Definition of the transcription factor TdIF1 consensusbinding sequence through genomewide mapping of its binding sites Kotaro Koiwai1*, Takashi Kubota2, Nobuhisa Watanabe3, Katsutoshi Hori3, Osamu Koiwai2 and Hisao Masai1* 1

Department of Genome Medicine, Tokyo Metropolitan Institute of Medical Science, Tokyo 156-8506, Japan Department of Applied Biological Science, Faculty of Science and Technology, Tokyo University of Science, Noda, Chiba 278-8510, Japan 3 Department of Biotechnology, Graduate School of Engineering, Nagoya University, Chikusa-ku, Nagoya 464-8603, Japan 2

TdIF1 was originally identified as a protein that directly binds to terminal deoxynucleotidyltransferase, TdT. Through in vitro selection assays (SELEX), we recently showed that TdIF1 recognizes both AT-tract and a specific DNA sequence motif, 50 -TGCATG-30 , and can upregulate the expression of RAB20 through the latter motif. However, whether TdIF1 binds to these sequences in the cells has not been clear and its other target genes remain to be identified. Here, we determined in vivo TdIF1-binding sequences (TdIF1-invivoBMs) on the human chromosomes through ChIP-seq analyses. The result showed a 160-base pair cassette containing ‘AT-tract~palindrome (inverted repeat)~AT-tract’ as a likely target sequence of TdIF1. Interestingly, the core sequence of the palindrome in the TdIF1-invivoBMs shares significant similarity to the above 50 -TGCATG-30 motif determined by SELEX in vitro. Furthermore, spacer sequences between AT-tract and the palindrome contain many potential transcription factor binding sites. In luciferase assays, TdIF1 can up-regulate transcription activity of the promoters containing the TdIF1-invivoBM, and this effect is mainly through the palindrome. Clusters of this motif were found in the potential target genes. Gene ontology analysis and RT-qPCR showed the enrichment of some candidate targets of TdIF1 among the genes involved in the regulation of ossification. Potential modes of transcription activation by TdIF1 are discussed.

Introduction Terminal deoxynucleotidyltransferase (TdT) interacting factor 1 (TdIF1, DNTTIP1) was first identified as a TdT-binding protein using a yeast two-hybrid system (Yamashita et al. 2001). We showed that TdIF1 inhibits TdT activity in vitro (Fujisaki et al. 2006). TdIF1 enhances TdT ubiquitylation by importing Bood POZ containing gene type-2 (BPOZ-2) from the cytoplasm to the nucleus (Hayano et al. 2009), which promotes TdT ubiquitylation through Cullin 3 (CUL3)-based ubiquitin ligase and degradation by Communicated by: Katsuhiko Shirahige *Correspondence: [email protected] or masai-hs@ igakuken.or.jp

242

Genes to Cells (2015) 20, 242–254

proteasome (Maezawa et al. 2008). The ubiquitylation of TdT itself inhibits the TdT activity (Maezawa et al. 2012). In nonimmune tissues, TdIF1 functions as a transcription factor. We conducted in vitro SELEX analyses and showed that TdIF1 binds to AT-tract and 50 -GNTGCATG-30 through the AT-hook and helix-turn-helix (HTH), respectively, present in TdIF1 (Kubota et al. 2013). Other emerging results also support the idea that TdIF1 functions in transcription. TdIF1 interacts with a 132 kDa transcription regulator, TReP-132 or TRERF1, which functions as a transcription coactivator of steroidogenic factor 1 to induce the P450scc gene expression in steroid-hormone-producing cells (Gizard et al. 2001; Fujisaki et al. 2006). TdIF1 is likely to be a

DOI: 10.1111/gtc.12216 © 2015 The Authors Genes to Cells © 2015 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Definition of the TdIF1-binding sequence

subunit of a M phase-specific histone deacetylase complex (HDAC), because it was captured by the HDAC inhibitors-proven matrix in greater amounts from mitotic cells compared with nonmitotic cells, and was shown to interact with HDAC1 in vivo (Bantscheff et al. 2011). The C. elegans TdIF1 orthologue, SAEG2, acts at downstream of EGL-4 (corresponding to mammalian cGMP-dependent protein kinase, PKG) in the signaling pathway to control foraging behavior together with HDA-2 (corresponding to mammalian HDAC1 or HDAC2) (Hao et al. 2011). TdIF1 also interacts with an activating enhancer-binding protein 4 (AP-4, TFAP4) (Ku et al. 2009). We found RAB20 as a TdIF1-target gene on the basis of computational analysis using cisRED (Kubota et al. 2013). However, this approach cannot cover all of the TdIF1-regulated genes. We therefore conducted ChIP-seq analysis to define the TdIF1-binding motif in vivo and to identify the TdIF1-regulated genes. We identified 324 genes as candidates of TdIF1-targets and found DNA motifs potentially recognized by TdIF1 in vivo, including a palindrome of 50 -TGCAGTG-30 . TdIF1 can promote transcription via this motif in luciferase assays, and potential novel target genes have been identified. We noted the presence of multiple copies of the identified TdIF1 target sequences in these putative target genes.

Results Identification of TdIF1-binding sequences by ChIP-seq analyses

We previously identified an AT-tract and 50 -TG CATG-30 as potential TdIF1-binding sites by in vitro SELEX screening and showed that TdIF1 regulates the expression of RAB20, which was identified as one of the TdIF1-targets using cisRED (Kubota et al. 2013). To identify TdIF1-binding sequences and TdIF1-targets in vivo, we carried out ChIP-seq analyses using 293T cells expressing an epitope-tagged TdIF1 and the tag-specific antibody (Fig. S1A in Supporting Information). As a result, 1274 peaks were called using MACS. First, we conducted de novo motif discovery and motif searches in the peak sequences using GADEM and MotIV. We found seven motifs as candidates of TdIF1-binding sequences. TdIF1 binds to an AT-tract through its AT-hook (Kubota et al. 2013), and AT-tracts were expectedly identified in these candidate sequences (Fig. S1B, motif3, motif4 and motif7 in Supporting Information). To identify other sequences potentially

recognized by the HTH DNA-binding domain present in TdIF1, we searched motifs other than AT-tract. As a result, we found seven other motifs as potential TdIF1-binding sequences (Fig. S1C in Supporting Information). To further narrow down the candidates, we looked for motifs that are located in the center of ChIPed DNA fragments (i.e. MACS peak). We have compared the distances from the MACS peaks to the potential target sequences (Fig. S1C in Supporting Information). As shown in Figs 1A and 1B, the motif 50 -TGCAGTG-30 appeared in the MACS peak sequence (334 of 1274) with a high frequency and its location was at the MACS peak. Interestingly, this motif is highly similar to the TdIF1-binding sequence identified by SELEX (Kubota et al. 2013), 50 -TGCATG-30 . There is an additional ‘G’ between A and T, in the in vivo target sequence, 50 -TGCAGTG-30 . In contrast, an AT-tract is located at ~50 bp away from the MACS peak, suggesting that the major determinant for recognition by TdIF1 may be 50 -TGCAGTG-30 (Fig. 1A,B). We found only 79 peaks containing 50 -TGCATG-30 , the in vitro target (Kubota et al. 2013), of the 1274 peaks. TdIF1 may bind to AT-tract and 50 -TGCAGTG0 3 motifs through its AT-hook and HTH, respectively. Thus, we then examined the length between the two motifs. We aligned all the 134 sequences containing both an AT-tract and 50 -TGCAGTG-30 and measured the length between the motifs. As shown in Fig. 1C, significant peaks of the spacer length were observed at 34, 55, 84 or 105 bp. These numbers matched with the preferred lengths between the AT-tracts and the MACS peaks (shoulders in Fig. 1B). During the course of this operation, we found a (pseudo)palindrome sequence, which is represented by 50 -TGCAGTG-(14 bp)-CACTGCA-30 , within the AT-tract-(55 bp)-50 -TGCAGTG-30 or AT-tract-(105 bp)-50 -TGCAGTG-30 (Fig. 1C). If we limit the search only to those sequences containing a palindrome, we have come up with the peaks of the distance between the AT-tract and 50 -TGCAGTG-30 or 50 -CACTGCA-30 (the terminus of the nearest conserved sequence constituting the palindrome) at 84 and 34 bp, consistent with the above results (Fig. 1D). Because HTH generally binds to a specific motif as a dimer, it is suggested that TdIF1 recognizes the palindrome through the two HTH present in a TdIF1 dimer. Indeed, we previously reported that TdIF1 forms a dimer (Kubota et al. 2007). We next examined the length of the AT sequence that is recognized by TdIF1. The numbers of peaks carrying 5-bp A/T, 6-bp A/T, or 7-bp A/T were

© 2015 The Authors Genes to Cells © 2015 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Genes to Cells (2015) 20, 242–254

243

K Koiwai et al.

(A)

(B)

(C)

(D)

(E)

Figure 1 Identification of in vivo TdIF1-binding sequences using ChIP-seq and de novo motif search. (A) Motifs discovered by MotIV. Frequency at each position of the motifs is expressed with LOGO. AT-tract (left) was discovered from all of the TdIF1binding sequences, and 50 -TGCAGTG-30 motif (right) was identified from the search for the sequences without AT-tracts (see Fig. S1 in Supporting Information). AT-tract and TGCAGTG motifs were extracted from motif7 (Fig. S1B in Supporting Information) and from motif4 (Fig. S1C in Supporting Information; derived from search without AT-tract), respectively. Enrichment of the motifs (P-value) was recalculated by PWMEnrich program. (B) Distribution of motifs containing the AT-tract or the TGCAGTG motif relative to the MACS peak (the summit of the binding set at 0). (C and D) Distances between the AT-tract and 50 -TGCAGTG-30 motif. The distance from the left-edge T of 50 -TGCAGTG-30 to the AT-tract at the 50 -side and that from the right-edge G to the AT-tract at 30 -side (C). In (D), search was limited to the TdIF1-invivoBM containing a palindrome, 50 gtTGCAGTG-//-CACTGCAct-30 , and open and closed circles indicate the distribution of distance from the left-edge T of 50 TGCAGTG-30 to the AT-tract at the 50 -side and that from the right-edge A of 50 -CACTGCA-30 to the AT-tract at 30 -side. (E) Consensus TdIF1-invivoBM was deduced from the 340 extended MACS peak sequences that can be aligned without any insertion and nucleotide frequency is expressed with LOGO.

244

Genes to Cells (2015) 20, 242–254

© 2015 The Authors Genes to Cells © 2015 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Definition of the TdIF1-binding sequence

136, 112 and 610, respectively. These studies led to the identification of the consensus AT-tract motifs, 50 -AAAATTA-30 and 50 -AAAAAAA-30 . To precisely elucidate TdIF1-binding sequences in vivo, we extended the range for the search by 50 bp from MACS peaks. As a result, 552 peaks were found to have both AT-tract and a palindrome. We aligned and presented the frequency of each motif by LOGO. The sequences around the TGCAGTG motifs including the 14-bp central sequences were not conserved as strictly, but there are some preferred sequences, including the 50 -GTTGCAGTGAGC-30 , 50 -CCACTGCACT or 50 -AGAT-30 (Fig. 1E). The alignment of the 84- or 34-bp spacer segments also showed preferred nucleotide sequences (Fig. S2 in Supporting Information). Two hundred and twelve peaks have short insertion between each element. Then, we deduced a candidate target sequence of TdIF1 (TdIF1invivoBM; Fig. 1E) based on the analyses of the remaining 340 sequences (carrying no insertions), 50 AAAATTA-84 bp-TGCAGTG-14 bp-CACTGCA34 bp-AAAAAAA-30 . The 340 peaks carry sequences that are at least 90% homologous to TdIF1-invivoBM.

of genes as well as in the gene bodies (Fig. 2A). To dissect the potential function of TdIF1-invivoBM, we examined its effect on transcription using luciferase (A)

(B)

(C)

(D)

(E)

(F)

TdIF1 up-regulates transcription activity through TdIF1-invivoBM

We next examined the locations of TdIF1-binding sites on the genome. The results indicated rather uniform distribution at both upstream and downstream

Figure 2 TdIF1 up-regulates transcription via TdIF1-invivoBM. (A) Distribution of TdIF1-binding sites relative to genes. Upstr., upstream of TSS; downstr. downstream of genes; inside, inside of gene bodies. (B) Schematic representation of the luciferase reporter plasmids used in this experiment. TA, TATA box; FL, full-length TdIF1-invivoBM; AT, ATtract; palin, 50 -TGCAGTG-//-CACTGCA-30 palindrome. (C) pGL3b-vector, pGL3b-TdIF1-invivoBM_up and pGL3bTdIF1-invivoBM_down were transfected into 293T cells, and the luciferase activity was measured. (D) pEGFP-TdIF1 was cotransfected with pGL3b-vector and pGL3b-TdIF1-invivoBM_up, and the luciferase activity was measured. (E) 293T cells were transfected with pGL3b-TdIF1-invivoBM_up together with TdIF1 siRNA (siTdIF1) or nontargeting siRNA (siNG), and the luciferase assays were carried out. (F) Various TdIF1 truncated or point mutants fused to EGFP were analyzed in luciferase assay. WT, the full-length TdIF1; Nter, 1183 amino acid; Cter, 184-329 amino acid; mutNAH, the full-length TdIF1 with point mutations, R50A, R52A, K168D, K170D, R229A, R231A and K235A.

© 2015 The Authors Genes to Cells © 2015 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Genes to Cells (2015) 20, 242–254

245

K Koiwai et al.

reporter assays. We inserted the entire TdIF1-invivoBM upstream or downstream of the TATA-linked luciferase gene (pGL3b-TdIF1-invivoBM_up and pGL3b-TdIF1-invivoBM_down, respectively; Fig. 2B). As shown in Fig. 2C, TdIF1-invivoBM inserted upstream of the promoter promoted the luciferase gene expression, whereas pGL3b-TdIF1-invivoBM_down carrying TdIF1-invivoBM downstream of the promoter exhibited similar or even lower luciferase expression compared to the vector, indicating that TdIF1-invivoBM promotes transcription, when placed upstream of the promoter regions. Next, we examined whether this promoter enhancing activity is regulated by TdIF1. As shown in Fig. 2D, the luciferase activity was enhanced by co-expression of pEGFP-TdIF1. Conversely, it was suppressed by siRNA-mediated knockdown of TdIF1 (Fig. 2E). These results indicate that TdIF1 can activate transcription through TdIF1-invivoBM. We previously expressed the N-terminal (1-183 amino acid) or C-terminal polypeptides (184-329 amino acid) of TdIF1 (N-ter and C-ter, respectively). We also generated a mutant (mtNAH) carrying amino acid substitutions within the N-terminal disordered segment (N-IDP; for intrinsically disordered polypeptide), AT-hook and HTH [R50A/R52A, K168D/K170D and R229A/R231A/K235A, respectively (Kubota et al. 2013)]. We expressed these mutant TdIF1s as fusions with EGFP and compared their transactivation activities on TdIF1-invivoBM. As shown in Fig. 2F, the transactivation activity by N-ter and C-ter decreased by 35% and 40%, respectively, compared with WT. TdIF1 was reported to form a dimer through both its N-terminal and C-terminal domains. Therefore, N-ter and C-ter may form a heterodimer with endogenous TdIF1 and thus show some residual activity. The mtNAH mutant showed much reduced activity, suggesting that these three domains of TdIF1 may play a crucial role in transactivation of TdIF1-invivoBM. TdIF1 up-regulates transcription via 50 TGCAGTG-30 palindrome

We then examined which element of TdIF1-invivoBM is important for transactivation by TdIF1. We have inserted a 50 -TGCAGTG-30 palindrome or ATtract alone upstream of the SV40 promoter and TATA box (Fig. 3A). As shown in Fig. 3B, the original TdIF1-invivoBM, palindrome and AT-tract exhibited, respectively, 9.0-, 5.0- and 2.5-fold higher activity compared with the vector, suggesting that 246

Genes to Cells (2015) 20, 242–254

each element can serve as an enhancer to varied extents. This is consistent with the results of luciferase assays with TdIF1 mutants (Fig. 2E). Each element alone did not significantly stimulate luciferase activity on pGL3b containing only the TATA box (data not shown). We also examined the effect of TdIF1-overexpression or TdIF1 depletion on the transactivation by these elements. As shown in Fig. 3C, luciferase activities were significantly up-regulated with the original TdIF1-invivoBM and the palindrome sequence but not with the AT-tract in TdIF1-over-expressing cells. In contrast, TdIF1 depletion repressed the luciferase activity with the original TdIF1-invivoBM and the palindrome sequence by more than 50%, but did not significantly affect the activity of the AT-tract (Fig. 3D). These results suggest that TdIF1 transactivates transcription mainly via the 50 -TGCAGTG-30 palindrome which is a target of HTH, and AT-tracts further facilitates the binding and activation. TdIF1 regulates expression of ossification-related genes: clustering of TdIF1 target sequences

To identify potential TdIF1 target genes, we focused on those genes that carry MACS peak within 25 kbp from transcription start site (TSS). As a result, we have identified 324 candidate genes and classified them using Gene Ontology classification software DAVID. Of the 324 genes, 191 genes were functionally annotated and eight of them, AMELX, BMP6, MGP, oxytocin, SMAD1, SMURF1, Wnt7b and Znf675, were classified into ossification-related genes (Pvalue = 2.2 9 105). We checked with qPCR whether TdIF1 actually regulates the transcription of these genes. As shown in Fig. 4A, AMELX, BMP6, MGP, SMURF1 and Wnt7b were significantly downregulated in TdIF1-knockdown cells, whereas SMAD1 was up-regulated. In TdIF1 over-expressing cells, the profiles of the mRNA levels of these genes were in general inversely correlated with those in TdIF1-knockdown cells. These results suggest a possibility that TdIF1 may suppress ossification because SMAD1 promotes ossification and MGP and SMURF1 prevent the SMAD1 cascade (Zebboudj et al. 2002). We could not detect mRNA of oxytocin and Znf675 in 293T cells. We then conducted ChIP-qPCR to show that TdIF1 is indeed bound to these genes. We used 293T cells stably expressing FLAG-TdIF1, and the human osteosarcoma cell line U2OS transiently expressing FLAG-TdIF1, to enrich TdIF1-bound DNA with the protocol used in ChIP-

© 2015 The Authors Genes to Cells © 2015 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Definition of the TdIF1-binding sequence (A)

(B)

(C)

(D)

Figure 3 TdIF1 up-regulates transcription through the 50 -TGCAGTG-30 palindrome. (A) Schematic representation of the luciferase reporter plasmids used in this experiment. AT, AT-tract; 84-, 84-bp spacer; palin, palindrome; 34-, 34-bp spacer; SV, SV40 promoter) (B) The transcription activation by each element in TdIF1-invivoBM in luciferase assays. Luciferase reporter plasmids carrying different elements from TdIF1-invivoBM were transfected into 293T cells, and the luciferase activities were normalized relative to that of pGL3p. (C) pEGFP-TdIF1 or pEGFP plasmid was cotransfected into 293T cells with luciferase reporter plasmids carrying different elements from TdIF1-invivoBM, and the luciferase activities were normalized relative to that of the samples cotransfected with pEGFP. (D) 293T cells transfected with luciferase reporter plasmids carrying different elements from TdIF1invivoBM were cotransfected with siRNA against TdIF1 (siTdIF1) or control siRNA (siNG), and the luciferase activities were normalized relative to that of siNG. The luciferase activities were normalized to that of the samples cotransfected with siNG.

seq experiments. We confirmed that TdIF1 indeed bound to all of the genes examined in 293T cells as well as in U2OS cells. To check the relationship between the regulation by TdIF1 and the distance of TdIF1-invivoBM from TSS, we aligned the promoter regions of the genes. As shown in Fig. S3 in Supporting Information, these genes had varied numbers of TdIF1-invivoBMs. The numbers and distribution of TdIF1 sites did not differ significantly between stimulated or repressed genes. The extent of stimulation by TdIF1 did not correlate with the numbers of the TdIF1-binding sites. The genes, such as BMP6, SMURF1 and Wnt7b, which are efficiently (by more than 50%) down-regulated in TdIF1-knockdown cells, carried TdIF1-invivoBM within 5000 bp from TSS. TdIF1 may regulate ossification via control of various signaling pathways

We then evaluated other 183 genes. They were not classified to specific pathways by GO or PATHWAY

analyses, but appeared to be involved in ubiquitous intracellular metabolism or signaling pathways. From these genes (MACS peaks with P-value < 0.00005), we selected the targets having MACS peaks with Pvalue < 0.00001. Those are ACSBG2, ANGPTL6, ARMCX4, CGN, CXCL17, ERBB3, GNB1L, HS6ST2, KPRP, NARS, PIN4, RNF8 and UTY which had MACS peaks within 25 kb upstream of TSS. The expression of these genes as well as that of those genes (GNG7, MAPK6, PRKCQ and ARHGAP6) carrying MACS peaks and TdIF1-invivoFL downstream of TSS was measured by RT-qPCR using TdIF1-over-expressing or TdIF1-knockdown 293T cells. As shown in Fig. 5, expression of ARMCX4, CGN, GNB1L, HS6ST2, KPRP, RNF8 and UTY was significantly decreased, similar to the positive controls RAB20 and DNTTIP1, whereas expression of ANGPTL6, CXCL17, ERBB3 and PIN4 was up-regulated in TdIF1-knockdown cells. mRNA levels of ANGPTL6, ARMCX4, GNB1L, KPRP, UTY, GNG7, MAPK6 and ARHGAP6 in TdIF1over-expressing cells were inversely correlated with

© 2015 The Authors Genes to Cells © 2015 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Genes to Cells (2015) 20, 242–254

247

K Koiwai et al. (A)

(B)

Figure 4 TdIF1 regulates transcription of ossification-related genes. (A) Total RNA was extracted from 293T cells transfected with siRNAs against TdIF1 (siTdIF1; TdIF1 KD) or negative control siRNA (siNG), or those transfected with a plasmid for FLAG-TdIF1 over-expression (TdIF1 O/E) or an empty vector plasmid. The mRNA levels of indicated genes in TdIF1 (DNTTIP1) KD (gray bars)- or O/E (black bars)cells were calculated by the DDCt method and normalized to the values of the siNG samples or empty vector samples, respectively. Error bars represent SEM. (B) Validation of TdIF1 binding to the promoter regions of ossification-related genes by ChIP-qPCR. DNA fragments were ChIPed from 293T cells stably expressing FLAG-TdIF1 (black bars) or not (white bars), or from U2OS cells transiently expressing FLAGTdIF1 (dark gray bars) or not (light gray bars) using antiFLAG antibody, and amplified by real-time PCR using indicated primers. The amount of ChIPed DNA was calculated by the DCt method and normalized to the values of the input samples.

248

Genes to Cells (2015) 20, 242–254

Figure 5 TdIF1 regulates transcription of genes involved in various cellular signaling pathways. Total RNA was extracted from 293T cells transfected with siRNAs against TdIF1 (siTdIF1; TdIF1 KD) or negative control siRNA (siNG), or those transfected with a plasmid for FLAG-TdIF1 over-expression (TdIF1 O/E) or an empty vector plasmid. The mRNA levels of indicated genes in TdIF1 (DNTTIP1) KD (gray bars)- or O/E (black bars)-cells were calculated by the DDCt method and normalized to the value of the siNG samples or empty vector samples, respectively. Error bars represent SEM. The locations of TdIF1-invivoBM relative to TSS are indicated below the graph as ‘upstream’ or ‘downstream’. Control genes, RAB20, DNTTIP1 (TdIF1) and GAPDH, were also assayed.

© 2015 The Authors Genes to Cells © 2015 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Definition of the TdIF1-binding sequence

those in TdIF1-knockdown cells, whereas those of ACSBG2, CXCL17, ERBB3, HS6ST2, PIN4 and also RAB20 did not show correlation. GNB1L, HS6ST2, KPRP, RNF8, UTY and CGN carry TdIF1-invivoBMs within 5000 bp from TSS, as is the case for most of the ossification-related genes. It should be noted that TdIF1 can activate transcription even when TdIF1-invivoBMs is located downstream from TSS (GNG7, MAPK6, PRKCQ and ARHGAP6; Fig. 5). These results suggest that TdIF1 differentially regulates its target genes, which are related to various cellular signaling pathways and suggest a possibility that TdIF1 may regulate ossification through controlling these various signal pathways (see Discussion).

Discussion Identification of a putative consensus target sequence of TdIF1

Through analyses of the ChIP-seq data, we have identified the sequence 50 -AAAATTA-84 bpTGCAGTG-14 bp-CACTGCA-34 bp-AAAAAA-30 as a potential target sequence of TdIF1. TdIF1 binds to the same promoter regions in U2OS cells, human osteosarcoma cell lines derived from bone, as 293T cells (Fig. 4), further reinforcing our conclusion. Because TdIF1 has AT-hook and HTH, it is suggested that TdIF1 binds to the AT-tracts through AT-hook and the palindrome motif through HTH. HTH transcription factors generally bind to palindrome motifs as a dimer (Kubota et al. 2013). Previous study showed that TdIF1 forms a dimer (Kubota et al. 2007), consistent with its ability to recognize a palindrome. AT-tracts are 84 and 34 bp away from the palindrome motif, suggesting that TdIF1 may bend DNA to allow simultaneous interaction of TdIF1 with the palindrome motif and AT-tracts. We previously conducted SELEX, which led us to identify in vitro TdIF1-binding sites, AT-tract and 50 GNTGCATG-30 . The latter is similar to 50 GTTGCAGTG-30 , which was identified in the current study as a part of the in vivo TdIF1-binding site. 50 -GTTGCAGTG-30 was not identified in the SELEX using recombinant TdIF1, whereas TdIF1 also binds to 50 -GTTGCAGTG-30 in vitro (data not shown). 50 -GTTGCATG-30 was identified in ChIPseq assays as well, albeit at a reduced frequency. These data suggest that the binding specificity of TdIF1 is relaxed with regard to the presence or absence of G in 50 -GTTGCA[G]TG-30 . In the pro-

moter segment (from 205 to 1737 bp) of RAB20, TdIF1-invitroBM is localized at 1597 bp (Kubota et al. 2013). We also found TdIF1-invivoBM at 923 bp, suggesting that TdIF1 may up-regulate RAB20 expression via these two binding sites. However, we did not detect binding of TdIF1 to RAB20 promoter in the current ChIP-seq analyses of cells stably expressing FLAG-TdIF1, whereas we previously detected the binding in cells transiently overexpressing TdIF1. We do not know precise reasons for this. It could be that binding of TdIF1 to RAB20 promoter may be inefficient and its detection by ChIP requires high-level expression of TdIF1. On the mouse genome, half-motifs (50 -TGCAGTG-30 and AT-tract) were found in the 25 kbp sequences upstream to TSS of RAB20 and six ossificationrelated genes. However, full-length TdIF1-invivoBMs were not found. In fact, among 633 peaks containing at least one 50 -TGCAGTG-30 motif(s) within the 50-bp segments from MACS peaks, 81 sequences contained only a single 50 -TGCAGTG-30 motif. These results suggest that the full-length palindrome-binding sites might not always be essential but the half-motifs could mediate transcription regulation by TdIF1. Modes of action of TdIF1 in regulation of transcription

The mechanism of gene regulation by TdIF1 remains to be elucidated. The deduced binding motif contains two spacer sequences between the palindrome and AT-tracts. Interestingly, there is significant conservation of not only the length but also of the sequences of these spacers (Fig. S2 in Supporting Information; see also below). These spacer sequences contain potential binding sites of multiple transcription factors, suggesting that TdIF1 may trigger assembly of a large protein–DNA complex containing TdIF1 and other transcription factors upstream of a promoter. Depending on the factors recruited, TdIF1 could act as an activator or an inhibitor for transcription. TdIF1 was reported to interact with HDAC1, HDAC2, SAP130, SIN3B and TFAP4 (Ku et al. 2009; Bantscheff et al. 2011), generating an M phasespecific HDAC complex. HDAC1 and HDAC2 interact with many transcription factors, including YY1, Rb-binding protein-1, Sp1 and ZEB1, to regulate gene transcription (Yao et al. 2001; Yu et al. 2001; Choi et al. 2002; Segre & Chiocca 2011; Aghdassi et al. 2012). HDACs are generally inhibitory

© 2015 The Authors Genes to Cells © 2015 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Genes to Cells (2015) 20, 242–254

249

K Koiwai et al.

for transcription, and therefore, TdIF1 may recruit HDAC1 and HDAC2 to inhibit transcription during the M phase at particular promoters. In most genes that are activated by TdIF1, it may inhibit the activities of HDAC1 and HDAC2 by binding to them. This interaction may be regulated by phosphorylation at S54 in the N-IDP, or at S161 near the AT-hook which could be mediated by Cyclin A-Cdk (Olsen et al. 2006; Dephoure et al. 2008; Pagliuca et al. 2011). A potential role of TdIF1 as a factor targeting HDAC to specific promoter segments and its cell cycle regulation is very intriguing and deserve further investigation in the future. Physiological roles of TdIF1 as a transcription factor

The 84- and 34-bp spacers of TdIF1-invivoBM are conserved and 54 predicted transcription factors may bind to these sequences, as estimated by JASPAR (Portales-Casamar et al. 2010) (Fig. S2 in Supporting Information). Previous ChIP-seq analysis showed the presence of a motif, 50 -TGCAGTG-30 , near the transcription factor TFAP2A-binding sites (Orso et al. 2010). TFAP2A binds to 50 -GCCN3/4GGC-30 , and this motif was found in the 84- and 34-bp spacer segments. These findings suggest that TdIF1 and TFAP2 may cooperatively function. TdIF1 also binds to transcription factor TReP-132, which is involved in transcription of p450scc, p21 and p27 (Gizard et al. 2001, 2002a,b, 2005). However, TdIF1 did not associate with the promoter regions of these TReP-132-targets. This may be due to the tissue-specific function of TReP-132, which up-regulates P450scc transcription in adrenal NCI-H295 and JEG-3 cells (Gizard et al. 2001). Because TReP-132 regulates the expression of hydrocortisone, the hormone promoting apoptosis of osteocyte (Manelli & Giustina 2000), TReP-132 and TdIF1 might function cooperatively to prevent ossification. TdIF1 regulates six ossification-related genes, AMELX, BMP-6, MGP, SMAD1, SMURF1, and Wnt7b, and 13 other genes, ACSBG2, ANGPTL6, ARMCX4, CGN, CXCL17, ERBB3, GNB1L, HS6ST2, KPRP, NARS, PIN4, RNF8 and UTY. The TdIF1-regulated genes are related to various cellular signaling pathways (Fig. S5 in Supporting Information); MAPK and NF-jB signaling pathways are activated by ERBB3, GNB1L and oxytocin (Ganti et al. 2006; Kim et al. 2013) and inhibited by Znf675 via TRAF6 (Yoda et al. 2013); b-catenin is stabilized by PIN1 and transcriptionally activates RUNX2 250

Genes to Cells (2015) 20, 242–254

which is a target of SMURF1 in the Wnt signaling pathway (Brown-Endres et al. 2012; Yamamoto et al. 2012); the TGF and BMP signaling pathway is activated by SMADs and suppressed by MGP and SMURF1 (Zebboudj et al. 2002; Park et al. 2012); Angptl/Tie-2 signaling pathway regulates cell cycle via RhoA regulated by CGN and SMURF1 (Lee et al. 2011; Ryu et al. 2011; Lee et al. 2012). These pathways crosstalk with each other, suggesting a possibility that TdIF1 may regulate ossification through controlling these various signal pathways. Furthermore, functional analyses of TdIF1 would be needed to elucidate how TdIF1-mediated control of transcription would regulate ossification. Toward this goal, we are now currently constructing TdIF1 knockout cell lines and mice.

Experimental procedures ChIP-seq analysis ChIP-seq was conducted according to the manufacturer’s protocol of Applied Biosystems SOLiD4 system SOLiD, ChIPSeq Kit (Life technologies, cat# 4449638). In brief, target samples were chromatin purified from His-TdIF1-3xFLAG (FLAG-TdIF1) expressing 293T cells using anti-DYKDDDDK antibody-coupled beads. Negative control samples for ChIP were chromatin from the parent 293T cells (no tag). NonChIPed genome sheared by sonication was used as an input control samples for ChIP.

Chromatin immunoprecipitation Human embryonic kidney (HEK) 293T cells stably expressing FLAG-TdIF1 or control parent 293T cells were fixed with 1% formaldehyde for 10 min. The fixation was stopped with 0.125 M glycine. After wash in PBS, cells were lysed in 150 lL of lysis buffer containing protease inhibitors. Chromatin was fragmented by Covaris S2 (5% duty cycle, 15 cycles, 2 intensity, at 4 °C, 200 cycles per burst, 60 s Cycle time and continuous degassing mode) (non-ChIPed genome samples). After centrifugation, the supernatant was mixed with anti-DYKDDDDK antibody-coupled Dynabeads for 2 h. After wash, ChIPed samples and sheared non-ChIPed genome samples (input) were reverse-cross-linked and digested with proteinase K. The samples were purified by DNA purification magnetic beads and eluted in DNA elution buffer.

Library preparation Eluted DNA was end-repaired for 30 min in the following compositions: 50 lL of ChIP DNA, 20 lL of 59 end-polishing buffer, 4 lL of 10 mM dNTP Mix, 1 lL of end-polishing enzyme 1, 8 lL of end-polishing enzyme 2 and 17 lL of

© 2015 The Authors Genes to Cells © 2015 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Definition of the TdIF1-binding sequence nuclease-free water. The end-repaired DNA was purified using the Agencourt AMPure XP kit (Beckman Coulter, cat# A63880) and then P1 and P2 adaptors were ligated at RT in the following: 1 lL of 2.5 pM/mL P1 adaptor, 1 lL of 2.5 pM/mL P2 adaptor, 20 lL of 59 T4 ligase buffer, 30 lL of end-repaired DNA, 5 lL of 5 U/lL T4 Ligase and 43 lL of nuclease-free water. The adaptor-ligated DNA was purified using the Agencourt AMPure XP kit, nick translated and amplified in the following reaction mixes and procedures: 200 lL of Platinum PCR amplification mix, 5 lL of 50 mM Library PCR primer 1, 5 lL of 50 mM Library PCR primer 2, 30 lL of adaptor-ligated DNA and 10 lL of nuclease-free water; 20 min at 72 °C (nick translation), 5 min at 95 °C (denaturation), 15 cycles of PCR (15 s at 95 °C, 15 s at 62 °C, and 1 min at 70 °C) and 5 min at 70 °C (extension). Amplified DNA was purified using the Agencourt AMPure XP kit.

Sequencing In preparation for sequencing, the DNA fragments were clonally amplified by emulsion PCR (ePCR) using beads with P1 primer covalently attached to the surface. Emulsions were broken with butanol, and ePCR beads were enriched by hybridization with P2-coated capture beads (Life Technology). dTs were added to these beads at the 30 end in the presence of terminal transferase to link to the slide glass. Approximately 60 million beads were deposited onto one-fourth of a glass surface of a 25 9 75 mm SOLiD slide. The slide was loaded onto a SOLiD instrument, and the 50-base sequences were obtained according to manufacturer’s protocol. Input control samples were used as positive controls for ChIP DNA sequencing (data not shown).

Data processing and analysis ChIP reads were matched against the Human Genome 19 (hg19) using Bioscope SOLiD software. Alignments were carried out using 50 bp of the reads. Peaks were called using Model-based Analysis of ChIP-Seq (MACS) 1.4 with the default settings (except for P-value which was set at 0.00001 or 0.00005) using data from the parent 293T cells (no tag) as negative control (Zhang et al. 2008). We found 254 peaks using the P-value of 0.00001 and 1274 peaks using the Pvalue of 0.00005. The following analytical steps are carried out using R+Bioconductor packages. We carried out gene assignment using ChIPpeakAnno (Zhu et al. 2010). Before motif analysis, peaks containing simple repeat or low-complex sequences were masked using RepeatMasker (Smit, AFA, Hubley, R & Green, P. RepeatMasker Open-3.0. 1996–2010, ). GADEM and MotIV were used for de novo motif discovery and motif searches in the peak sequences, respectively (Li 2009; Eloi Mercier & Raphael Gottardo 2010). DAVID online service was used for Gene Ontology and PATHWAY analysis. Transcription factor binding sites were searched by JASPAR (Portales-Casamar et al. 2010). P-values of the AT-tract and TGCAGTG motif were

calculated by PWMEnrich (Robert Stojnic & Diego Diez 2014).

Luciferase assay pGL3b was constructed by insertion of the minP sequence (50 -TAGAGGGTATATAATGGAAGCTCGACTTCCAG-30 ) containing a TATA box at the Hind III site of the pGL3-basic (Promega). pGL3-promoter (pGL3p; Promega) contains the SV40 promoter upstream of the luciferase gene. A DNA fragment containing a TdIF1-binding sequence was inserted at the BglII or BamHI site of pGL3b/pGL3p plasmid present upstream or downstream, respectively, of the luciferase gene. The sequence of the entire motif used in the constructions was AAAATTAGCCGGGCGCAGTGGCGGGCGCCTGT AATCCCAGCTACTCAGGAGGCTGAGGCAGGAGAAT CGCTTGAACCCGGGAGGTGGAGTGTGCAGTGAGCC GAGATCACGCCACTGCACTCTAGCCTGGGCGACAG AGTGAGACTCCATCTCAAAAAAA from the MACS peak 1039 on AHCYL2 due to the availability of a Xma I site in the 84-bp spacer that can be used to insert motifs sequentially. Reporter plasmids and the control plasmid pRL-TK were transfected into 293T cells. After 24 h, the cells were lysed and the Photinum pyralis and Renilla reniformis luciferase activities (PLuc and RLuc) were measured by an ARVO X3 plate reader (PerkinElmer). The relative luciferase activity was calculated as PLuc divided by RLuc and normalized to the value obtained with pGL3b or pGL3p. The assay was carried out in triplicate. Statistical significance was determined by Student’s t-test.

Quantitative chromatin immunoprecipitation PCR The chromatin immunoprecipitation (ChIP) assay was carried out using the Low Cell# ChIP Kit (Diagenode). 293T and U2OS cells were transiently transfected with pME-2xFlagTdIF1 and pCSII-MCS-EF-His-TdIF1-3xFLAG, respectively. After harvesting the cells, proteins and DNA were crosslinked in 1% formaldehyde in PBS for 15 min. The reaction was stopped with 125 mM glycine. The cells were washed in PBS and then suspended in ChIP buffer. The chromatin was fragmented with a Covaris S220 focused-ultrasonicator (duty, 20%; intensity, 5; cycles/burst, 200; at 4 °C for 20 min). After centrifugation at 12 300 9 g for 20 min, the fragmented chromatin was mixed with anti-DYKDDDDK-antibody (Wako)-coupled protein G-magnetic beads for 2 h. After wash of the beads, the proteins were digested with Proteinase K at 55 °C for 30 min. The samples were boiled and centrifuged at 12 300 9 g for 1 min, and the purified DNA was obtained from the supernatant. The DNA was amplified and detected using Power SYBR Green PCR Master Mix (Life Technologies) and the Applied Biosystems 7300 real-time PCR system, or using SYBR Premix Ex Taq (Tli RNaseH Plus) (Takara) and the LightCycle Real-Time PCR (Roche) in the following conditions: 95 °C

© 2015 The Authors Genes to Cells © 2015 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Genes to Cells (2015) 20, 242–254

251

K Koiwai et al. for 10 min, 60 cycles of 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s, 60 °C for 30 s and 95 °C for 15 s. The DNA was quantified using a predetermined amount of DNA as a standard and normalized to the value of the input DNA for the ChIP assay. The DNA sequences of the primers used are presented in Table S1 in Supporting Information. The set of primers for the b-actin promoter was described previously (Takahashi et al. 2006).

TdIF1 knockdown using small interfering RNA Three TdIF1-specific small interfering RNAs (siRNAs) and negative control siRNA were designed and purchased from Cosmo Bio. 293T cells were transfected with 200 nM of a cocktail of siRNAs using Lipofectamine RNAiMAX (Life Technologies). After 48 h, cells were harvested, and the TdIF1 knockdown was confirmed by Western blotting and real-time PCR (Fig. S4 in Supporting Information).

Quantitative reverse transcriptase PCR Total RNA was purified from the TdIF1-knockdown or negative control cells using ISOGEN II (Nippon Gene). The cDNA was obtained by reverse transcription, amplified and detected using a Power SYBR Green RNA-to-Ct 1-Step Kit (Life Technologies) and the Applied Biosystems 7300 Real Time PCR system or the LightCycle Real-Time PCR (Roche) in the following conditions: 48 °C for 30 min, 95 °C for 10 min, 60 cycles of 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s, 60 °C for 30 s and 95 °C for 15 s. The DNA sequences of the primers are presented in Table S1 in Supporting Information. The DNA levels were calculated by the comparative Ct (DDCt) method using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal standard and normalized to the value of the negative control. The primers for RAB20 were described in Oleaga et al. (2012). Statistical differences were determined by Student’s t-test.

References Aghdassi, A., Sendler, M., Guenther, A., Mayerle, J., Behn, C.O., Heidecke, C.D., Friess, H., Buchler, M., Evert, M., Lerch, M.M. & Weiss, F.U. (2012) Recruitment of histone deacetylases HDAC1 and HDAC2 by the transcriptional repressor ZEB1 downregulates E-cadherin expression in pancreatic cancer. Gut 61, 439–448. Bantscheff, M., Hopf, C., Savitski, M.M., et al. (2011) Chemoproteomics profiling of HDAC inhibitors reveals selective targeting of HDAC complexes. Nat. Biotechnol. 29, 255–265. Brown-Endres, L., Schoenfeld, D., Tian, F., Kim, H.G., Namba, T., Munoz-Fontela, C., Mandinova, A., Aaronson, S.A. & Lee, S.W. (2012) Expression of the p53 target CDIP correlates with sensitivity to TNFalpha-induced apoptosis in cancer cells. Cancer Res. 72, 2373–2382.

252

Genes to Cells (2015) 20, 242–254

Choi, H.S., Lee, J.H., Park, J.G. & Lee, Y.I. (2002) Trichostatin A, a histone deacetylase inhibitor, activates the IGFBP-3 promoter by upregulating Sp1 activity in hepatoma cells: alteration of the Sp1/Sp3/HDAC1 multiprotein complex. Biochem. Biophys. Res. Commun. 296, 1005–1012. Dephoure, N., Zhou, C., Villen, J., Beausoleil, S.A., Bakalarski, C.E., Elledge, S.J. & Gygi, S.P. (2008) A quantitative atlas of mitotic phosphorylation. Proc. Natl Acad. Sci. USA 105, 10762–10767. Fujisaki, S., Sato, A., Toyomoto, T., Hayano, T., Sugai, M., Kubota, T. & Koiwai, O. (2006) Direct binding of TReP132 with TdT results in reduction of TdT activity. Genes Cells 11, 47–57. Ganti, R., Skapek, S.X., Zhang, J., Fuller, C.E., Wu, J., Billups, C.A., Breitfeld, P.P., Dalton, J.D., Meyer, W.H. & Khoury, J.D. (2006) Expression and genomic status of EGFR and ErbB-2 in alveolar and embryonal rhabdomyosarcoma. Mod. Pathol. 19, 1213–1220. Gizard, F., El-Alfy, M., Duguay, Y., Lavallee, B., DeWitte, F., Staels, B., Beatty, B.G. & Hum, D.W. (2002a) Function of the transcriptional regulating protein of 132 kDa (TReP132) on human P450scc gene expression. Endocr. Res. 28, 559–574. Gizard, F., Lavallee, B., DeWitte, F. & Hum, D.W. (2001) A novel zinc finger protein TReP-132 interacts with CBP/ p300 to regulate human CYP11A1 gene expression. J. Biol. Chem. 276, 33881–33892. Gizard, F., Lavallee, B., DeWitte, F., Teissier, E., Staels, B. & Hum, D.W. (2002b) The transcriptional regulating protein of 132 kDa (TReP-132) enhances P450scc gene transcription through interaction with steroidogenic factor1 in human adrenal cells. J. Biol. Chem. 277, 39144– 39155. Gizard, F., Robillard, R., Barbier, O., Quatannens, B., Faucompre, A., Revillion, F., Peyrat, J.P., Staels, B. & Hum, D.W. (2005) TReP-132 controls cell proliferation by regulating the expression of the cyclin-dependent kinase inhibitors p21WAF1/Cip1 and p27Kip1. Mol. Cell. Biol. 25, 4335–4348. Hao, Y., Xu, N., Box, A.C., Schaefer, L., Kannan, K., Zhang, Y., Florens, L., Seidel, C., Washburn, M.P., Wiegraebe, W. & Mak, H.Y. (2011) Nuclear cGMP-dependent kinase regulates gene expression via activity-dependent recruitment of a conserved histone deacetylase complex. PLoS Genet. 7, e1002065. Hayano, T., Koiwai, K., Ishii, H., Maezawa, S., Kouda, K., Motoyama, T., Kubota, T. & Koiwai, O. (2009) TdT interacting factor 1 enhances TdT ubiquitylation through recruitment of BPOZ-2 into nucleus from cytoplasm. Genes Cells 14, 1415–1427. Kim, C., Lee, H., Cho, Y.M., Kwon, O.J., Kim, W. & Lee, E.K. (2013) TNFalpha-induced miR-130 resulted in adipocyte dysfunction during obesity-related inflammation. FEBS Lett. 587, 3853–3858. Ku, W.C., Chiu, S.K., Chen, Y.J., Huang, H.H. & Wu, W.G. (2009) Complementary quantitative proteomics

© 2015 The Authors Genes to Cells © 2015 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Definition of the TdIF1-binding sequence reveals that transcription factor AP-4 mediates E-boxdependent complex formation for transcriptional repression of HDM2. Mol. Cell Proteomics 8, 2034–2050. Kubota, T., Koiwai, O., Hori, K., Watanabe, N. & Koiwai, K. (2013) TdIF1 recognizes a specific DNA sequence through its helix-turn-helix and AT-hook motifs to regulate gene transcription. PLoS One 8, e66710. Kubota, T., Maezawa, S., Koiwai, K., Hayano, T. & Koiwai, O. (2007) Identification of functional domains in TdIF1 and its inhibitory mechanism for TdT activity. Genes Cells 12, 941–959. Lee, J.H., Kang, M.J., Han, H.Y., Lee, M.G., Jeong, S.I., Ryu, B.K., Ha, T.K., Her, N.G., Han, J., Park, S.J., Lee, K.Y., Kim, H.J. & Chi, S.G. (2011) Epigenetic alteration of PRKCDBP in colorectal cancers and its implication in tumor cell resistance to TNFalpha-induced apoptosis. Clin. Cancer Res. 17, 7551–7562. Lee, Y.H., Kim, S.H., Kim, Y., Lim, Y., Ha, K. & Shin, S.Y. (2012) Inhibitory effect of the antidepressant imipramine on NF-kappaB-dependent CXCL1 expression in TNFalpha-exposed astrocytes. Int. Immunopharmacol. 12, 547–555. Li, L. (2009) GADEM: a genetic algorithm guided formation of spaced dyads coupled with an EM algorithm for motif discovery. J. Comput. Biol. 16, 317–329. Maezawa, S., Fukushima, R., Matsushita, T., Kato, T., Takagaki, Y., Nishiyama, Y., Ando, S., Matsumoto, T., Kouda, K., Hayano, T., Suzuki, M., Koiwai, K. & Koiwai, O. (2012) Ubiquitylation of terminal deoxynucleotidyltransferase inhibits its activity. PLoS One 7, e39511. Maezawa, S., Hayano, T., Koiwai, K., Fukushima, R., Kouda, K., Kubota, T. & Koiwai, O. (2008) Bood POZ containing gene type 2 is a human counterpart of yeast Btb3p and promotes the degradation of terminal deoxynucleotidyltransferase. Genes Cells 13, 439–457. Manelli, F. & Giustina, A. (2000) Glucocorticoid-induced osteoporosis. Trends Endocrinol. Metab. 11, 79–85. Oleaga, C., Welten, S., Belloc, A., Sole, A., Rodriguez, L., Mencia, N., Selga, E., Tapias, A., Noe, V. & Ciudad, C.J. (2012) Identification of novel Sp1 targets involved in proliferation and cancer by functional genomics. Biochem. Pharmacol. 84, 1581–1591. Olsen, J.V., Blagoev, B., Gnad, F., Macek, B., Kumar, C., Mortensen, P. & Mann, M. (2006) Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell 127, 635–648. Orso, F., Cora, D., Ubezio, B., Provero, P., Caselle, M. & Taverna, D. (2010) Identification of functional TFAP2A and SP1 binding sites in new TFAP2A-modulated genes. BMC Genom. 11, 355. Pagliuca, F.W., Collins, M.O., Lichawska, A., Zegerman, P., Choudhary, J.S. & Pines, J. (2011) Quantitative proteomics reveals the basis for the biochemical specificity of the cellcycle machinery. Mol. Cell 43, 406–417. Park, J., Kang, W., Ryu, S.W., Kim, W.I., Chang, D.Y., Lee, D.H., Park do, Y., Choi, Y.H., Choi, K., Shin, E.C. &

Choi, C. (2012) Hepatitis C virus infection enhances TNFalpha-induced cell death via suppression of NF-kappaB. Hepatology 56, 831–840. Portales-Casamar, E., Thongjuea, S., Kwon, A.T., Arenillas, D., Zhao, X., Valen, E., Yusuf, D., Lenhard, B., Wasserman, W.W. & Sandelin, A. (2010) JASPAR 2010: the greatly expanded open-access database of transcription factor binding profiles. Nucleic Acids Res. 38, D105–D110. Ryu, Y.S., Lee, Y., Lee, K.W., Hwang, C.Y., Maeng, J.S., Kim, J.H., Seo, Y.S., You, K.H., Song, B. & Kwon, K.S. (2011) TRIM32 protein sensitizes cells to tumor necrosis factor (TNFalpha)-induced apoptosis via its RING domain-dependent E3 ligase activity against X-linked inhibitor of apoptosis (XIAP). J. Biol. Chem. 286, 25729– 25738. Segre, C.V. & Chiocca, S. (2011) Regulating the regulators: the post-translational code of class I HDAC1 and HDAC2. J. Biomed. Biotechnol. 2011, 690848. Takahashi, K., Hayashi, N., Kaminogawa, S. & Ra, C. (2006) Molecular mechanisms for transcriptional regulation of human high-affinity IgE receptor beta-chain gene induced by GM-CSF. J. Immunol. 177, 4605–4611. Yamamoto, K., Itoh, M., Okamura, T., Kimura, M., Yokoyama, A., Yoshino, Y., Makino, M., Hayakawa, N. & Suzuki, A. (2012) Relative levels of the inflammatory cytokine TNFalpha and the soluble CD40 ligand profile in serum correlate with the thyrotoxic activity of Graves’ disease. Thyroid 22, 516–521. Yamashita, N., Shimazaki, N., Ibe, S., Kaneko, R., Tanabe, A., Toyomoto, T., Fujita, K., Hasegawa, T., Toji, S., Tamai, K., Yamamoto, H. & Koiwai, O. (2001) Terminal deoxynucleotidyltransferase directly interacts with a novel nuclear protein that is homologous to p65. Genes Cells 6, 641–652. Yao, Y.L., Yang, W.M. & Seto, E. (2001) Regulation of transcription factor YY1 by acetylation and deacetylation. Mol. Cell. Biol. 21, 5979–5991. Yoda, M., Kimura, T., Tohmonda, T., Morioka, H., Matsumoto, M., Okada, Y., Toyama, Y. & Horiuchi, K. (2013) Systemic overexpression of TNFalpha-converting enzyme does not lead to enhanced shedding activity in vivo. PLoS One 8, e54412. Yu, J.T., Foster, R.G. & Dean, D.C. (2001) Transcriptional repression by RB-E2F and regulation of anchorage-independent survival. Mol. Cell. Biol. 21, 3325–3335. Zebboudj, A.F., Imura, M. & Bostrom, K. (2002) Matrix GLA protein, a regulatory protein for bone morphogenetic protein-2. J. Biol. Chem. 277, 4388–4394. Zhang, Y., Liu, T., Meyer, C.A., Eeckhoute, J., Johnson, D.S., Bernstein, B.E., Nusbaum, C., Myers, R.M., Brown, M., Li, W. & Liu, X.S. (2008) Model-based analysis of ChIP-Seq (MACS). Genome Biol. 9, R137. Zhu, L.J., Gazin, C., Lawson, N.D., Pages, H., Lin, S.M., Lapointe, D.S. & Green, M.R. (2010) ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data. BMC Bioinformatics 11, 237.

© 2015 The Authors Genes to Cells © 2015 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Genes to Cells (2015) 20, 242–254

253

K Koiwai et al.

254

Received: 12 November 2014 Accepted: 4 December 2014

Figure S1 Putative TdIF1-binding motifs identified by ChIPseq and de novo motif search.

Supporting Information

Figure S2 Predicted presence of binding sites of various transcription factors in the spacer sequences.

Additional Supporting Information may be found in the online version of this article at the publisher’s web site:

Figure S3 Locations and distributions of TdIF1-invivoBM in ossification-related genes.

ChIP-seq data has been deposited database of DDBJ under accession number DRA002226.

Figure S4 Overexpression or knockdown of TdIF1 in 293T cells.

Table S1 Oligonucleotides used in qPCR or for construction of plasmids used in luciferase assays in this study

Figure S5 TdIF1-regulated genes in various pathways.

Genes to Cells (2015) 20, 242–254

© 2015 The Authors Genes to Cells © 2015 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd