ATTGCAAGAGAGCTGCATCAATTC-3' 5'-AC GAATTC TGCAGAGAAGTAGTGCAGAGTTAT-3' The Bluescript plasmid containing the subcloned segment of exon 8 was designated BS-RatARE8. The location and structure of the exon-specific probes and cDNA probe relative to a schematic structure of the androgen receptor are shown in Fig. 1. RNA transcription The method of in vitro RNA synthesis was modified from protocols provided by the manufacturer (Stratagene Cloning Systems). The sense strand of rAR3.1 was selectively transcribed by the addition of T3 RNA polymerase to a reaction mixture containing 40 mM Tris (pH 8); 8 mM MgCl2; 2 mM spermidine; 50 mM NaCl; 0.4 mM each of rATP, rCTP, rGTP, and rUTP; 40 mM dithiothreitol; 1.6 U//il RNAsin; 5 MM [32P] rUTP (800 Ci/mmol); and 1 ^g of the linearized Bluescript plasmid BSrAR3.1 and incubated at 37 C for 40 min. The molar ratio of 32P-labeled rUTP to unlabeled rUTP in this reaction was 1:80. After completion of the transcription reaction, 5 U RQI-DNAse were added for 40 min at 37 C to digest the


ANDROGEN RECEPTOR mRNA IN THE RAT PHALLUS TGA

ATG

v

RNAse protection assay

DNA Binding Hormone Domain Binding Domain

E1

1095

E8 rAR 3.1 200bp

FIG. 1. Location of the cDNA- and exon-specific probes relative to a schematic structure of the rat androgen receptor. The positions of the exon-specific probes used in RNAse protection assays are shown relative to a schematic representation of a rat androgen receptor cDNA clone. El and E8 refer to probes specific for exons 1 and 8 of the androgen receptor gene, respectively.

template DNA. The reaction mix was extracted with an equal volume of phenol-chloroform (1:1) and ammonium acetateethanol precipitated three times. The final purified RNA standard was stored as an ethanol precipitate at —80 C. Single stranded RNA probes, specific for exon 8 that are complementary to the polarity of native androgen receptor mRNA, were synthesized using the T3 RNA polymerase to transcribe the BS-RatE8 plasmid previously linearized with BamHl. Likewise, probes complementary to the sense strand of exon 1 were synthesized using the T7 RNA polymerase to transcribe a 1-^g sample of the plasmid BS-RatAREl linearized with Hmdlll. Notably, in both cases the uniformly labeled RNA probes contain small portions of Bluescript polylinker sequence, permitting the discrimination of residual undigested probe and specifically protected fragments. Before use, these RNA probes were purified by electrophoresis and elution from a 5% acrylamide-bis-8.3 M urea gel. RNA standard curve generation Sense strand RNA was prepared by in vitro transcription of an androgen receptor cDNA encoding the rat androgen receptor (generously provided by Dr. David Russell, University of Texas Southwestern Medical Center at Dallas). The quantity of androgen receptor mRNA was derived by measuring the radioactivity of the RNA and dividing by the specific activity of the incorporated [;12P]UTP and the number of uridine residues in the sense strand of the transcribed sequence. Aliquots of this synthetic androgen receptor mRNA standard were stored at -80 C as a sodium acetate-ethanol precipitate. Dilutions of this stock RNA were incorporated as standards in each experiment, hybridized to either the El or E8 probe, and digested according to the conditions of the RNAase protection assay (see below). The amount of synthetic RNA used for the standard curves ranged from 1-500 attamoles (amol). The protected radiolabeled bands were quantitated by either densitometry or scintillation counting of the excised protected band. The standard curve generated by scintillation counting was linear in assays containing from 1-500 amol of the synthetic androgen receptor mRNA standard.

The RNAse protection assay was modified from that of Krieg and Melton (11). Known quantities of synthetic androgen receptor RNA standard or 40 ng total rat RNA were coprecipitated with an excess of antisense probe RNA labeled with [32P] UTP (-100,000 cpm). This pellet was dissolved in 80% formamide, 0.4 M NaCl, 40 mM 1,4-piperazine-diethanesulfonic acid (pH 6.4), and 1 mM EDTA, denatured at 85 C for 5 min, and hybridized at 42 C for 8 h. After hybridization, single stranded RNA was digested in 0.3 M NaCl, 10 mM Tris (pH 7.5), 5 mM EDTA, 10 Mg/ml RNAse-A, and 2 /xg/ml RNAse-T! for 1 h at 30 C. The digestion was terminated by the addition of proteinase-K and SDS to final concentrations of 125 Mg/ml and 0.5%, respectively, for 15 min at 37 C. The products of this digestion were phenol-chloroform extracted and precipitated with ethanol at -20 C. The pellet was dissolved in 80% formamide in 50 mM Tris-borate (pH 8.3) and 1 mM EDTA, heated for 2 min at 85 C, and electrophoresed on a 5% acrylamide-8.3 M urea gel. The gel was directly exposed to XAR-5 film at room temperature for 15 h (Fig. 2). The androgen RNA content was quantitated by scanning densitometry (Quick Scan R&D, Helena Laboratories) of the developed film and by excising the radiolabeled band and comparing the recovered radioactivity to a standard curve. The levels of androgen receptor mRNA were adjusted to reflect the tissue content of androgen receptor mRNA by correcting for the RNA recovery measured for each specimen. Student's t test was used to determine significance. Primer-extended library construction Fifteen micrograms of polyadenylated RNA isolated from adult rat prostate were annealled to an antisense oligonucleotide rARP (5' -GTCCCTTAAGCTTCTGTATGGCAC-TGGAGT-3') derived from the 5' untranslated segment of the rat androgen receptor (8) for 1 h at 60 C. After extension (12), second strand synthesis was accomplished according to the method of Gubler and Hoffman (13). Synthetic EcoRl adpators were ligated onto the ends of the cDNA, and the resulting fragment was ligated into the vector XgtlO, yielding a library containing 2.2 x 10fi independent recombinants. This unamplified library was plated onto a bacterial lawn and screened with a genomic Hmdlll fragment (2RG10H; see below) derived from the up-stream region of the untranslated segment of the rat androgen receptor, yielding three independent recombinants. Genomic clone isolation and characterization A library constructed from rat genomic DNA (Clontech, Inc.) was screened with a 757-bp probe derived from the EcoRl-Ncol fragment of the rat androgen receptor cDNA. Eight recombinant clones were isolated and purified. One clone, designated X-2RG10, was characterized in detail and found to contain an insert of genomic DNA approximately 12 kb in length. Southern analysis localized the 5' flanking sequences to a 1.5-kb EcoKL restriction endonuclease fragment, designated 2RG10H (see Fig. 5). DNA sequence analysis Restriction endonuclease fragments were ligated into the plasmid vector Bluescript or into M13 single stranded phage


1096


Endo«1991 Vo! 129 «No 2

attomoles of sense androgen receptor RNA FIG. 2. RNAse Protection Standard Curve of Synthetic Sense Rat Androgen Receptor RNA (El). Left panel, Samples of synthetic sense RNA were hybridized with excess radiolabeled antisense RNA probe and digested with RNAse, according to the procedures described in the text. El refers to the undigested probe. The quantity of sense RNA added is shown (in attomoles) above each lane. Mol wt markers derived from Bluescript digested with Hpall are on the left in basepairs. Right panel, The specifically protected El bands shown in A were excised and counted in 5 ml Picofluor. The quantity of radioactivity detected was plotted vs. the amount of rAR3.1 sense RNA added to each hybridization.

200 T

118 —

200

400

600

Sense RNA (amol)

TABLE 1. Androgen receptor mRNA quantification by a RNAse protection assay in rat penis using probes to exon 1 or exon 8

Age (weeks) 3 10

Androgen receptor mRNA in penis (fmol/g tissue) Exon 1

Exon 8

5.3 ± 0.7 2.1 ± 0.2

6.5 ± 0.5 2.2 ± 0.1

Tissue was taken from the rats at the indicated ages, and total RNA was isolated by the GTC/CsCl and GTC/hot phenol methods. Androgen receptor mRNA per sample was quantitated by the RNAse protection assay, as described in the text. Using the measurements of RNA recovery (see Materials and Methods) and the specimen weights, these values were corrected to estimate the level of androgen receptor mRNA per wt of tissue. The data for the two types of RNA (GTC/CsCl and GTC/hot phenol methods) were combined in this table. The androgen receptor mRNA levels detected with probes for exons 1 and 8 were not statistically different in RNA prepared from the 3-week-old and the 10 week-old rat penis. For this reason, values obtained using the exon 1and 8-specific probes were combined in subsequent tables. The values presented are the means of eight assays ± SEM.

vectors and sequenced using Sanger dideoxy sequencing protocols (14). Si nuclease mapping Si nuclease mapping was performed using a single stranded end-labeled probe. A single stranded template containing the HmdIII endonuclease fragment (2RG10H) was extended after annealling to a 1-pmol sample of oligonucleotide rARP labeled with 32P at its 5' terminus. The labeled extended product was purified by electrophoresis on and elution from a denaturing acrylamide gel. Hybridization, Si nuclease digestion, electrophoresis, and visualization were described previously (15).

118 -

FIG. 3. RNAse protection assay of androgen receptor mRNA (El) in RNA samples prepared from rat tissues. Forty micrograms of total RNA derived by the GTC/CsCl (A) or GTC/hot phenol (B) methods from rat tissues at the indicated ages were hybridized to the El probe and digested with RNAses, as described in the text. The numbers on the left are mol wt markers in basepairs (//pall-digested Bluescript).

Results As a preliminary step to examining the pattern in androgen receptor mRNA expression in the rat penis, we sought to determine whether selective degradation or differential splicing of the androgen receptor transcript is a regulatory mechanism by which the level of androgen



1097

TABLE 2. Androgen receptor mRNA in rat ventral prostate and penis as a function of age: RNAse protection assay Age (weeks)

Tissue wt (mg)

Androgen receptor mRNA (fmol/g)

Androgen receptor (fmol DHT binding/g)"

Penis

3 10

47 ± 1 278 ± 10

5.9 ± 0.4 2.2 ± 0.1"

729 ± 114 43 ± 19

Ventral prostate

3 10

33 ± 1 376 ± 27

12.6 ± 1.5 8.1 ± 0.7c

2017 ± 210 848 ± 45

Tissue

Tissues were taken from rats at the indicated ages, and total RNA was isolated by both the GTC/CsCl and GTC/hot phenol methods. The quantity of androgen receptor mRNA per sample was determined by the RNAse protection assay, as described in the text. Using the RNA recovery values measured for each tissue type and age (see Materials and Methods) and the weights of the specimens, these values were adjusted to reflect the androgen receptor mRNA content per wt of tissue. The data for the two types of RNA were combined. The values presented are the means of 16 assays ± SKM. " Data for dihydrotestosterone binding are from Ref. 3. 6 Significantly different from the 3-week data, P < 0.001. ' Significantly different from the 3-week data, P < 0.005. TABLE 3. Androgen receptor mRNA as a function of age in dissected portions of the rat penis: RNAse protection assay

Compartment

9.4

-

6.6 —

4.4 Fid. 4. Northern analysis of rat androgen receptor mRNA. Fortymicrogram samples of total RNA isolated from rat tissues using the GTC/CsCl purification method at the indicated ages were analyzed as described in the text and probed using the cDNA fragment contained in rAR 3.1. The presence of similar quantitites of RNA in each lane was confirmed by hybridization of the same blot to a labeled probe for ribosomal RNA (data not shown). The numbers at the left indicate (in kilobases) the positions of migration of radiolabeled DNA markers.

receptor is controlled. For this purpose, probes for portions of exon 1 (El) and exon 8 (E8) of the androgen receptor were employed in a solution hybridization assay to analyze samples of RNA from the penis of young (3week-old) and mature (10-week-old) rats. As shown in Table 1, the levels of androgen receptor mRNA for each tissue were similar with each probe. Thus, the androgen receptor gene appears to be processed in the penis in a manner that causes exon 1 and exon 8 to be present in similar concentrations. When corrected for RNA recovery, RNAse protection assays using RNA prepared both by the GTC/CsCl and GTC/hot phenol methods gave comparable values for androgen receptor mRNA content (for example, 3-weekold penis: CsCl, 300 ± 30 amol/organ; hot phenol, 310 ± 50 amol/organ). The data derived from both methods of

Corpus/os Urethra/epithelia Glans penis

Androgen receptor mRNA (fmol/g) 3 week

10 week

3.9 ± 0.1 3.7 ± 0.7 1.2 ± 0.2

0.5 ±0.1" 1.0±0.1 h 0.9 ± 0.2

Tissue was dissected from rats at the indicated ages, and total RNA was isolated by the GTC/hot phenol method. Androgen receptor mRNA per sample was quantitated by the RNAse protection assay, as described in the text. These measurements were adjusted to reflect the tissue content of androgen receptor mRNA per wt of tissue based on the weights of the specimens and the RNA recoveries measured in parallel samples. [These recoveries varied from 80-100% (corpus/os: 3 week, 80%; 10 week, 100%; urethra/epithelium: 3 week, 95%; 10 week, 97%; glans: 3 week, 97%; 10 week, 100%).]. The values presented are the means of four assays ± SEM. " Significantly different from 3 week level, P < 0.0005. 6 Significantly different from 3 week level, P < 0.01.

isolation of RNA were, therefore, combined for statistical analysis. An autoradiogram depicting the protected El band using androgen receptor mRNA from different tissues is shown in Fig. 3, and Table 2 summarizes the androgen receptor mRNA measurements in the 3- and 10-week-old rat penis and ventral prostate. The 3-weekold rat penis contains approximately 2.7-fold more androgen receptor mRNA than the 10-week-old rat penis when expressed as femtomoles per g tissue. In ventral prostate there was also a decline in androgen receptor mRNA per g tissue with age. The decline in penile androgen receptor mRNA was not as large as we have previously reported for the androgen receptor itself using a ligand binding assay (15-fold; Table 2) (3). The amount of intact androgen receptor mRNA was also estimated by Northern analyses of RNA prepared using the GTC/CsCl method to determine whether the changes in intact androgen receptor mRNA are similar



1098

A

R

K

H

PR

-284

AAGCTTCTGCTTTGGAGTCTAAAGCCCGGTTCCGAAAAACAAGTGGTATTTGGGGAAAAGGGGTCTTCAG

-214

AGGCIACAGGGAGTCCTTCCAGCCTTCAACCATACTACGCCAGCACTATGTTCTCTAAAGCCACCCTGCG

-144

CTAGCTTGCGGTGAGGGGAGGGGAGAAAAGGAAAGGGGAGGGGAGGGGAGGGGAGGGGAGAGAGAAAGGA

-74

GGTGGGAAGGCAGGGAGGCCGGCCCGCGdSGGCGaSACCGACTCACAAACTGTTGCATTTGCTTTCCACC

67

Endo • 1991 Voll29«No2

GAGGCTGAGAGGGCATCAGAGGGGAAAAGACTGAGTTAGCCACTCCAGTGCCATACAGAAGCTT

FlG. 5. Localization of nucleotide sequence of the rat androgen receptor gene promoter and 5' flanking segment. A, Schematic representation of the genomic £coRI endonuclease restriction fragment 2RG10H. The arrow denotes the approximate position of the transcription initiation site. The restriction sites are as follows; H, Hindlll; K, Kpril; P, Pstl; R, EcoRl; S, Sacll. B, The sequence of the Hindlll restriction endonuclease fragment containing the rat androgen receptor gene promoter is shown (the area shown as the bold line in A). Indicated on this sequence is the location of the termini of three independent primerextended clones (shown as an asterisk) and the site of initiation as determined by Si nuclease mapping experiments (designated I and II). The half-arrow notes the position of the oligonucleotide used in the construction of the primer-extended library.

to those of mRNA fragments detected by solution hybridization. The Northern filters were hybridized with probes specific for El or E8 and with the 3.1-kilobase (kb) cDNA. In each instance, bands approximately 8 kb in length were visualized in RNA from penis and ventral prostate (Fig. 4). The relative amounts of intact androgen receptor mRNA visualized in these filters were approximated by scanning densitometry of the autoradiographs. Although these data are semiquantitative, when the densitometry data were corrected for DNA content and RNA recovery, a 5-fold decrease in intact androgen receptor mRNA per g tissue was seen in the 10-week-old compared to the 3-week-old rat penis. These results are in general agreement with the more exact measurements obtained using the RNAase protection assay and suggest that the changes identified with the RNA protection assays reflect alterations in the levels of intact androgen receptor mRNA. To examine whether the changes in androgen receptor mRNA are similar in different tissue compartments of the rat penis, 10-week-old and prepubertal rat penis were dissected to separate those portions of the penis in which the amount of androgen receptor decreases most strikingly with age, as determined by immunohistochemical staining, specifically the corpus and os (4). When total RNA was isolated using the hot phenol method and the amount of androgen receptor mRNA was quantitated using the RNAse protection assay, significant decreases were observed in the 10-week-old rat corpus/os (8-fold)

140 —

120 —

*.-#

FIG. 6. Si nuclease localization of the androgen receptor gene promotor employed in rat ventral prostate and rat corporal tissue. Samples of total RNA were hybridized to an end-labeled single stranded DNA probe derived from a //mdlll-digested fragment of 2RG10H (see Materials and Methods and Fig. 5) and digested with Si nuclease. I and II are the major protected bands and correspond to the sites labeled I and II in Fig. 5.

and urethra/epithelium (4-fold; Table 3). By contrast, only a 30% decrease was observed in the glans penis. The decreases in mRNA content with age are similar in magnitude in corpus/os and urethra/epithelium to changes in immunoreactive androgen receptor in these tissues (4). Changes in androgen receptor mRNA levels with age could be due to alterations in the synthesis and/or the degradation of the molecule. As an initial approach to understanding the regulatory mechanism by which the levels are controlled, we examined the location of the androgen receptor gene promoter employed in the ventral prostate and various compartments of the penis. To define the 5' terminus of androgen receptor mRNA, poly(A)+ RNA from adult rat prostate was hybridized to an oligonucleotide derived from the 5' untranslated segment of the rat androgen receptor gene (see Materials and Methods). After cDNA synthesis, ligation, and in vitro packaging, a library containing 2.5 X 105 independent recombinant phage was obtained. From this library, three independent recombinant phages were isolated and characterized. The positions of the termini of these phages relative to the sequence of the up-stream region



of the rat androgen receptor gene promoter are shown in Fig. 5. As indicated, the termini of all three independent clones map to identical positions and localize the promoter used in the ventral prostate approximately 1 kb up-stream of the initiator methionine of the androgen receptor-coding sequence. To establish whether the same promoter is employed in the corpus and os as in the ventral prostate, we performed Si nuclease mapping using a probe derived from fragment 2RG10H (shown in Fig. 5) on RNA samples from dissected fractions of the 3-week-old rat phallus and from prepubertal and adult rat prostate (Fig. 6). The results indicate that the same promoter is used in all three compartments of the rat phallus and in the ventral prostate. The position of initiation as indicated by the Si nuclease mapping in this experiment agrees with the initiation site as determined by primer extension using RNA samples prepared from the adult rat ventral prostate. These results are shown schematically in Fig. 5.

Discussion Androgen receptor expression in the developing rat phallus is regulated by androgens (2, 3). The studies of this phenomenon, originally performed using radiolabeled hormone in binding assays, suggest that the level of androgen receptor expression is permanently decreased in the tissue after the pubertal phase of phallic growth. These findings have been confirmed in studies that examined the localization of the androgen receptor using antibodies that recognize the androgen receptor protein (4). This pattern of androgen receptor regulation is in contrast to the changes in androgen receptor expression in some target tissues, such as the rat prostate, where suppression of androgen receptor expression in response to ligand is partial in degree and reversible with androgen deprivation (16, 17). The current studies provide additional insight into the nature of the decrease in penile androgen receptor expression. First, the gross structure of the androgen receptor mRNA in the rat phallus is similar to that in other tissues. Although the androgen receptor mRNA detected in our studies is somewhat smaller than that detected in other studies (8, 18), this difference is probably due to methodological differences, particularly the use of formaldehyde gels and radioactive DNA markers. In addition, the amounts of transcripts containing exons 1 and 8 are identical in various preparations of RNA from the rat penis, suggesting that no differential splicing of the androgen receptor gene occurs in this tissue, as has been demonstrated in some tissues for thyroid hormone (19, 20) and retinoic acid receptors (21). Second, the postpubertal decrease in the level of androgen recep-

1099

tor in the rat phallus detected by binding assays and immunological techniques appears to be due in large part to a decrease in the steady state level of androgen receptor mRNA within specific tissue compartments. This decrease is clear-cut in the corpus and os of the mature rat phallus, in which an 8-fold decrease in androgen receptor mRNA level occurs between 3-10 weeks of age. The decrease in androgen receptor mRNA levels in the corpus/os appears to be greater in magnitude than that in the glans penis and ventral prostate. Notably, this decrease in androgen receptor mRNA in the corpus and os is associated with dramatic changes in the tissue architecture and cell type (e.g. the os penis) within the phallus. Our data do not allow us to deduce whether this decrease is due to alterations in the synthesis or stability of androgen receptor mRNA. Although several mechanisms could be responsible for the developmental changes observed in androgen receptor mRNA levels, we have focused first on defining the transcription initiation site that is employed in tissues expressing the androgen receptor. The transcription initiation site defined in these experiments for the rat androgen receptor gene in the rat ventral prostate is similar to that identified in the human androgen receptor gene that is active in several human tissues and cell lines (15). This flanking segment contains a single putative SP] -binding site, but lacks a typical CCAAT box or TATA box motif and, thus, appears to fall into the category of housekeeping genes. While there are considerable differences in the flanking segments of the rat and human androgen receptor genes (78 nucleotide substitutions are encountered in the 400 nucleotides within the Hindlll restriction endonuclease fragment that contains the site of transcription initiation), there are regions that are more highly conserved than others. In particular, substitutions in the region surrounding the putative SPibinding site are much less frequent than more 5'-terminal segments. This segment includes a purine-rich tract also similar to that in the human androgen receptor and chicken progesterone receptor genes (15, 22). The identification of the androgen receptor promoter employed in the rat prostate permitted us to examine whether this same promoter was employed in compartments of the rat phallus that show a quite different pattern of androgen receptor expression. The finding that the same androgen receptor gene promoter is active in all compartments of the rat phallus suggests that changes in levels of androgen receptor mRNA are not due to the activities of different promoter elements within the androgen receptor gene. Further studies will be required to define the mechanisms responsible for achieving these diverse patterns of androgen receptor expression.


1100


References 1. George FW, Wilson JD 1986 Embryology of the gential tract. In: Walsh PC, Gittes RF, Perlmutter AD, Stamey TA (eds) Campbell's Urology. Saunders, Philadelphia, pp 1804-1818 2. Rajfer J, Namkung PC, Petra PH 1980 Identification, partial characterization and age-related changes of a cytoplasmic androgen receptor in the rat penis. J Steroid Biochem 13:1489-1492 3. Takane KK, George FW, Wilson JD 1990 Androgen receptor of rat penis is downregulated by androgen. Am J Physiol 258:E46E50 4. Takane KK, Husmann DA, McPhaul MJ, Wilson JD 1991 Androgen receptor levels in the rat penis are controlled differently in distinctive cell types. Endocrinology 128:2234-2238 5. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ 1979 Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294-4299 6. Sambrook J, Fritsch EF, Maniatis T 1989 Extraction, purification, and analysis of messenger RNA from eukaryotic cells. In: Molecular Cloning-A Laboratory Manual, ed 2, chapt 7. Cold Spring Harbor Laboratory, Cold Spring Harbor, pp 7.43-7.45 7. Chang C, Kokontis J, Liao S 1988 Structural analysis of complementary DNA and amino acid sequences of human and rat androgen receptors. Proc Natl Acad Sci USA 85:7211-7215 8. Tan J, Joseph DR, Quarmby VE, Lubahn DB, Sar M, French FS, Wilson EM 1988 The rat androgen receptor: primary structure, autoregulation of its messenger ribonucleic acid, and immunocytochemical localization of the receptor protein. Mol Endocrinol 12:1276-1285 9. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA, Arnheim N 1985 Enzymatic amplification of /3-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230:1350-1354 10. Marcelli M, Tilley WD, Wilson CM, Griffin JE, Wilson JD, McPhaul MJ 1990 Definition of the human androgen receptor gene structure permits the identification of mutations that cause androgen resistance: premature termination of the receptor protein at

11. 12. 13. 14. 15. 16. 17.

18.

19. 20. 21.

22.

Endo • 1991 Vol 129"No 2

amino acid residue 588 causes complete androgen resistance. Mol Endocrinol 4:1105-1116 Krieg PA, Melton DA 1987 In vitro RNA synthesis with SP6 RNA polymerase. Methods Enzymol 155:397-415 McKnight SL, Kingsbury R 1982 Transcriptional control signals of a eukaryotic protein-coding gene. Science 217:316-324 Gubler U, Hoffman BJ 1983 A simple and very efficient method for generating cDNA libraries. Gene 25:263-269 Sanger F, Nicklen S, Carlson AR 1977 DNA sequencing with chainterminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467 Tilley WD, Marcelli M, McPhaul MJ 1990 Expression of the human androgen receptor gene utilizes a common promoter in adverse human tissues and cell lines. J Biol Chem 265:13776-13781 Quarmby VE, Yarbrough WG, Lubahn DB, French FS, Wilson EM 1990 Autologous downregulation of androgen receptor messenger ribonucleic acid. Mol Endocrinol 4:22-28 Krongrad A, Wilson CM, Wilson JD, Allman DR, McPhaul MJ 1991 Androgen increases androgen receptor protein while decreasing androgen receptor mRNA in LNCaP cells. Mol Cell Endocrinol 76:79-88 Shan L-X, Rodriguez MC, Janne OA 1990 Regulation of androgen receptor protein and mRNA concentrations by androgens in rat ventral prostate and seminal vesicles and in human hepatoma cells. Mol Endocrinol 4:1636-1646 Mitsuhashi T, Tennyson GE, Nikodem VM 1988 Alternative splicing generates messages encoding rat c-er6A proteins that do not bind thyroid hormone. Proc Natl Acad Sci USA 85:5804-5808 Izumo S, Mahdavi V 1988 Thyroid hormone receptor G isoforms generated by alternative splicing differentially activate myosin heavy chain gene transcription. Nature 334:539-542 Kastner P, Krist A, Mendelsohn C, Gamier JM, Zelent A, Leroy P, Staub A, Chambon P 1990 Murine isoforms of retinoic acid receptor gamma with specific patterns of expression. Proc Natl Acad Sci USA 87:2700-2704 Jeltsch J-M, Turcotte B, Gamier J-M, Lerouge T, Krozowski Z, Gronemeyer H, Chambon P 1990 Characterization of multiple mRNAs originating from the chicken progesterone receptor gene. J Biol Chem 265:3967-3974


Androgen resistance associated with a mutation of the androgen receptor at amino acid 772 (Arg----Cys) results from a combination of decreased messenger ribonucleic acid levels and impairment of receptor function.

Androgen receptor messenger ribonucleic acid (mRNA) in the rat liver: changes in mRNA levels during maturation, aging, and calorie restriction.

Autologous down-regulation of androgen receptor messenger ribonucleic acid.

luteinizing hormone receptor down-regulation involves decreased levels of receptor messenger ribonucleic acid.

Decreased levels of androgen binding protein in the reproductive tract of the restricted (Hre) rat.

Androgen receptor levels in the rat penis are controlled differently in distinctive cell types.

Hormonal regulation of follicle-stimulating hormone receptor messenger ribonucleic acid levels in cultured rat granulosa cells.

Changes in retinoic acid receptor messenger ribonucleic acid levels in the vitamin A-deficient rat testis after administration of retinoids.

Developmental changes in levels of luteinizing hormone receptor and androgen receptor in rat Leydig cells.

Differential regulation of thyroid hormone receptor messenger ribonucleic acid levels by thyrotropin-releasing hormone.

Androgen receptor of rat penis is down-regulated by androgen.

The rat androgen receptor gene promoter.

Androgen receptor in nuclei of rat testis.

Valproic acid induces histologic changes and decreases androgen receptor levels of testis and epididymis in rats.

Significantly higher expression levels of androgen receptor are associated with erythroblastosis virus E26 oncogene related gene positive prostate cancer.

Beta-nerve growth factor influences the expression of androgen-binding protein messenger ribonucleic acid in the rat testis.

Localization of the androgen receptor in the developing rat gubernaculum.

Tissue-specific regulation of vasoactive intestinal peptide messenger ribonucleic acid levels by estrogen in the rat.

Androgen-binding proteins in rat epididymis: properties of a cytoplasmic receptor for androgen similar to the androgen receptor in ventral prostate and different from androgen-binding protein (ABP).

Regulation of FSH beta messenger ribonucleic acid levels in the rat by endogenous inhibin.

Melatonin levels are decreased in rheumatoid arthritis.

Are adrenal and testicular androgen levels correlated?

Androgen receptor expression predicts decreased survival in early stage triple-negative breast cancer.

Decreased maternal serum 2-methoxyestradiol levels are associated with the development of preeclampsia.