GENOMICS

13, 718-725

(1992)

Degenerate Oligonucleotide-Primed PCR: General Amplification of Target DNA by a Single Degenerate Primer HAKAN TELENIUS,*+’

NIGEL P. CARTER, t CHARLOTTE E. BEBB, t MAGNUS NORDENSKJ~LD, BRUCE A. J. PONDER,* AND ALAN TUNNACLIFFE”

$

*CRC Human Cancer Genetics Research Group and tHuman Molecular Genetics Group, Department of Pathology, University of Cambridge, United Kingdom; and *Department of Clinical Genetics, Karolinska Hospital, Stockholm, Sweden Received

December

12, 1991;

A version of the polymerase chain reaction (PCR), termed degenerate oligonucleotide-primed PCR (DOPPCR), which employs oligonucleotides of partially degenerate sequence, has been developed for genome mapping studies. This degeneracy, together with a PCR protocol utilizing a low initial annealing temperature, ensures priming from multiple (e.g., - lo6 in human) evenly dispersed sites within a given genome. Furthermore, as efficient amplification is achieved from the genomes of all species tested using the same primer, the method appears to be species-independent. Thus, for the general amplification of target DNA, DOP-PCR has advantages over interspersed repetitive sequence PCR (IRS-PCR), which relies on the appropriate positioning of species-specific repeat elements. In conjunction with chromosome flow sorting, DOP-PCR has been applied to the characterization of abnormal chromosomes and also to the cloning of new markers for specific chromosome regions. DOP-PCR therefore represents a rapid, efficient, and species-independent technique for general DNA amplification. D 1992 Academic Press,

Inc.

INTRODUCTION

Although the polymerase chain reaction (PCR) was initially introduced to amplify a single locus in target DNA (Saiki et al., 19&j), it is increasingly being used to amplify multiple loci simultaneously. This “general” amplification of DNA has been applied to several areas, including fingerprinting of hybrids (Ledbetter et al., 1990a) and genomes (Welsh and McClelland, 1990; Williams et al., 1990). The main application has however been the rapid generation of new clones from particular genomic regions. The most widely used primers for this general amplification are those based on repetitive sequences within the genome, which allow amplification of segments between suitably positioned repeats. Inter’ To whom correspondence should be addressed at CRC Human Cancer Genetics Research Group, Dept. of Pathology, Tennis Court Road, Cambridge CB2 IQP England.

0888-7543192

$5.00

Copyright Q 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.

718

revised

February

28, 1992

spersed repetitive sequence PCR (IRS-PCR) has in this manner been used to create human chromosome- and region-specific libraries (Nelson et al, 1989; Cotter et al., 1990, 1991; Ledbetter et al., 1990b). In man, the most abundant family of repeats is the Ah family, estimated to comprise 900,000 elements in the haploid genome, thus giving an average spacing of 3-4 kb (Hwu et al., 1986). IRS-PCR has notable advantages for speciesspecific amplification in caseswhere genomes are mixed, such as in human/rodent somatic cell hybrids. However, these repeats are not uniformly distributed. Ah elements, for example, are preferentially found in the Glight bands of human chromosomes (Korenberg and Rykowski, 1988). In cloning experiments, this therefore results in a bias toward these regions, as demonstrated by the banding pattern seen in chromosome paints generated by Alu-PCR (Baldini and Ward, 1991). Furthermore, IRS-PCR is only applicable to those species where abundant repeat families have been identified, whereas other species such as Drosophila and as yet less wellcharacterized animals and plants are not amenable to this type of amplification. The limitations of IRS-PCR can be bypassed to some extent using the linker adapter technique (LA-PCR) (Liidecke et al., 1989; Saunders et al., 1989). In this procedure, small numbers of microdissected chromosome bands or flow-sorted chromosomes are collected and then digested with a frequently cutting restriction enzyme such as RsaI. The resulting fragments are ligated to short oligonucleotides, which serve as priming sites for a general PCR across the unknown sequences. Following amplification, the fragments are cloned. Since RsaI sites can be expected to be distributed evenly throughout any given genome, this technique overcomes the problems of regional bias and species dependence seen with IRS-PCR. However, LA-PCR is technically difficult and involves working with small quantities of DNA and small reaction volumes. For these reasons, we have developed a simple PCR technique involving multiple locus priming, which allows a more general amplification than IRS-PCR and can be used whenever pure DNA of interest, e.g., flow-

GENERAL

AMPLIFICATION

sorted chromosomes, microdissected chromosomes, or isolated yeast artificial chromosomes (YACs), can be obtained. This technique, which is rapid, efficient, and species-independent, is termed degenerate oligonucleotide-primed PCR (DOP-PCR) and has important applications to genome mapping, including chromosome painting and chromosome-specific marker generation. MATERIALS

AND

METHODS

Primer design and PCR conditions. The following primers were used in the study: 6-M (5’ AAGTCGCGGCCGCNNNNNNATG 3’, where N = A, C, G, or T), a degenerate primer containing three specified bases at its 3’ end and a NoA site at its 5’ end; 6-MW (5 CCGACTCGAGNNNNNNATGTGG 3’), a degenerate primer with six specified 3’ bases and a XhoI site at its 5’ end, RetA, a nondegenerate primer (5’ GCAATGAGATGCAACAGAGCA 3’), chosen at random, which is derived from a unique sequence of the RET locus (Sozzi et al., 1991). Target DNAs included human, murine, and Drosophila genomes (100 ng), flow-sorted human chromosome 15 (500 copies) (Telenius et al., 1992), cosmidcTBIRBP-9 (Nakamura et al., 1988) (10 ng), and a 2.4-kb isolated fragment from the RET locus (10 ng). DOPPCR conditions are described in protocol A (Table 1). Where the RetA primer was used, the high annealing temperature was set at 55’C. Variations in concentrations of MgCl,, primer, and Tuq polymerase for amplification of cosmid DNA with primer 6-MW are also listed in Table 1. All PCR products were analyzed by electrophoretic separation on 1% agarose gels. FISH analysis of IRS-PCR and DOP-PCR amplified products. Two different Ah primers, 517 (Nelson et al., 1989) and AlS (BrooksWilson et al., 1990), were used in separate reactions to amplify human genomic DNA in volumes of 50 ~1. PCR conditions used were as described (Nelson et al., 1989; Brooks-Wilson et al., 1990). Biotinylation was achieved by subjecting 5 ~1 of the primary reaction products to a reamplification by a further 25 cycles, which included 300 /.&f biotinll-dUTP (Sigma). DOP-PCR with primer 6-MW was performed as in protocol A (Table 1) on human genomic DNA and a 5-~1 aliquot similarly biotinylated by reamplification for 25 cycles, this time excluding the low annealing temperature cycles. Product concentrations were measured on a fluorometer (Hoefer TKO loo), and 150 ng was used for each in situ hybridization. The probes were ethanol-precipitated with 3 pg of competitor DNA (Cot-l, BRL) and resuspended in 15 ,ul hybridization mix (50% formamide, 10% dextran sulfate, 2X SSC, 0.5 mM Tris-HCl, pH 7.6, 0.1 mM EDTA, 0.1 wg/gl sonicated salmon sperm DNA). Probes were denatured at 65°C for 10 min and then preannealed at 37°C for 60 min. FISH was carried out as previously described (Telenius et al., 1992), using normal male metaphase slides. The slides were analyzed sequentially using a confocal laser scanning microscope (MRC-600, Bio-Rad Microscience Ltd). For each slide, two metaphases were chosen for image analysis: one containing relatively compact chromosomes and another with extended chromosomes. Images were acquired at different amplifier gains but using a constant signal threshold level. Three different amplifier gains (two for primer AlS) were used for each metaphase: the first setting such that the hybridization signal was just detectable on the most repetitive chromosome regions, a second setting at an intermediate gain, and the third at a gain where all, or nearly all, of the genome was covered by signal. For each metaphase and gain combination, image analysis was used to calculate the image area covered by the fluorescent chromosome counterstain, the area of hybridization signal, and the mean intensity of the hybridization signal. The area of hybridization signal was then expressed as a percentage of the area of chromosome counterstain, giving a measure of the completeness of hybridization. Cloning and mapping of DOP-PCR products. The cell line t(10;18) carries two translocation chromosomes, 18pter-q22:10q21-qter and lOpter-q21:1@22-qter. Five hundred copies of each product were isolated by flow sorting as previously described (Telenius et al., 1992) and amplified by DOP-PCR (primer 6-MW; protocol A, Table l), and the

OF

DNA

BY

719

DOP-PCR

PCR fragments were spun through a column (Chromaspin-400, Clontech). The fragments from the larger translocation product (lBpterq22:1Oq21-qter) were then digested with XhoI, for which a restriction site was present in the 6-MW primer sequence, while, as a comparison, the fragments from the smaller reciprocal translocation chromosome were digested with Sau3A. Following extraction with phenol/ chloroform, the products were concentrated by ethanol precipitation and ligated to SalI- or BarnHI-cut Bluescript SKIIvector (Stratagene), for XhoI- and SauBA-cut fragments, respectively. The plasmids were used to transform Escherichia coli TG-1 cells. Ten white colonies from the Sau3A-restricted fragments were grown up and treated according to the alkaline lysis miniprep method (Maniatis et al., 19821, and the inserts were released by XhoI and X&I double digestion. Nine white colonies from the XhoI-digested products were analyzed by placing bacterial cells directly into PCR tubes and performing 30 cycles using the 6-MW primer at the high annealing temperature (62°C). As a comparison, the colonies were also grown up, plasmids were extracted, and the inserts were released by digestion with SmaI and ApaI. Inserts from all the clones were isolated on low-meltingpoint agarose gels. The chromosomal origin of the DOP-PCR clones was confirmed using a panel of somatic cell hybrids (details given in Table 2; only chromosomes present in hybrids are listed). Human genomic and hybrid DNAs were digested with EcoRI, electrophoresed, and Southern blotted onto Hybond N (Amersham). The isolated inserts were labeled by the random priming method (Feinberg and Vogelstein, 1983) and used in turn to probe the mapping filters, using standard techniques (Maniatis et al., 1982). Filters were washed to a final stringency of 0.1~ SSC, at 65°C. Furthermore, 5-10 ng of each insert was blotted onto a filter and hybridized to labeled total genomic DNA to assess the repetitive element content of each clone. Autoradiography was carried out using Kodak X-omat AR film and intensifying screens at -70°C for l-6 days.

RESULTS

PCR with Partially Degenerate Oligonucleotides DOP-PCR was designed to give general amplification of target DNAs at frequently occurring priming sites, without restrictions due to the complexity of DNA or the species from which it was derived. It rests on the principle of priming from short sequences specified by the 3’ end of the oiigonucleotides used, during the initial low annealing temperature cycles of the PCRprotocol. Since these short sequences occur frequently, amplification of target DNA proceeds at multiple loci simultaneously. Annealing of the specified 3’-most primer sequence is stabilized by the adjacent six bases of degenerate sequence. At the 5’ end of the primer is a further specified sequence, including a restriction site for cloning, if required. This 5’ sequence also allows efficient annealing of primers to previously amplified DNA, enabling a higher annealing temperature to be used in later PCR cycles. Two primers of partially degenerate sequence (6-M and 6-MW), with three and six specified bases at their 3’ ends, respectively, were tested singly according to PCR protocol A (Table 1) on genomic DNA. The first five cycles were carried out at a low annealing temperature (30”(Z), with subsequent cycles performed at 62°C. The results show that, although both primers gave the expected smear of fragments, the primer carrying six specified 3’ nucleotides (6-MW) gave more efficient amphfication than that with only three specified bases (6-M)

720

TELENIUS

ET

TABLE Protocols

Protocol A Protocol B Range tested

M&L

Tris-HCl

bM)

(mM/pH)

2 2 2-5

10/8.4 10/8.0,

TAPS”

(mM/pH) 25/9.3

8.4

AL

1

Used for DOP-PCR

KC1 (mM) 50 50 50

DTT*

Primer

dNTPs

W-l’

(mM)

(40

(mM)

(96v/v)

1

2 2 l-8

0.2 0.2 0.2

0.05

Taq d

(U/50 g1) 1.25 2.5 1.25-6.2

No. of low-t,emp

cycles 5 5 2-5

Note. Cycling conditions: 5 min at 95”C, followed by 5 cycles of 1 min at 94”C, 1.5 min at 3O”C, 3 min transition 30-72”C, and 3 min extension at 72°C. Then followed 25-35 cycles of 1 min at 94”C, 1 min at 62”C, and 3 min at 72°C with an addition of 1 s/cycle to the extension step. The final extension was lengthened to 10 min. Amplifications were performed on Perkin-Elmer Cetus and Biometra Trio machines. a N-tris[hydroxymethyl]methyl-3-amino-propanesulfonic acid (Sigma). b Dithiothreitol (Sigma). ’ Polyoxyethylene ether (BRL). d Supplied by Bethesda Research Laboratories and New Brunswick Scientific Biologicals.

(Fig. la), possibly reflecting more efficient annealing of the 6-MW primer. When 6-MW was used on genomic DNA in a PCR where the low annealing temperature cycles were omitted, no amplification was detected, demonstrating the requirement for initial low temperature cycles or previously formed fragments (data not shown). To determine the importance of primer degeneracy to the basic PCR protocol, we compared amplification by degenerate primer 6-MW to that of a nondegenerate primer RetA. When cosmid DNA (containing sequences from the RBP3 locus in human chromosome band lOq11.2) was used as target for DOP-PCR with the 6MW primer, discrete fragments were amplified, although with a background smear (Fig. lb). This suggests preferential priming from specific sites within the COS-

mid, rather than “random” priming, presumably governed by the specified sequence at the 3’ end of 6-MW. The unique primer also amplified sequences from the cosmid, after low annealing temperature PCR cycles, but not to the same extent as the degenerate primer (Fig. lb). Other unique primers gave similar results, although with different banding patterns (data not shown). These data suggest that more priming sites are available to a partially degenerate primer than to a unique primer. An unexplained but reproducible result of this experiment is the appearance of fragments produced by the RetA primer in the absence of target DNA (Fig. lb). These bands were not detected under PCR conditions involving a single, high (55°C) annealing temperature. The phenomenon was also observed with other unique primers, and, very occasionally, with the degenerate oligonucleotide tested. Wesley et al. (1990) have reported a similar result. A possible explanation is contamination of primers with plasmid or cosmid DNAs, but we consider it unlikely that this would be restricted to unique primers. In any case, the general conclusions of the experiment are not affected by this phenomenon. DOP-PCR Efficiency is Dependent on Polymerase and Primer Concentration

FIG. 1. (a) Human genomic DNA amplified by DOP-PCR using different degenerate primers, (1) 6-M; (2) 6-MW; (3) negative control (no DNA), 6-M; (4) negative control (no DNA), 6-MW. The marker lane contains X DNA cut with HindHI. (b) Cosmid DNA amplified by degenerate and nondegenerate primers using cycling conditions as for DOP-PCR (Table l), with the exception that the high annealing temperature was set at 55°C. (1) 6-MW; (2) RetA, 1 PMprimer; (3) RetA, 2 pM primer; (4) negative control (no DNA), RetA, 2 pM primer; (5) negative control (no DNA), 6-MW. The bands in lane (4) are not seen under normal amplification conditions for the Ret primer (55°C).

To investigate the spectrum of working conditions, the primer 6-MW was used on genomic and cosmid DNA under different concentrations of MgCl,, primer, and Taq polymerase, as well as with two different buffer types (as outlined in Table 1). Amplification was shown to take place under all conditions tested. However, the efficiency of the amplification, i.e., the resulting product concentration, was found to be dependent mainly on Taq polymerase concentration (Fig. 2, lanes 7-9), although clearly also proportional to the primer concentration in the 2-3 PM range (Fig. 2, lanes l-3). At very high polymerase concentrations (6.25 U/50 pl), primer-related products were evident in the negative controls (Fig. 2, lane 11). It is likely that these products are also present in the amplification products from cosmid DNA (Fig. 2, lane 9), as fragments larger than the normal PCR range

GENERAL

AMPLIFICATION

FIG. 2. Cosmid DNA amplified using 6-MW in different concentrations of Tag polymerase and primer. (l-3) Constant polymerase (3.75 U/50 al), primer 2,3, and 4 PM; (4-6) constant polymerase (1.25 U/50 nl), primer 4,6, and 8 pM; (7-9) constant primer concentration (2 FM), Tuq polymerase 1.25,3.75, and 6.25 U/50 ~1. No amplification was detected in any negative control except in the tube containing 6.25 U/50 ~1 Z’uq polymerase (11). The marker lane contains X DNA cut with HindIII.

can be seen. These products were reproducible and have not been observed with single locus primers at similar polymerase concentrations. For routine amplifications, we found that 2-4 PM primer and 1.25-4 U of polymerase per 50 ~1 reaction, in 2 mM MgCl, and at a pH of 8.4 (or 9.3 if TAPS was used; protocol B, Table 1) worked well. Under optimal conditions, we achieved product yields of up to 7 pg in 50 ~1. The highest concentrations were obtained when using protocol B. Under most reaction conditions tested, although the product yield varied, the fragment pattern obtained from amplification of the same cosmid did not alter significantly. However, at 5 mM MgCl,, a shift in band intensities and the appearance of some new bands were observed (data not shown). Similarly, at 8 PM primer and 1.25 U polymerase, a shift in intensities could be seen (Fig. 2, lane 6). Amplification Complexity

of DNA

of Different

OF

DNA

BY

721

DOP-PCR

reactions by two different Alu-specific primers, 517 (Nelson et al., 1989) and AlS (Brooks-Wilson et al., 1990), and by DOP-PCR using the 6-MW primer. The fragments were then biotin-labeled by further PCR and hybridized to normal metaphase spreads. FISH was carried out under exactly the same conditions for all three primers and analyzed sequentially using a confocal laser scanning microscope (Fig. 4). A clear difference was observed in that the degenerate primer produced more even hybridization, reaching saturation of the genome at a lower fluorescence signal amplifier gain, than did the Ah primers. Two parameters were evaluated quantitatively with respect to the hybridizations: the area of the chromosomes covered by the signal (Fig. 5a) and the intensity of the hybridization signal (Fig. 5b). Both of these parameters confirmed our observations that the DOP-PCR technique produces brighter and more even paints than IRS-PCR. Cloning and Regional Assignment

of DOP-PCR

Products

DOP-PCR material generated from two reciprocal t(10;18) translocation chromosomes, isolated by flow sorting, was cloned, and a total of 19 clones were analyzed. Nine clones, 2 of which contained highly repetitive sequences, were derived from the translocation chromosome comprising 18pter-q22:10q21-qter. Out of 7 nonrepetitive clones, 3 were mapped using a somatic cell hybrid panel: 1 was shown to map to chromosome 18, and by inference from the starting material, 18pter922, while two clones mapped to lOq21-24. Of 10 clones derived from the reciprocal translocation product comprising lOpter-q21:18q22-qter, two were repetitive. Three single-copy clones were mapped: 2 to chromosome 18q22-qter and 1 to IOpll-pter (Table 2). Although the

Species and

To test the general applicability of the method, DNAs of different species and complexity were amplified (Fig. 3). Genomic DNA from human, mouse and fruit fly were all amplified as smears. Human chromosome 15 also gave a smear, but, as noted above, cosmid DNA was amplified as discrete bands. An isolated genomic fragment of 2.4 kb was also amplified, but to a lesser extent, in accordance with its lower sequence complexity. Comparison

of DOP-PCR

to IRS-PCR

by FlSHAnalysis

We exploited the fluorescence in situ hybridization (FISH) technique to determine, on a cytogenetic level, the extent of amplification using DOP-PCR and IRSPCR. Human genomic DNA was amplified in separate

FIG. 3. DNA of different species and complexity amplified using 6-MW: (1) Human, genomic; (2) mouse, genomic; (3) Drosophila melunogaster, genomic; (4) human, chromosome 15; (5) cosmid, cTBIRBP9; (6) 2.4-kb fragment (iRET T3-1); (‘7) negative control (no DNA). The marker lane contains a mixture of X cut with Hind111 and @X174 cut with HaeIII.

GENERAL

AMPLIFICATION

OF

DNA

a T e

175

I z

150

BY

723

DOP-PCR

b

i

m 0

400

450

500

550

Signal

650

600

Amplifier

700

750

Gain

400

450

500

550

Signal

FIG. 5. (a) Graph displaying the area ratio of signal to chromosomes, plotted against the amplifier gain. the detection system generating a spillover effect, outside the hybridization loci. At lOO%, the chromosomes 4a). (b) Graph displaying the mean intensity of hybridization signal, plotted against the amplifier gain.

hybrid panel alone could not exclude other locations for the chromosome 18 clones, a chromosome paint that was generatedusing the same flow-sorted products (Telenius et al., 1992) showed hybridization signal only on the chromosomes involved in the translocation, thus making other map locations highly unlikely. DISCUSSION General amplification of DNA by PCR is a rapid and efficient way to generate fragments representing the target DNA. We have shown that DOP-PCR yields a more general amplification than IRS-PCR, with the additional advantage of species independence. A technique similar in principle to DOP-PCR was used by Wesley et al. (1990) for the rapid generation of new markers from a microdissected Drosophila polytene chromosome. Their primer used a sequence of three specified 3’ bases, followed by four degenerate positions. In view of our own results, we would predict that these conditions were not optimal, since they observed fewer bands from a source more complex than a cosmid. Recently, another group has created a DNA library from a single microdissected human chromosome by using a unique (nondegenerate) primer in a PCR involving two different annealing temperatures (Hadano et al,, 1991). Although compatible with our results (we observed a smear of products when using nondegenerate primers on genomic DNA; data not shown), we might expect that a more general amplification would have been possible by using a degenerate primer. Efficient amplification of DNA by DOP-PCR relies on two fundamental requirements: (1) initial low annealing temperature cycles, which allow the primer to initiate PCR from short target sequences; and (2) primer

600

Amplifier

DOP-PCR Alu 517.PCR

650

700

750

Gain

A ratio of more than are not completely

100% is due to covered (Fig.

degeneracy. The six degenerate positions create a pool of 46 primers of different sequences, as opposed to the single sequence of a nondegenerate primer. The annealing of the specified 3’ end is probably stabilized by simultaneous annealing at one or more of the “degenerate” positions for any given priming site. The priming in the initial low annealing temperature cycles can therefore be regarded as being determined solely by the six 3’-most specified bases of the oligonucleotide. That priming occurs at specific sequences of the target DNA, rather than at random positions, is indicated by the discrete and reproducible band patterns seen with low complexity target, e.g., cosmid, DNA. Previous work showed that oligonucleotides as short as 12 basescould be used as primers for the specific amplification of a gene (Mack and Sninsky, 1988). Our experiments would suggest that by having degenerate positions 5’ to the specified sequence, an even shorter minimal specific sequence can be used for priming. Both the primer and Taq polymerase concentration are limiting factors for the product yield of DOP-PCR. These limitations would be expected, since the aim of this type of reaction is to amplify as many sites as possible, in contrast to conventional single-locus PCR. For example, calculations show that in a typical single locus PCR, the initial ratio of available primer molecules to target sites is about 4.4 X 108,whereas the same ratio for the primer 6-MW is 300,000 fold less, due to its theoretical priming of every 4 kb. Indeed, by assuming 100% efficiency in each cycle, all degenerate primers would be depleted after 10 cycles, whereas single-locus primers would last 29 cycles. However, the number of available polymerase molecules will limit the reaction before primers are exhausted. If 1.25 U of enzyme is used for a

FIG. 4. Genomic DNA amplified and labeled by PCR for FISH onto normal male metaphase spreads. primer. The amplifier gain was set at (a) 450 and (b) 550. (c, d) Alu-PCR, using 517 as primer. The amplifier (e, f) Ala-PCR, using AlS as primer. The amplifier gain was set at (e) 600 and (f) 700.

(a, b) DOP-PCR, using 6MW as gain was set at (c) 550 and (d) 600.

724

TELENILJS

ET

TABLE Six DOP-PCR Chromosomal

Clones contents

AL.

2

Mapped

on a Hybrid

Panel

of panel Clones

Hybrids TG3” 64034~6’ CY6 Hor1411 B6N4d

3

5

6

8

+

10 pter-qll

10 pter-q24

10 pll-qter

11

+ +

13

+

15

16

18

+ +

+

12

21

22

+

X

+ +

+

+

X8A

+

+ +

X8B

S4

S6

+

SlO +

+

Nate. By including information on the extent of the starting material (flow-sorted translocation chromosomes), nossible (see text). The breakuoints of the transfocation chromosomes have been confirmed by chromosome painting iTelenius et al., 1992). 1 D Mathew et al. (1990). * Fisher et al. (1988). ’ Callen et al. (1988). d Hor1411B6N4 was provided by the UK HGMP Resource Centre.

50-~1 reaction, all polymerase molecules will be engaged by the twenty-first cycle of a single target PCR, after which the reaction will enter a linear rather than exponential mode, while in the case of DOP-PCR, the enzyme will already be limiting during the second cycle. We thus observe a linear amplification by DOP-PCR of any one fragment and it follows that each fragment will be present in only 35-40 times the original concentration (for a PCR of 35-40 cycles), if all priming sites are available. Doubling the concentration of polymerase should double the product yield, but the primer-related formations seen in the negative control at 6.25 U/50 ~1 Tuq concentration probably put an upper limit on the amount of enzyme that can be used. Although these calculations are simplified, they provide a plausible model to explain the results and may help further development of the technique. It should also be noted that we found considerable variations in the yields obtained when using different polymerase preparations, which would indicate differences in enzyme activity and/or stability. Chromosome painting by FISH using PCR-generated probes is an increasingly employed technique in clinical as well as molecular cytogenetics (Lichter et al., 1990; Lengauer et al., 1990; Weier et al., 1990; Trask, 1991). Human Alu repeats have been estimated to occur every 4 kb, i.e., a similar distribution to that of any randomly specified 6-bp sequence. We amplified genomic DNA using Alu-PCR and DOP-PCR and visualized the products by FISH. By analyzing hybridizations carried out in parallel, with identical settings of the confocal microscope, a comparison could be obtained. Although Alu-PCR products can be shown to cover large portions of the genome using a high amplifier gain during image acquisition, DOP-PCR produces a more even and uniform amplification, since its products cover the genome at a lower amplifier gain. In cytogenetic applications, such as chromosome painting of translocations to map breakpoints or to identify the origin of marker chromosomes, this difference in uniformity of amplification is likely to have an impact: Because the DOP-PCR-generated

XllU

+

+

f

Y

mapped

+ + +

t +

t

more precise assignment is of the flow-sorted material

paints are covered at a lower setting of the amplifier signal strength and with a higher intensity hybridization signal, this will produce a better signal-to-noise ratio in chromosome painting experiments, where a high ratio is important for the accurate analysis of the results. Thus, for translocation mapping using DOP-PCR, it is more likely that the limit of the painted region also reflects the true translocation breakpoint and not a region of low amplification. We have previously mapped the breakpoints of three translocations using DOP-PCR, in two cases refining the existing cytogenetic data on these chromosome abnormalities (Telenius et al., 1992). Other cytogenetic aberrations, such as deletions and insertions, are also described using the same methodology (Carter et aZ., 1992). It is envisaged that the application of DOP-PCR to chromosome painting will prove a powerful addition to the technology of cytogenetics. DOP-PCR has also been used as a cloning resource: clones isolated after amplification of flow-sorted translocation chromosomes were shown to map back to the chromosome regions involved. The level of highly repetitive clones, 4/19 (21%), is slightly lower than that reported for IRS-PCR generated libraries: Cotter et al. (1991) found 17/55 (31%) clones to be repetitive and Brooks-Wilson et al. (1990) reported 7/18 (39%) repetitive clones. If significant, this difference might be explained by the supposition that DOP-PCR amplifies more uniformly along the chromosomes, whereas IRSPCR is directed toward repeat-rich regions. DOP-PCR can thus be applied for generating libraries containing a high level of single-copy sequences, provided pure DNA of interest can be obtained, e.g., flow-sorted chromosomes, microdissected chromosome bands, or isolated YACs. ACKNOWLEDGMENTS This work was supported by a program grant from the Cancer Research Campaign. H.T. is funded by grants from the Swedish Medical Research Council, The Torsten and Ragnar Soderberg Foundations,

GENERAL

AMPLIFICATION

The Crafoord Foundation, and The Gyllenstiernska-Krapperup Foundation. B.A.J.P. is a Gibb Fellow of the Cancer Research Campaign. Dr. S. Mole provided the unpublished iRET T3-1 fragment, and the chromosome 18 hybrid DNA was provided by the UK Human Genome Mapping Project Resource Centre. Printing costs were defrayed by the Swedish Medical Research Council.

OF

DNA

BY

DOP-PCR

725

Fluorescence in situ hybridisation with Alu and Ll polymerase chain reaction probes for rapid characterisation of human chromosomes in hybrid cell lines. Proc. Natl. Aead. Sci. USA 87: 6634-

6638. Liidecke, H. J., Senger, G., Claussen, U., and Horsthemke, B. (1989). Cloning defined regions of the human genome by microdissection of banded chromosomes and enzymatic amplification. Nature 338:

348-350. REFERENCES Baldini, A., and Ward, D. C. (1991). In situ hybridization of human chromosomes with Alu-PCR products: A simultaneous karyotype for gene mapping studies. Genamics 9: 770-774. Brooks-Wilson, A. R., Goodfellow, P. N., Povey, S., Nevanlinna, H. A., De Jong, P. J., and Goodfellow, P. J. (1990). Rapid cloning and characterization of new chromosome 10 DNA markers by Alu element-mediated PCR. Genamics 7: 614-620. Callen, D. F., Hyland, V. J., Baker, E. G., Fratini, A., Simmers, R. N., Mulley, J. C., and Sutherland, G. R. (1988). Fine mapping of gene probes and anonymous DNA fragments to the long arm of chromosome 16. Genamics 2: 144-153. Carter, N. P., Ferguson-Smith, M. A., Perryman, M. T., Telenius, H., Pelmear, A. H., Leversha, M. A., Glancy, M. T., Wood, S. L., Cook, K., Dyson, H. M., Ferguson-Smith, M. E., and Willat, L. R. (1992). Reverse chromosome painting: A method for the rapid analysis of aberrant chromosomes in clinical cytogenetics. J. Med. Gent%. 29: 299-307. Cotter, F. E., Hampton, G. M., Nasipuri, S., Bodmer, W. F., and Young, B. D. (1990). Rapid isolation of human chromosome-specific DNA probes from a somatic cell hybrid. Genomics ‘7: 257-263. Cotter, F. E., Das, S., Douek, E., Carter, N. P., and (1991). The generation of DNAprobes to chromosome PCR on small numbers of flow-sorted 22q-derivative Genomics 9: 473-480. Feinberg, A. P., and Vogelstein, B. (1983). A technique ling DNA restriction endonuclease fragments to high ity. Anal. Biochem. 132: 6-13.

Young, B. D. llq23 by Alu chromosomes. for radiolabespecific activ-

Fisher, J. H., Emrie, P. A., Drabkin, H. A., Kushnik, T., Gerber, M., Hofmann, T., and Jones, C. (1988). The gene encoding the hydrophobic surfactant protein SP-C is located on 8p and identifies an EcoRI RFLP. Am. J. Hum. Genet. 43: 436-441. Hadano, S., Watanabe, M., Yokoi, H., Kogi, M., Kondo, I., Tsuchiya, H., Kanazawa, I., Wakasa, K., and Ikeda, J. E. (1991). Laser microdissection and single unique primer PCR allow generation of regional chromosome DNA clones from a single human chromosome. Genamics 11:364-373. Hwu, H. R., Roberts, J. W., Davidson, E. H., and Britten, R. J. (1986). Insertion and/or deletion of many repeated DNA sequences in human and higher ape evolution. Proc. Natl. Acad. Sei. USA 83: 38753879. Korenberg, J. R., and Rykowski, M. C. (1988). Human genome organisation: Alu, lines and the molecular structure of metaphase chromosome bands. Cell 63: 391-400. Ledbetter, S. A., Garcia-Heras, J., and Ledbetter, D. H. (199Oa). “PCR-karyotype” of human chromosomes in somatic cell hybrids. Genomics 8: 614-622. Ledbetter, S. A., Nelson, D. L., Warren, S. T., and Ledbetter, D. H. (199Ob). Rapid isolation of DNA probes within specific chromosome regions by interspersed repetitive sequence polymerase chain reaction. Genamics 6: 475-481. Lengauer, C., Riethman, H., and Cremer, T. (1990). Painting of human chromosomes with probes generated from hybrid cell lines by PCR with Alu and Ll primers. Nun. Genet. 86: 1-6. Lichter, P., Ledbetter, S. A., Ledbetter, D. H., and Ward, D. C. (1990).

Mack, D., and Sninsky, J. J. (1988). A sensitive method for the identification of uncharacterized viruses related to known virus groups: Hepadnavirus model system. Proc. Natl. Acad. Sci. USA 85: 69776981. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982). “Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor Laboratory, Gold Spring Harbor, NY. Mathew, C. G. P., Wakeling, W., Jones, E., Easton, D., Fisher, R., Strong, C., Smith, B., Chin, K., Little, P., Nakamura, Y., Shows, T. B., Jones, C., Goodfellow, P. J., Povey, S., and Ponder, B. A. J. (1990). Regional localisation of polymorphic markers on chromosome 10 by physical and genetic mapping. Ann. Hum. Genet. 54: 121-129. Nakamura, Y., Lathrop, M., Bragg, T., Leppert, T., D’Connei, P., Jones, C., Lalouel, J.-M., and White, R. (1988). An extended genetic linkage map of markers for human chromosome 10. Genomics 3: 389-392. Nelson, D. L., Ledbetter, S. A., Corbo, L., Victoria, M. F., Ramirez-Solis, R., Webster, T. D., Ledbetter, D. H., and Caskey, C. T. (1989). Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources. Proc. Natl. Acad. Sci. USA 86: 6686-6690. Saiki, R., Scharf, S., Faloona, F. A., Mullis, K. B., Horn, G. T., Ehrlich, H. A., and Arnheim, M. (1985). Enzymatic amplification of /3-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230: 1350-1354. Saunders, R. D., Glover, D. M., Ashburner, M., Siden-Kiamos, I., Louis, C., Monastirioti, M., Savakis, C., and Kafatos, F. (1989). PCR amplification of DNA microdissected from a single polytene band: a comparison with conventional microcloning. Nucleic Acids Res. 17:9027-9037. Sozzi, G., nedetti, Mathew, (1991). 1Oq of quence

Pierotti, M. A., Miozzo, M., Donghi, R., Radice, P., De BeV., Grieco, M., Santoro, M., Fusco, A., Vecchio, G., C. G. P., Ponder, B. A. J., Spurr, N. K., and Della Porta, G. Refined localisation to contiguous regions on chromosome the two genes (H4 and RET) that form the oncogenic sePTC. Oncogene 6: 339-342.

Telenius, H., Pelmear, A. H. P., Tunnacliffe, A., Carter, N. P., Behmel, A., Ferguson-Smith, M. A., Nordenskjold, M., Pfragner, R., and Ponder, B. A. J. (1992). Cytogenetic analysis by chromosome painting using DOP-PCR amplified flow-sorted chromosomes. Genes Chrom. Cancer 4: 257-263. Trask, B. J. (1991). Fluorescence in situ hybridisation: Applications cytogenetics and gene mapping. Trends Genet. 7: 149-154.

in

Weier, H.-U. G., Segraves, R., Pinkel, D., and Gray, J. W. (1990). Synthesis of Y chromosome-specific labeled DNA probes by in vitro DNA amplification. J. Histochem. Cytochem. 38: 421-426. Welsh, J., and McGlelland, M. (1990). Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Res. 18: 7213-7218. Wesley, C. S., Ben, M., Kreitman, M., Hagag, N., and Eanes, W. F. (1990). Cloning regions of the Drosophila genome by microdissection of polytene chromosome DNA and PCR with non-specific primer. Nucleic Acids Res. 18: 599-603. Williams, J. G. K., Kubelik, A. R., Livak, K. J., Rafalski, J. A., and Tingey, S. V. (1990). DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18: 6531-

6535.