Food Additives and Contaminants: Part B Vol. 4, No. 1, March 2011, 71–78
VIEW DATASET Deoxynivalenol and zearalenone in Fusarium-contaminated wheat in Mexico City L. Gonza´lez-Osnaya* and A. Farre´s Department of Food and Biotechnology, Facultad de Quimica, Universidad Nacional Autonoma de Mexico, Conjunto E. L-312, Circuito Institutos s/n, Ciudad Universitaria, Mexico 04510, Mexico (Received 11 August 2010; final version received 2 January 2011) Fusarium spp. invasion causes head blight, a destructive disease in the world’s main wheat-growing areas, and deoxynivalenol (DON) and zearalenone (ZEA) contamination in cereal-based products. No data are available on the relationship between Fusarium spp. on commercial wheat samples in Mexico City and the presence of mycotoxins. A total of 30 wheat samples were subject to a PCR method involving genes of the trichothecene and zearalenone biosynthesis pathways to detect the presence of Fusarium. Detection and quantification of DON and ZEA was performed using liquid chromatography coupled to UV detection. PCR indicated the presence of the Tri5 and PKS4 genes in 16.7 and 23.3% of samples, respectively. DON and ZEA contamination was found in 51.2 and 71.4% of samples, respectively, where a positive amplification was obtained. This work presents up-to-date information on mycotoxin contamination in Mexico, where improved contamination/exposure data and firm control/monitoring measures are needed. Keywords: cereals; mycotoxins; Fusarium toxins; zearalenone; trichothecenes
Introduction Fusarium is one of the most important pathogenic fungi of small-grain cereals. It is best known as the pathogen responsible for Fusarium head blight (FHB) disease in wheat, also referred to as head scab (Goswami and Kistler 2004). The economic damage caused by FHB includes reduced yields, discolored, shriveled kernels, mycotoxin contamination and reduced seed quality. Fusarium-infected grains are often contaminated with mycotoxins, such as trichothecenes, fumonisins and zearalenone, which make them unsuitable for use as food and feed (McMullen et al. 1997). The occurrence of mycotoxins in agricultural commodities has long been recognized as a potential hazard for human and animal health. Fusarium fungi have been reported as among the most prominent pathogens of various cereals (Klotzel et al. 2006). They are the most prevalent toxinproducing fungi of the northern temperate regions and are commonly found on cereals grown in the temperate regions of America, Europe and Asia (Creppy 2002). Deoxynivalenol (DON) is one of the most common trichothecene toxins produced by Fusarium. This water-soluble toxin, also known as ‘vomitoxin’, is responsible for emesis and feed refusal in nonruminant animals (Forsyth et al. 1997). Trichothecenes are known to be cytotoxic to mammalian cells and *Corresponding author. Email: [email protected] ISSN 1939–3210 print/ISSN 1939–3229 online ß 2011 Taylor & Francis DOI: 10.1080/19393210.2011.551944 http://www.informaworld.com
cause alimentary toxic aleukia (ATA) under acute toxicosis (Wannemacher et al. 2000). Several genes involved in the biosynthesis of trichothecenes have been described, most of them localized in a gene cluster. The Tri5 gene encodes trichodiene synthase, which catalyzes the first step in the biosynthesis of trichothecenes. The nucleotide sequence of the Tri5 gene has been characterized in several Fusarium species (Hohn and Desjardins 1992; Fekete et al. 1997); all Fusarium species capable of producing trichothecenes carry the Tri5 gene (Niessen and Vogel 1998). Zearalenone (ZEA) is an estrogenic mycotoxin also mainly produced by Fusarium and is naturally found in contaminated grains and cereals (Manova and Mladenova 2009). The toxic effects of ZEA and its metabolites mainly derive from its estrogenic properties, since it can assume a structural shape similar to the naturally occurring estrogens, estradiol, estrone and estriol, and interact with human estrogen receptors in competition with 17 -estradiol (Miksicek 1994; Kuiper et al. 1998). ZEA is a major concern for its estrogenic activity and because it can be a significant contaminant of maize, barley, wheat and other cereals (JECFA 2000; Hagler et al. 2001). It causes hyperestrogenism, especially in pigs, and reproductive problems in experimental animals and livestock (Desjardins and Proctor 2001). Gene disruption studies have determined that four tightly linked genes are required for zearalenone biosynthesis; the PKS4 gene
72
L. Gonza´lez-Osnaya and A. Farre´s
of F. graminearum has been reported to be essential in the production of zearalenone (Lysøe et al. 2006). Surveys for the presence of DON and ZEA have indicated the world-wide occurrence of these mycotoxins primarily in cereals, such as wheat (Cahill et al. 1999; Manova and Mladenova 2009). Wheat is the most important human food grain and ranks second in total production as a cereal crop behind maize. Recently, the European Union (EU) legislated maximum limits for Fusarium toxins in cereals and cereal-based products ranging from 200 to 1750 mg kg1 (European Commission 2006b). The methodology for the analysis of trichothecenes and Fusarium mycotoxins in general is especially complicated; sometimes several purification techniques are required for the same analysis, which can reduce the recovery of the analyte. Thus, reliable and simple analytical methodologies for the analysis of deoxynivalenol and zearalenone are required. Prevention of the formation of deoxynivalenol and zearalenone by fungal contaminants is considered the most effective measure to reduce the levels of these mycotoxins in foodstuffs. For these reasons, it is necessary to ensure quality control of food by identifying and monitoring the contaminant mycobiota and assessing the levels of these mycotoxins. Unfortunately, in Mexico, this type of information is scarce; therefore, the objectives of this work were to apply PCR analysis for the detection of Fusarium in wheat sold in Mexico City, to test for the presence of the Tri5 and PKS4 genes in these samples, and to determine the incidence of DON and ZEA in wheat for human consumption in this city.
Materials and methods Chemicals DON and ZEA were obtained from OEKANAL (RdH, Seelze, Germany). Charcoal and C18 silica were acquired from Sigma (St. Louis, MO, USA). High-performance liquid chromatography (HPLC)grade acetonitrile and methanol were supplied by Merck (Darmstadt, Germany).
Samples Thirty samples of wheat for human consumption were collected in the main market (Central de Abasto) of Mexico City according to the methods of sampling and analysis for the official control of the levels of mycotoxins in foodstuffs (European Commission 2006a). This market is the world’s largest and the most important food distribution center in Mexico; it is the axis of the food supply system in the country and it distributes to most of the city’s and other states markets, supermarkets, restaurants, as well as individuals.
Ten sub-samples of 0.1 kg each were acquired from the same lot; combining all sub-samples the total size was 1 kg for each sample. All samples were stored in sealed plastic bags and kept under refrigeration until analysis.
Fungal cultures from wheat grains Seventy grains of each wheat sample were added to a 300-ml Erlenmeyer flask, immersed in 1% sodium hypochlorite solution for 1 min and washed three times with sterilized water. Five grains were placed on potato-dextrose agar complemented with chloramphenicol (0.5 g l1) plates; these plates were incubated at 28 C for 7 days to permit growth of all species present.
DNA extraction The DNA extraction procedure was adopted with some modifications from the methods of Borges et al. (2009), Chow and Ka¨fer (1993) and Plaza et al. (2004). Fungal mycelium was directly collected from culture plates and 200–500 mg of mycelium material (wet weight) was added to 1.5-ml microcentrifuge tubes. Mycelium material from the fungi was suspended in 500 ml of a bead-beating solution containing: 0.2 M Tris–HCl, (pH 7.5), 0.5 M NaCl, 0.01 M EDTA and 1% SDS. Approximately 0.2 g of mixed diameter (1.0/0.5/0.1 mm) glass beads were added to crush cell walls. The tubes were then vortexed for 10 min at maximum speed. Then, the tubes were centrifuged for 10 min at 11,000 g. After centrifugation, the supernatants were decanted into new tubes and the extraction procedure was repeated. An equal volume of phenol/ chloroform/isoamyl alcohol (25 : 24 : 1, v/v) (Amresco) was added to each sample; the samples were then vortexed briefly and centrifuged for 5 min in a microcentrifuge. The aqueous layer was transferred to a new tube and extracted again with an equal volume of chloroform/isoamyl alcohol (24 : 1, v/v). The tubes were mixed vigorously and centrifuged for 5 min at 11,000 g. The supernatant was transferred to new Eppendorf tubes, and 2.5 volumes of cold isopropanol were added for precipitation of DNA. The tubes were incubated at 20 C for 1 hour, and centrifuged at 4 C for 10 min at 14,000 g. The pellets were washed twice with cold 70% ethanol, air-dried and then resuspended in sterile double deionized water. The samples were treated with RNase (DNase-free) (Roche Molecular Systems). The subsequent DNA yields and quality were assessed by standard electrophoresis through a 2% (w/v) ethidium bromide-stained agarose gel.
Food Additives and Contaminants: Part B
73
Table 1. Oligonucletoide primer sequences, size of PCR products and source of primers for Fusarium spp. Primer code Tri5-F Tri5-R PKS4-F PKS4-R
Sequence (50 –30 )
Amplicon size (bp)
Reference
GCT GCT CAT CAC TTT GCT CAG CTG ATC TGG TCA CGC TCA TC AGATGGCCATGGTGCTTCGTGAT GTGGGCTTCGCTAGACCGTGAGTT
658
Niessen and Vogel (1998)
280
Lysøe et al. (2006)
Polymerase chain reaction (PCR) The sequences of the primers, size of the amplicons and the reference sources are shown in Table 1. PCR amplification was carried out in a 50-ml reaction mix containing 1 Unit of Taq DNA polymerase (Fermentas, Hanover, MD, USA), 1 ml dNTPs (2.5 mM each), 5 ml reaction buffer, 36.5 ml nucleasefree water, 5 ml template DNA and 1 ml each of both forward and reverse primers. DNA amplification was performed in an Axygen Maxygene gradient thermal cycler (Axygen Scientific, Union City, CA, USA) using an initial 5 min denaturation at 95 C followed by 34 cycles of 1 min denaturation at 95 C, 50 s annealing at 58.1 C (for Tri5 primers) and 55 C (for PKS4 primers), 1 min extension at 72 C followed by a final extension of 10 min at 72 C. The amplicons were separated by 2% (w/v) agarose gel electrophoresis. To test specificity of the primer sets for the target fungi, PCR reactions were performed with the genomic DNA of four mycotoxin-producing Fusarium strains (Fu 40, Fu41, Fu53 and Fu60) kindly donated by the Grains and Seeds Research Unit (UNAM) culture collection.
DON and ZEA extraction and clean-up For the extraction of both mycotoxins, 10 g of milled sample were placed in a 125-ml Erlenmeyer flask and extracted with 20 ml of a mixture of acetonitrile/ methanol/water (85 : 10 : 5, v/v) for 30 min at 300 rpm in an horizontal shaker (IKA-WERKE, Staufen, Germany). After the extraction, the solution was filtered and collected. A 10-ml aliquot of the extract was cleaned up according to Valle-Algarra et al. (2005) with slight modifications. Briefly, laboratory-made cartridges were prepared using 5-ml sterile plastic syringes. A glass microfiber filter was placed at the bottom and a mixture of charcoal/C18 silica (3 : 1) was poured in and another glass microfiber filter was placed on top. Then, it was pressed tightly but carefully with a plunger and the aliquot was loaded; gentle vacuum was applied and the filtrate was collected in a tube. The cartridge was rinsed with 2 ml of the same solvent mixture to elute the remaining mycotoxins in the solid phase. The purified extract was evaporated to dryness at 50 C and reconstituted in 400 ml of mobile phase.
LC–UV determination A Waters Alliance 2695 (Milford, MA, USA) SCL-6A liquid chromatography system coupled to a dualwavelength absorbance UV/VIS Waters 2489 detector were used. A LC Phenomenex column Luna C18 (5 mm) (150 4.6 mm I.D.) was employed. The determination of ZEA was performed according to Briones-Reyes et al. (2007); 50 ml of the extract were eluted under isocratic conditions with a mobile phase of acetonitrile/ water/methanol (50 : 42 : 8, v/v) solution at a flow rate of 0.5 ml min1 and 236, 274 and 316 nm wavelengths were used for detection. For the analysis of DON, the mobile phase consisted of acetonitrile/water (90 : 10, v/v) at a flow rate of 0.8 ml min1. Detection of DON was carried out at 218 nm.
Results and discussion Mycotoxins analysis During optimization of the extraction procedure, both blank and enriched wheat (200 mg kg1 of DON and ZEA) were used. Fortification was carried out by direct addition of the standard and placing the sample in a vacuum fume for 30 min. The acetonitrile/methanol/water (85 : 10 : 5, v/v) mixture was found suitable for the extraction of DON from cereals as it yielded high recoveries. Currently, the acetonitrile/water (84/ 16, v/v) mixture, introduced by Chang et al. (1984), is the most widely used solvent for the extraction of trichothecenes in combination with purification columns using charcoal/alumina. Trenholm et al. (1985) demonstrated that the use of these solvents for the extraction yielded less interfering compounds of the matrix compared to mixtures of methanol/water. ZEA is generally extracted either by conventional liquid shaking for a period varying from 30 min to 1 h (Tanaka et al. 2000; Fazekas and Tar 2001) or by blending for few minutes (Krska and Joseph 2001). Various extraction mixtures have been used to extract ZEA form cereals; the most commonly used are acetonitrile/water (Visconti and Pascale 1998; Kruger et al. 1999) and methanol/water (Fazekas and Tar 2001; Llorens et al. 2002) mixed at different ratios. For the simultaneous extraction of DON and ZEA from wheat samples, a slight different polarity is necessary and the mixture acetonitrile/methanol/water used in
74
L. Gonza´lez-Osnaya and A. Farre´s
Table 2. Main performance characteristics of the method.
Analyte
Matrix
LOD mg kg1
LOQ mg kg1
Recovery range (%)
RSDr % (n ¼ 5)
Inter-day variation (%)
Intra-day variation (%)
Accreditation (Yes/No)
DON ZEA
Wheat Wheat
0.0491 0.0730
0.081 0.122
84.3–95.9 78.6–89.4
5.8–14.4 7.8–14.9
6.3 5.5
5.5 6.1
No No
this study provided cleaner extracts than the mixture of methanol/water or acetonitrile/water alone. Interfering compounds must be removed from the extract without substantial losses of the mycotoxins. Purification of extracts with materials such as silica and florisil (magnesium silicate) has long been used in several investigations (Scott et al. 1981; Tanaka et al. 2000), but now most laboratories use mixtures of charcoal, alumina or C18 silica or MycosepÕ columns (mixed charcoal, celite and ion exchange resins) (Biselli et al. 2004; Berthiller et al. 2005) with good recoveries. Nevertheless, ready-made columns are expensive and, in agreement with Valle-Algarra et al. (2005), equivalent results can be obtained with laboratorymade cartridges. Analytical performance parameters are shown in Table 2; the recovery of DON and ZEA did not significantly change when spiking at lower levels. In order to estimate the detection limit (LOD), fortified wheat at concentration levels of 50–500 mg kg1 were extracted and analyzed using the described procedure, the LOD and limit of quantification (LOQ) values were calculated by applying the 3 criterion. The analytical work was conducted on three different days in triplicate to detect any day-to-day effects. Certification exercises on several mycotoxins indicate the possibility that the variation (inter and intraday) values for duplicate recovery experiments do not exceed 15% (Hald et al. 1993). According to the results presented in Table 2, the analytical work conducted fulfills this suggestion. Figure 1 shows chromatograms of a naturally DON-contaminated sample and of ZEA- and DON-fortified wheat; as can be observed, there are no interferences at the retention times of both analytes.
Occurrence of mycotoxins and Fusarium contamination Fusarium spp. contamination on grain of a quality suitable for milling, baking and pasta making has increased during the past few years; this is reflected in the natural contamination found in these samples. According to Placinta et al. (1999), it is possible that fungi may be spread from one country to another with the increase in the global grain trade. However, in the case of Fusarium fungi, this risk is likely to be minimal
Figure 1. LC/UV chromatograms of (a) DON-fortified wheat at 200 mg kg1, (b) ZEA-fortified wheat at 200 mg kg1 and (c) a naturally contaminated wheat sample with 37 mg kg1 DON.
Food Additives and Contaminants: Part B
75
Table 3. Occurrence of deoxynivalenol and zearalenone (mg kg1) in wheat grain samples from Mexico City.
Sample matrix Wheat
Deoxynivalenol
Zearalenone
Numbers of samples in the range (mg kg1)
Numbers of samples in the range (mg kg1)
50.1 11
0.1–0.5 2
0.5–1.0 14
since these pathogens are field rather than storage organisms. In our study, PCR was used to screen wheat samples destined for human consumption. The Tri5 gene codes for trichodiene synthase, which catalyzes the first specific step in the biosynthesis of trichothecenes for all producing fungi, has been particularly well characterized in Fusarium spp. Niessen and Vogel (1998) aligned Tri5 gene sequences of several Fusarium spp. and found two highly conserved regions within the gene. Primers designed for those regions amplified a 658-bp product from 20 different species and varieties within Fusarium. In five wheat samples (16.7% of total), a 658-bp PCR product was obtained with the Tri5-F and Tri5-R primers, as described by Niessen and Vogel (1998). Positive amplifications for the PKS4 gene were also observed in 23.3% of the wheat samples; from these positive samples, only three were positive for both genes. Although Fusarium-infected cereals standing in the field may accumulate mycotoxins before harvest time, numerous experiments tend to indicate that the high levels of ZEA reported to occur naturally in some samples of corn-based animal feeds result from improper storage rather than development in the field (Kuiper-Goodman et al. 1987). On the other hand, there is now overwhelming evidence of global contamination of cereals and animals with Fusarium mycotoxins (Zinedine et al. 2007). The occurrence of both mycotoxins is shown in Table 3. DON was detected in 68.6% of the samples. None of the samples exceeded the maximum permitted level of DON established by the EU for unprocessed cereal (1750 mg kg1); however, 56.7% of samples surpassed the 750 mg kg1 limit for cereals intended for direct human consumption. On the other hand, ZEA was detected in 45.7% of wheat; 14.3% of the positive samples surpassed the maximum permitted level for unprocessed cereals (100 mg kg1) and 43.3% exceeded the 75 mg kg1 limit for cereals intended for direct human consumption (European Commission 2006b). The presence of DON and ZEA in wheat samples should be compared to the positive PCR with primers specifically targeted to the genes involved in the biosynthesis pathways. DON and ZEA contamination was found in 51.2 and 71.4% of the samples where a positive amplification of the Tri5 and PKS4 gene was obtained; however, chemical analysis
1.0–20.0 3
50.073 16
0.073–0.090 6
0.090–0.2 6
0.2–1.0 2
detected DON and ZEA contamination in samples where the PCR assay could not detect the presence of Fusarium. In contrast, our study revealed the presence of potentially toxigenic Fusarium in 13.3% of the samples, but no mycotoxins were detected. Furthermore, PCR based on the gene-specific primer pairs Tri5-F/Tri5-R and PKS4-F/PKS4-R was related with the presence of these mycotoxins in 26.7% of the wheat samples. This last statement reinforces the idea that, even though mycotoxigenic fungi are present, it is not always an indicator of mycotoxin contamination. The average content of DON and ZEA was 628.5 and 77.1 mg kg1 (0.629 and 0.077 mg kg1), respectively. There are studies on the incidence of DON and ZEA in different matrixes; in Canada, high concentrations of ZEA (up to 141 mg kg1) were reported in corn for animals (Funnell 1979). Monitoring of Canadian foods (wheat, barley, soybeans, corn, cornbased foods and grain crops) by Stratton et al. (1993) and Scott (1997) also reported the presence of ZEA at different levels. In Argentina, ZEA was found in wheat (Quiroga et al. 1995) and corn-based foods (Resnik et al. 1996). Monitoring of corn samples which originated from different communities in the State of Tlaxcala (Mexico) showed 70% ZEA contamination, although the degree of contamination (3.25– 83.63 mg kg1) is within the acceptable limits (Briones-Reyes et al. 2007). The incidence of DON in wheat has been widely studied, generally with findings of a high incidence. The SCOOP report on the incidence and intake of trichothecenes by the Member States of the European Union (Schothorst and van Egmond 2004) recorded a total of 57% positive samples for cereal (n ¼ 11,022), mostly wheat; however, in Mexico, data on the occurrence of mycotoxins contamination in food is scarce. This work is the first to report the co-occurrence of these mycotoxins and Fusarium contamination in wheat meant for human consumption from Mexico City.
Discretional exposure assessment to DON and ZEA To assess the public health risk in the Mexican population of consuming DON and ZEA, the exposure of consumers to these toxins can be compared to safety guidelines, such as the TDI (tolerable daily intake).
76
L. Gonza´lez-Osnaya and A. Farre´s
According to the Food and Agriculture Organization of the United Nations Statistical Databases and Data-sets, the Mexican population consumes 99.45 g per day of wheat, corresponding to 36.3 kg per person per year. Therefore, considering an average body weight of 75 kg and the average mycotoxin levels in the analyzed samples, ZEA and DON daily intake by wheat consumption in this city was estimated at 0.102 and 0.83 mg kg1 body weight (bw) day1, respectively; however, it is important to keep in mind the limitations of this estimation and the data used for its calculation. There are some studies which show that the original content of these mycotoxins is distributed during milling into the different fractions obtained (TrigoStockli et al. 1996; Dexter et al. 1997); however, given the variety of products made from this cereal and the increased number of products made from the whole grain, it is very likely that the exposure to these mycotoxins is significant. The estimated daily intake of ZEA represents 20.4% of the provisional maximum tolerable daily intake (PMTDI) established by the Joint FAO/WHO Expert Committee on Food Additives (JECFA 2000) at 0.5 mg kg1 bw. Total intake of DON estimated by the JECFA (2001) in mg kg1 bw day1 was 1.2 for the Latin American diet; this value for the African, European, Asian and Middle East diets was 0.78, 1.4, 1.6 and 2.4, respectively. The estimated total intake of DON for the Mexican population is close to that stated in the latter report; however, it is important to note that this estimated intake is only based on the ingestion of wheat. Given the wide variety of products (corn, rice, etc.) where both ZEA and DON can be found, these values could be significantly higher. The relationship between the intake of each mycotoxin and the TDI levels proposed by the JECFA (1 mg kg1 bw day1 for DON and 0.5 mg kg1 bw day1 temporary TDI for ZEA) has been expressed as a percentage. The mycotoxin intake values found in this study are less than those proposed as TDI for each toxin, and they represented a fraction which does not exceed 20.4% for adults (20.4 and 0.083% for ZEA and DON, respectively). Nonetheless, these percentages may increase for risk groups, such as children. The results of a large-scale European study on the occurrence of Fusarium toxins and dietary intake in the European population (European Commission 2003) demonstrated that, while dietary intakes of trichothecenes were often less than the TDIs for the respective toxin for the entire population and adults, higher intake values were observed for infants and children. Our results provide current data on mycotoxins contamination in this country where occurrence/exposure information and control/monitoring measures are needed to prevent human intake of deoxynivalenol and zearalenone from wheat and related products.
Acknowledgements The authors thank the Unit of Synthesis and DNA Sequencing of the Biotechnology Institute UNAM for the oligonucleotide synthesis and to Cristina Pe´rez Reyes at the Grains and Seeds Research Unit (UNIGRAS, UNAM) for the donation of the Fusarium strains. The authors also acknowledge the support of the ‘‘Programa de Becas Posdoctorales en la UNAM’’ for the development of this research.
References Berthiller F, Schuhmacher R, Buttinger G, Krska R. 2005. Rapid simultaneous determination of major type A- and B-trichothecenes as well as zearalenone in maize by high performance liquid chromatography–tandem mass spectrometry. J Chromatogr A. 1062:209–216. Biselli S, Hartig L, Wegner H, Hummert C. 2004. Analysis of Fusarium toxins using LC/MS–MS: application to various food and feed matrices. LC/GC Eur. 17:25–31. Borges MI, Azevedo MO, Bonatelli RJ, Felipe MSS, Astolfi-Filho S. 1999. A practical method for the preparation of total DNA from filamentous fungi. Fung Genet Newslett. 37:10. Briones-Reyes D, Gomez-Martinez L, Cueva-Rolon R. 2007. Zearalenone contamination in corn for human consumption in the state of Tlaxcala, Mexico. Food Chem. 100:693–698. Cahill LM, Kruger SC, McAlice BT, Ramsey CS, Prioli R, Kohn B. 1999. Quantification of deoxynivalenol in wheat using an immunoaffinity column and liquid chromatography. J Chromatogr A. 859:23–28. Chang HL, DeVries JW, Larson PA, Patel HH. 1984. Rapid determination of deoxynivalenol (vomitoxin) by liquid chromatography using modified Romer column cleanup. J AOAC Int. 67:52–54. Chow TYK, Ka¨fer E. 1993. A rapid method for isolation of total nucleic acids from Aspergillus nidulans. Fung Genet Newslett. 40:25–27. Creppy E. 2002. Update of survey, regulation and toxic effects of mycotoxins in Europe. Toxicol Lett. 127:19–28. Desjardins AE, Proctor RH. 2001. Biochemistry and genetics of Fusarium toxins. In: Summerell BA, Leslie JF, Backhouse D, Bryden WL, Burgess LW, editors. Fusarium. Paul E. Nelson Memorial Symposium. St. Paul (MN): American Phytopathological Society Press. p. 50–69. Dexter JE, Marchylo BA, Clear RM, Clarke JM. 1997. Effect of Fusarium head blight on semolina milling and pasta-making quality of durum wheat. Cereal Chem. 74:519–524. European Commission. 2003. Collection of occurrence data of Fusarium toxins in food and assessment of dietary intake by the population of EU member states, Report on Tasks for Scientific Cooperation (SCOOP) 3.2.10. Brussels: European Commission. European Commission. 2006a. Commission Regulation (EC) No 401/2006 of 23 February 2006 laying down the methods of sampling and analysis for the official control of the levels of mycotoxins in foodstuffs. Off J Eur Union. L70:12.
Food Additives and Contaminants: Part B European Commission. 2006b. Commission Regulation (EC) No. 1881/2006 of 19 December 2006 setting maximum levels for certain contaminants in foodstuffs. Off J Eur Union. L364:17. Fazekas B, Tar A. 2001. Determination of zearalenone content in cereals and feedstuffs by immunoaffinity column coupled with liquid chromatography. J AOAC Int. 84:1453–1459. Fekete C, Logrieco A, Giczey G, Hornok L. 1997. Screening of fungi for the presence of the trichodiene synthase encoding sequence by hybridization to the Tri5 gene cloned from Fusarium poae. Mycopathologia. 138:91–97. Food and Agriculture Organization of the United Nations. Statistical Databases and Data-sets. Food Balance Sheets: Mexico. Available from: http://faostat.fao.org/ Forsyth OM, Yoshizawa T, Morooka N, Tuite J. 1997. Emetic and refusal activity of the deoxynivalenol to swine. Appl Environ Microbiol. 34:547–552. Funnell HS. 1979. Mycotoxins in animal feedstuffs in Ontario, 1972 to 1977. Can J Comp Med. 43:243–246. Goswami RS, Kistler HC. 2004. Heading for disaster: Fusarium graminearum on cereal crops. Mol Plant Pathol. 5:515–525. Hagler Jr WM, Towers NR, Mirocha CJ, Eppley RM, Bryden WL. 2001. Zearalenone: mycotoxin or mycoestrogen? In: Summerell BA, Leslie JF, Backhouse D, Bryden WL, Burgess LW, editors. Fusarium. Paul E. Nelson Memorial Symposium. St. Paul (MN): American Phytopathological Society Press. p. 321–331. Hald B, Wood GM, Boenke A, Schurer B, Finglas P. 1993. Ochratoxin A in wheat: An intercomparison of procedures. Food Addit Contam A. 10:185–207. Hohn T, Desjardins AE. 1992. Isolation and gene disruption of the tox5 gene encoding trichodiene synthase in Gibberella pulicaris. Mol Plant Microbiol Int. 5:249–256. Joint FAO/WHO Expert Committee on Food Additives (JECFA). 2000. Opinion of the Scientific Committee on Food on Fusarium Toxins Part 2: Zearalenone (ZEA). Rome: Food and Agriculture Organization. p. 2–9. Joint FAO/WHO Expert Committee on Food Additives (JECFA). 2001. Safety Evaluation of Certain Mycotoxins in Food. Rome: Food and Agriculture Organization. p. 281–320. Klotzel M, Lauber U, Humpf H-U. 2006. A new solid phase extraction clean-up method for the determination of 12 type A and B trichothecenes in cereals and cereal-based food by LC-MS/MS. Mol Nutr Food Res. 50:261–269. Krska R, Josephs R. 2001. The state-of-the-art in the analysis of estrogenic mycotoxins in cereals. Fresenius J Anal Chem. 369:469–476. Kruger SC, Kohn B, Ramsey CS, Prioli RV. 1999. Rapid immunoaffinity-based method for determination of zearalenone in corn by fluorometry and liquid chromatography. J AOAC Int. 82:1364–1368. Kuiper GJ, Lemmen JG, Carlsson B, Corton C, Safe SH, Van der Saag PT, van der Burg B, Gustafsson JA. 1998. Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor . Endocrinology. 139:4252–4263. Kuiper-Goodman T, Scott PM, Watanabe H. 1987. Risk assessment of the mycotoxin zearalenone. Regul Toxicol Pharmacol. 7:253–306.
77
Llorens A, Mateo R, Mateo JJ, Jimenez M. 2002. Comparison of extraction and clean-up procedures for analysis of zearalenone in corn, rice and wheat grains by high-performance liquid chromatography with photodiode array and fluorescence detection. Food Addit Contam A. 19:272–281. Lysøe E, Klemsdal SS, Bone KR, Frandsen RJN, Johansen T, Thrane U, Giese H. 2006. The PKS4 gene of Fusarium graminearum is essential for zearalenone production. Appl Environ Microbiol. 72:3924–3932. Manova R, Mladenova R. 2009. Incidence of zearalenone and fumonisins in Bulgarian cereal production. Food Control. 20:362–365. McMullen M, Jones R, Gallenberg D. 1997. Scab of wheat and barley: a re-emerging disease of devastating impact. Plant Dis. 81:1340–1348. Miksicek RJ. 1994. Interaction of naturally occurring nonsteroidal estrogens with expressed recombinant human estrogen receptor. J Steroid Biochem. 49:153–160. Niessen ML, Vogel RF. 1998. Group specific PCR-detection of potential trichothecene-producing Fusarium species in pure cultures and cereal samples. Syst Appl Microbiol. 21:618–631. Placinta CM, D’Mello JPF, Macdonald AMC. 1999. A review of worldwide contamination of cereal grains and animal feed with Fusarium mycotoxins. Anim Feed Sci Technol. 78:21–37. Plaza GA, Upchurch R, Brigmon RL, Whitman WB, Ulfig K. 2004. Rapid DNA extraction for screening soil filamentous fungi using PCR amplification. Pol J Environ Stud. 13:315–318. Quiroga N, Resnik S, Pacin A, Martinez E, Pagano A, Riccobene I, Neira S. 1995. Natural occurrence of trichothecenes and zearalenone in Argentine wheat. Food Control. 6:201–204. Resnik S, Neira S, Pacin A, Martinez E, Apro N, Latreite S. 1996. A survey of the natural occurrence of aflatoxins and zearalenone in Argentine field maize: 1983–1994. Food Addit Contam A. 13:115–120. Schothorst RC, van Egmond HP. 2004. Report from SCOOP task 3.2.10: collection of occurrence data of Fusarium toxins in food and assessment of dietary intake by the population of EU member states. Subtask: trichothecenes. Toxicol Lett. 153:133–143. Scott PM. 1997. Multi-year monitoring of Canadian grains and grain based foods for trichothecenes and zearalenone. Food Addit Contam A. 14:333–339. Scott PM, Lau PY, Kanhere SR. 1981. Gas chromatography with electron capture and mass spectrometric detection of deoxynivalenol in wheat and other grains. J AOAC Int. 64:1364–1371. Stratton GW, Robinson AR, Smith HC, Kittilsen L, Barbour M. 1993. Levels of five mycotoxins in grains harvested in Atlantic Canada as measured by high performance liquid chromatography. Arch Environ Contam Toxicol. 24:399–409. Tanaka T, Yoneda A, Inoue S, Sugiura Y, Ueno Y. 2000. Simultaneous determination of trichothecene mycotoxins and zearalenone in cereals by gas chromatography–mass spectrometry. J Chromatogr A. 882:23–28. Trenholm HL, Warner RM, Prelusky DB. 1985. Assessment of extraction procedures in the analysis of naturally
78
L. Gonza´lez-Osnaya and A. Farre´s
contaminated grain products for deoxynivalenol (vomitoxin). J AOAC Int. 68:645–649. Trigo-Stockli DM, Deyoe CW, Satumbaga RF, Pedersen JR. 1996. Distribution of deoxynivalenol and zearalenone in milled fractions of wheat. Cereal Chem. 73:388–391. Valle-Algarra FM, Medina A, Gimeno-Adelantado JV, Llorens A, Jime´nez M, Mateo R. 2005. Comparative assessment of solid-phase extraction clean-up procedures, GC columns and perfluoroacylation reagents for determination of type B trichothecenes in wheat by GC–ECD. Talanta. 66:194–201.
Visconti A, Pascale M. 1998. Determination of zearalenone in corn by means of immunoaffinity clean-up and highperformance liquid chromatography with fluorescence detection. J Chromatogr A. 815:133–140. Wannemacher RJ, Stanley Z, Wiener MD. 2000. Trichothecenes mycotoxins. In: Zajtchuk R, editor. Medical aspects of chemical and biological warfare. Washington (DC): Department of the Army. p. 656–670. Zinedine A, Soriano JM, Molto JC, Man˜es J. 2007. Review on the toxicity, occurrence, metabolism, detoxification, regulations and intake of zearalenone: An oestrogenic mycotoxin. Food Chem Toxicol. 45:1–18.
VIEW DATASET Deoxynivalenol and zearalenone in Fusarium-contaminated wheat in Mexico City L. Gonza´lez-Osnaya* and A. Farre´s Department of Food and Biotechnology, Facultad de Quimica, Universidad Nacional Autonoma de Mexico, Conjunto E. L-312, Circuito Institutos s/n, Ciudad Universitaria, Mexico 04510, Mexico (Received 11 August 2010; final version received 2 January 2011) Fusarium spp. invasion causes head blight, a destructive disease in the world’s main wheat-growing areas, and deoxynivalenol (DON) and zearalenone (ZEA) contamination in cereal-based products. No data are available on the relationship between Fusarium spp. on commercial wheat samples in Mexico City and the presence of mycotoxins. A total of 30 wheat samples were subject to a PCR method involving genes of the trichothecene and zearalenone biosynthesis pathways to detect the presence of Fusarium. Detection and quantification of DON and ZEA was performed using liquid chromatography coupled to UV detection. PCR indicated the presence of the Tri5 and PKS4 genes in 16.7 and 23.3% of samples, respectively. DON and ZEA contamination was found in 51.2 and 71.4% of samples, respectively, where a positive amplification was obtained. This work presents up-to-date information on mycotoxin contamination in Mexico, where improved contamination/exposure data and firm control/monitoring measures are needed. Keywords: cereals; mycotoxins; Fusarium toxins; zearalenone; trichothecenes
Introduction Fusarium is one of the most important pathogenic fungi of small-grain cereals. It is best known as the pathogen responsible for Fusarium head blight (FHB) disease in wheat, also referred to as head scab (Goswami and Kistler 2004). The economic damage caused by FHB includes reduced yields, discolored, shriveled kernels, mycotoxin contamination and reduced seed quality. Fusarium-infected grains are often contaminated with mycotoxins, such as trichothecenes, fumonisins and zearalenone, which make them unsuitable for use as food and feed (McMullen et al. 1997). The occurrence of mycotoxins in agricultural commodities has long been recognized as a potential hazard for human and animal health. Fusarium fungi have been reported as among the most prominent pathogens of various cereals (Klotzel et al. 2006). They are the most prevalent toxinproducing fungi of the northern temperate regions and are commonly found on cereals grown in the temperate regions of America, Europe and Asia (Creppy 2002). Deoxynivalenol (DON) is one of the most common trichothecene toxins produced by Fusarium. This water-soluble toxin, also known as ‘vomitoxin’, is responsible for emesis and feed refusal in nonruminant animals (Forsyth et al. 1997). Trichothecenes are known to be cytotoxic to mammalian cells and *Corresponding author. Email: [email protected] ISSN 1939–3210 print/ISSN 1939–3229 online ß 2011 Taylor & Francis DOI: 10.1080/19393210.2011.551944 http://www.informaworld.com
cause alimentary toxic aleukia (ATA) under acute toxicosis (Wannemacher et al. 2000). Several genes involved in the biosynthesis of trichothecenes have been described, most of them localized in a gene cluster. The Tri5 gene encodes trichodiene synthase, which catalyzes the first step in the biosynthesis of trichothecenes. The nucleotide sequence of the Tri5 gene has been characterized in several Fusarium species (Hohn and Desjardins 1992; Fekete et al. 1997); all Fusarium species capable of producing trichothecenes carry the Tri5 gene (Niessen and Vogel 1998). Zearalenone (ZEA) is an estrogenic mycotoxin also mainly produced by Fusarium and is naturally found in contaminated grains and cereals (Manova and Mladenova 2009). The toxic effects of ZEA and its metabolites mainly derive from its estrogenic properties, since it can assume a structural shape similar to the naturally occurring estrogens, estradiol, estrone and estriol, and interact with human estrogen receptors in competition with 17 -estradiol (Miksicek 1994; Kuiper et al. 1998). ZEA is a major concern for its estrogenic activity and because it can be a significant contaminant of maize, barley, wheat and other cereals (JECFA 2000; Hagler et al. 2001). It causes hyperestrogenism, especially in pigs, and reproductive problems in experimental animals and livestock (Desjardins and Proctor 2001). Gene disruption studies have determined that four tightly linked genes are required for zearalenone biosynthesis; the PKS4 gene
72
L. Gonza´lez-Osnaya and A. Farre´s
of F. graminearum has been reported to be essential in the production of zearalenone (Lysøe et al. 2006). Surveys for the presence of DON and ZEA have indicated the world-wide occurrence of these mycotoxins primarily in cereals, such as wheat (Cahill et al. 1999; Manova and Mladenova 2009). Wheat is the most important human food grain and ranks second in total production as a cereal crop behind maize. Recently, the European Union (EU) legislated maximum limits for Fusarium toxins in cereals and cereal-based products ranging from 200 to 1750 mg kg1 (European Commission 2006b). The methodology for the analysis of trichothecenes and Fusarium mycotoxins in general is especially complicated; sometimes several purification techniques are required for the same analysis, which can reduce the recovery of the analyte. Thus, reliable and simple analytical methodologies for the analysis of deoxynivalenol and zearalenone are required. Prevention of the formation of deoxynivalenol and zearalenone by fungal contaminants is considered the most effective measure to reduce the levels of these mycotoxins in foodstuffs. For these reasons, it is necessary to ensure quality control of food by identifying and monitoring the contaminant mycobiota and assessing the levels of these mycotoxins. Unfortunately, in Mexico, this type of information is scarce; therefore, the objectives of this work were to apply PCR analysis for the detection of Fusarium in wheat sold in Mexico City, to test for the presence of the Tri5 and PKS4 genes in these samples, and to determine the incidence of DON and ZEA in wheat for human consumption in this city.
Materials and methods Chemicals DON and ZEA were obtained from OEKANAL (RdH, Seelze, Germany). Charcoal and C18 silica were acquired from Sigma (St. Louis, MO, USA). High-performance liquid chromatography (HPLC)grade acetonitrile and methanol were supplied by Merck (Darmstadt, Germany).
Samples Thirty samples of wheat for human consumption were collected in the main market (Central de Abasto) of Mexico City according to the methods of sampling and analysis for the official control of the levels of mycotoxins in foodstuffs (European Commission 2006a). This market is the world’s largest and the most important food distribution center in Mexico; it is the axis of the food supply system in the country and it distributes to most of the city’s and other states markets, supermarkets, restaurants, as well as individuals.
Ten sub-samples of 0.1 kg each were acquired from the same lot; combining all sub-samples the total size was 1 kg for each sample. All samples were stored in sealed plastic bags and kept under refrigeration until analysis.
Fungal cultures from wheat grains Seventy grains of each wheat sample were added to a 300-ml Erlenmeyer flask, immersed in 1% sodium hypochlorite solution for 1 min and washed three times with sterilized water. Five grains were placed on potato-dextrose agar complemented with chloramphenicol (0.5 g l1) plates; these plates were incubated at 28 C for 7 days to permit growth of all species present.
DNA extraction The DNA extraction procedure was adopted with some modifications from the methods of Borges et al. (2009), Chow and Ka¨fer (1993) and Plaza et al. (2004). Fungal mycelium was directly collected from culture plates and 200–500 mg of mycelium material (wet weight) was added to 1.5-ml microcentrifuge tubes. Mycelium material from the fungi was suspended in 500 ml of a bead-beating solution containing: 0.2 M Tris–HCl, (pH 7.5), 0.5 M NaCl, 0.01 M EDTA and 1% SDS. Approximately 0.2 g of mixed diameter (1.0/0.5/0.1 mm) glass beads were added to crush cell walls. The tubes were then vortexed for 10 min at maximum speed. Then, the tubes were centrifuged for 10 min at 11,000 g. After centrifugation, the supernatants were decanted into new tubes and the extraction procedure was repeated. An equal volume of phenol/ chloroform/isoamyl alcohol (25 : 24 : 1, v/v) (Amresco) was added to each sample; the samples were then vortexed briefly and centrifuged for 5 min in a microcentrifuge. The aqueous layer was transferred to a new tube and extracted again with an equal volume of chloroform/isoamyl alcohol (24 : 1, v/v). The tubes were mixed vigorously and centrifuged for 5 min at 11,000 g. The supernatant was transferred to new Eppendorf tubes, and 2.5 volumes of cold isopropanol were added for precipitation of DNA. The tubes were incubated at 20 C for 1 hour, and centrifuged at 4 C for 10 min at 14,000 g. The pellets were washed twice with cold 70% ethanol, air-dried and then resuspended in sterile double deionized water. The samples were treated with RNase (DNase-free) (Roche Molecular Systems). The subsequent DNA yields and quality were assessed by standard electrophoresis through a 2% (w/v) ethidium bromide-stained agarose gel.
Food Additives and Contaminants: Part B
73
Table 1. Oligonucletoide primer sequences, size of PCR products and source of primers for Fusarium spp. Primer code Tri5-F Tri5-R PKS4-F PKS4-R
Sequence (50 –30 )
Amplicon size (bp)
Reference
GCT GCT CAT CAC TTT GCT CAG CTG ATC TGG TCA CGC TCA TC AGATGGCCATGGTGCTTCGTGAT GTGGGCTTCGCTAGACCGTGAGTT
658
Niessen and Vogel (1998)
280
Lysøe et al. (2006)
Polymerase chain reaction (PCR) The sequences of the primers, size of the amplicons and the reference sources are shown in Table 1. PCR amplification was carried out in a 50-ml reaction mix containing 1 Unit of Taq DNA polymerase (Fermentas, Hanover, MD, USA), 1 ml dNTPs (2.5 mM each), 5 ml reaction buffer, 36.5 ml nucleasefree water, 5 ml template DNA and 1 ml each of both forward and reverse primers. DNA amplification was performed in an Axygen Maxygene gradient thermal cycler (Axygen Scientific, Union City, CA, USA) using an initial 5 min denaturation at 95 C followed by 34 cycles of 1 min denaturation at 95 C, 50 s annealing at 58.1 C (for Tri5 primers) and 55 C (for PKS4 primers), 1 min extension at 72 C followed by a final extension of 10 min at 72 C. The amplicons were separated by 2% (w/v) agarose gel electrophoresis. To test specificity of the primer sets for the target fungi, PCR reactions were performed with the genomic DNA of four mycotoxin-producing Fusarium strains (Fu 40, Fu41, Fu53 and Fu60) kindly donated by the Grains and Seeds Research Unit (UNAM) culture collection.
DON and ZEA extraction and clean-up For the extraction of both mycotoxins, 10 g of milled sample were placed in a 125-ml Erlenmeyer flask and extracted with 20 ml of a mixture of acetonitrile/ methanol/water (85 : 10 : 5, v/v) for 30 min at 300 rpm in an horizontal shaker (IKA-WERKE, Staufen, Germany). After the extraction, the solution was filtered and collected. A 10-ml aliquot of the extract was cleaned up according to Valle-Algarra et al. (2005) with slight modifications. Briefly, laboratory-made cartridges were prepared using 5-ml sterile plastic syringes. A glass microfiber filter was placed at the bottom and a mixture of charcoal/C18 silica (3 : 1) was poured in and another glass microfiber filter was placed on top. Then, it was pressed tightly but carefully with a plunger and the aliquot was loaded; gentle vacuum was applied and the filtrate was collected in a tube. The cartridge was rinsed with 2 ml of the same solvent mixture to elute the remaining mycotoxins in the solid phase. The purified extract was evaporated to dryness at 50 C and reconstituted in 400 ml of mobile phase.
LC–UV determination A Waters Alliance 2695 (Milford, MA, USA) SCL-6A liquid chromatography system coupled to a dualwavelength absorbance UV/VIS Waters 2489 detector were used. A LC Phenomenex column Luna C18 (5 mm) (150 4.6 mm I.D.) was employed. The determination of ZEA was performed according to Briones-Reyes et al. (2007); 50 ml of the extract were eluted under isocratic conditions with a mobile phase of acetonitrile/ water/methanol (50 : 42 : 8, v/v) solution at a flow rate of 0.5 ml min1 and 236, 274 and 316 nm wavelengths were used for detection. For the analysis of DON, the mobile phase consisted of acetonitrile/water (90 : 10, v/v) at a flow rate of 0.8 ml min1. Detection of DON was carried out at 218 nm.
Results and discussion Mycotoxins analysis During optimization of the extraction procedure, both blank and enriched wheat (200 mg kg1 of DON and ZEA) were used. Fortification was carried out by direct addition of the standard and placing the sample in a vacuum fume for 30 min. The acetonitrile/methanol/water (85 : 10 : 5, v/v) mixture was found suitable for the extraction of DON from cereals as it yielded high recoveries. Currently, the acetonitrile/water (84/ 16, v/v) mixture, introduced by Chang et al. (1984), is the most widely used solvent for the extraction of trichothecenes in combination with purification columns using charcoal/alumina. Trenholm et al. (1985) demonstrated that the use of these solvents for the extraction yielded less interfering compounds of the matrix compared to mixtures of methanol/water. ZEA is generally extracted either by conventional liquid shaking for a period varying from 30 min to 1 h (Tanaka et al. 2000; Fazekas and Tar 2001) or by blending for few minutes (Krska and Joseph 2001). Various extraction mixtures have been used to extract ZEA form cereals; the most commonly used are acetonitrile/water (Visconti and Pascale 1998; Kruger et al. 1999) and methanol/water (Fazekas and Tar 2001; Llorens et al. 2002) mixed at different ratios. For the simultaneous extraction of DON and ZEA from wheat samples, a slight different polarity is necessary and the mixture acetonitrile/methanol/water used in
74
L. Gonza´lez-Osnaya and A. Farre´s
Table 2. Main performance characteristics of the method.
Analyte
Matrix
LOD mg kg1
LOQ mg kg1
Recovery range (%)
RSDr % (n ¼ 5)
Inter-day variation (%)
Intra-day variation (%)
Accreditation (Yes/No)
DON ZEA
Wheat Wheat
0.0491 0.0730
0.081 0.122
84.3–95.9 78.6–89.4
5.8–14.4 7.8–14.9
6.3 5.5
5.5 6.1
No No
this study provided cleaner extracts than the mixture of methanol/water or acetonitrile/water alone. Interfering compounds must be removed from the extract without substantial losses of the mycotoxins. Purification of extracts with materials such as silica and florisil (magnesium silicate) has long been used in several investigations (Scott et al. 1981; Tanaka et al. 2000), but now most laboratories use mixtures of charcoal, alumina or C18 silica or MycosepÕ columns (mixed charcoal, celite and ion exchange resins) (Biselli et al. 2004; Berthiller et al. 2005) with good recoveries. Nevertheless, ready-made columns are expensive and, in agreement with Valle-Algarra et al. (2005), equivalent results can be obtained with laboratorymade cartridges. Analytical performance parameters are shown in Table 2; the recovery of DON and ZEA did not significantly change when spiking at lower levels. In order to estimate the detection limit (LOD), fortified wheat at concentration levels of 50–500 mg kg1 were extracted and analyzed using the described procedure, the LOD and limit of quantification (LOQ) values were calculated by applying the 3 criterion. The analytical work was conducted on three different days in triplicate to detect any day-to-day effects. Certification exercises on several mycotoxins indicate the possibility that the variation (inter and intraday) values for duplicate recovery experiments do not exceed 15% (Hald et al. 1993). According to the results presented in Table 2, the analytical work conducted fulfills this suggestion. Figure 1 shows chromatograms of a naturally DON-contaminated sample and of ZEA- and DON-fortified wheat; as can be observed, there are no interferences at the retention times of both analytes.
Occurrence of mycotoxins and Fusarium contamination Fusarium spp. contamination on grain of a quality suitable for milling, baking and pasta making has increased during the past few years; this is reflected in the natural contamination found in these samples. According to Placinta et al. (1999), it is possible that fungi may be spread from one country to another with the increase in the global grain trade. However, in the case of Fusarium fungi, this risk is likely to be minimal
Figure 1. LC/UV chromatograms of (a) DON-fortified wheat at 200 mg kg1, (b) ZEA-fortified wheat at 200 mg kg1 and (c) a naturally contaminated wheat sample with 37 mg kg1 DON.
Food Additives and Contaminants: Part B
75
Table 3. Occurrence of deoxynivalenol and zearalenone (mg kg1) in wheat grain samples from Mexico City.
Sample matrix Wheat
Deoxynivalenol
Zearalenone
Numbers of samples in the range (mg kg1)
Numbers of samples in the range (mg kg1)
50.1 11
0.1–0.5 2
0.5–1.0 14
since these pathogens are field rather than storage organisms. In our study, PCR was used to screen wheat samples destined for human consumption. The Tri5 gene codes for trichodiene synthase, which catalyzes the first specific step in the biosynthesis of trichothecenes for all producing fungi, has been particularly well characterized in Fusarium spp. Niessen and Vogel (1998) aligned Tri5 gene sequences of several Fusarium spp. and found two highly conserved regions within the gene. Primers designed for those regions amplified a 658-bp product from 20 different species and varieties within Fusarium. In five wheat samples (16.7% of total), a 658-bp PCR product was obtained with the Tri5-F and Tri5-R primers, as described by Niessen and Vogel (1998). Positive amplifications for the PKS4 gene were also observed in 23.3% of the wheat samples; from these positive samples, only three were positive for both genes. Although Fusarium-infected cereals standing in the field may accumulate mycotoxins before harvest time, numerous experiments tend to indicate that the high levels of ZEA reported to occur naturally in some samples of corn-based animal feeds result from improper storage rather than development in the field (Kuiper-Goodman et al. 1987). On the other hand, there is now overwhelming evidence of global contamination of cereals and animals with Fusarium mycotoxins (Zinedine et al. 2007). The occurrence of both mycotoxins is shown in Table 3. DON was detected in 68.6% of the samples. None of the samples exceeded the maximum permitted level of DON established by the EU for unprocessed cereal (1750 mg kg1); however, 56.7% of samples surpassed the 750 mg kg1 limit for cereals intended for direct human consumption. On the other hand, ZEA was detected in 45.7% of wheat; 14.3% of the positive samples surpassed the maximum permitted level for unprocessed cereals (100 mg kg1) and 43.3% exceeded the 75 mg kg1 limit for cereals intended for direct human consumption (European Commission 2006b). The presence of DON and ZEA in wheat samples should be compared to the positive PCR with primers specifically targeted to the genes involved in the biosynthesis pathways. DON and ZEA contamination was found in 51.2 and 71.4% of the samples where a positive amplification of the Tri5 and PKS4 gene was obtained; however, chemical analysis
1.0–20.0 3
50.073 16
0.073–0.090 6
0.090–0.2 6
0.2–1.0 2
detected DON and ZEA contamination in samples where the PCR assay could not detect the presence of Fusarium. In contrast, our study revealed the presence of potentially toxigenic Fusarium in 13.3% of the samples, but no mycotoxins were detected. Furthermore, PCR based on the gene-specific primer pairs Tri5-F/Tri5-R and PKS4-F/PKS4-R was related with the presence of these mycotoxins in 26.7% of the wheat samples. This last statement reinforces the idea that, even though mycotoxigenic fungi are present, it is not always an indicator of mycotoxin contamination. The average content of DON and ZEA was 628.5 and 77.1 mg kg1 (0.629 and 0.077 mg kg1), respectively. There are studies on the incidence of DON and ZEA in different matrixes; in Canada, high concentrations of ZEA (up to 141 mg kg1) were reported in corn for animals (Funnell 1979). Monitoring of Canadian foods (wheat, barley, soybeans, corn, cornbased foods and grain crops) by Stratton et al. (1993) and Scott (1997) also reported the presence of ZEA at different levels. In Argentina, ZEA was found in wheat (Quiroga et al. 1995) and corn-based foods (Resnik et al. 1996). Monitoring of corn samples which originated from different communities in the State of Tlaxcala (Mexico) showed 70% ZEA contamination, although the degree of contamination (3.25– 83.63 mg kg1) is within the acceptable limits (Briones-Reyes et al. 2007). The incidence of DON in wheat has been widely studied, generally with findings of a high incidence. The SCOOP report on the incidence and intake of trichothecenes by the Member States of the European Union (Schothorst and van Egmond 2004) recorded a total of 57% positive samples for cereal (n ¼ 11,022), mostly wheat; however, in Mexico, data on the occurrence of mycotoxins contamination in food is scarce. This work is the first to report the co-occurrence of these mycotoxins and Fusarium contamination in wheat meant for human consumption from Mexico City.
Discretional exposure assessment to DON and ZEA To assess the public health risk in the Mexican population of consuming DON and ZEA, the exposure of consumers to these toxins can be compared to safety guidelines, such as the TDI (tolerable daily intake).
76
L. Gonza´lez-Osnaya and A. Farre´s
According to the Food and Agriculture Organization of the United Nations Statistical Databases and Data-sets, the Mexican population consumes 99.45 g per day of wheat, corresponding to 36.3 kg per person per year. Therefore, considering an average body weight of 75 kg and the average mycotoxin levels in the analyzed samples, ZEA and DON daily intake by wheat consumption in this city was estimated at 0.102 and 0.83 mg kg1 body weight (bw) day1, respectively; however, it is important to keep in mind the limitations of this estimation and the data used for its calculation. There are some studies which show that the original content of these mycotoxins is distributed during milling into the different fractions obtained (TrigoStockli et al. 1996; Dexter et al. 1997); however, given the variety of products made from this cereal and the increased number of products made from the whole grain, it is very likely that the exposure to these mycotoxins is significant. The estimated daily intake of ZEA represents 20.4% of the provisional maximum tolerable daily intake (PMTDI) established by the Joint FAO/WHO Expert Committee on Food Additives (JECFA 2000) at 0.5 mg kg1 bw. Total intake of DON estimated by the JECFA (2001) in mg kg1 bw day1 was 1.2 for the Latin American diet; this value for the African, European, Asian and Middle East diets was 0.78, 1.4, 1.6 and 2.4, respectively. The estimated total intake of DON for the Mexican population is close to that stated in the latter report; however, it is important to note that this estimated intake is only based on the ingestion of wheat. Given the wide variety of products (corn, rice, etc.) where both ZEA and DON can be found, these values could be significantly higher. The relationship between the intake of each mycotoxin and the TDI levels proposed by the JECFA (1 mg kg1 bw day1 for DON and 0.5 mg kg1 bw day1 temporary TDI for ZEA) has been expressed as a percentage. The mycotoxin intake values found in this study are less than those proposed as TDI for each toxin, and they represented a fraction which does not exceed 20.4% for adults (20.4 and 0.083% for ZEA and DON, respectively). Nonetheless, these percentages may increase for risk groups, such as children. The results of a large-scale European study on the occurrence of Fusarium toxins and dietary intake in the European population (European Commission 2003) demonstrated that, while dietary intakes of trichothecenes were often less than the TDIs for the respective toxin for the entire population and adults, higher intake values were observed for infants and children. Our results provide current data on mycotoxins contamination in this country where occurrence/exposure information and control/monitoring measures are needed to prevent human intake of deoxynivalenol and zearalenone from wheat and related products.
Acknowledgements The authors thank the Unit of Synthesis and DNA Sequencing of the Biotechnology Institute UNAM for the oligonucleotide synthesis and to Cristina Pe´rez Reyes at the Grains and Seeds Research Unit (UNIGRAS, UNAM) for the donation of the Fusarium strains. The authors also acknowledge the support of the ‘‘Programa de Becas Posdoctorales en la UNAM’’ for the development of this research.
References Berthiller F, Schuhmacher R, Buttinger G, Krska R. 2005. Rapid simultaneous determination of major type A- and B-trichothecenes as well as zearalenone in maize by high performance liquid chromatography–tandem mass spectrometry. J Chromatogr A. 1062:209–216. Biselli S, Hartig L, Wegner H, Hummert C. 2004. Analysis of Fusarium toxins using LC/MS–MS: application to various food and feed matrices. LC/GC Eur. 17:25–31. Borges MI, Azevedo MO, Bonatelli RJ, Felipe MSS, Astolfi-Filho S. 1999. A practical method for the preparation of total DNA from filamentous fungi. Fung Genet Newslett. 37:10. Briones-Reyes D, Gomez-Martinez L, Cueva-Rolon R. 2007. Zearalenone contamination in corn for human consumption in the state of Tlaxcala, Mexico. Food Chem. 100:693–698. Cahill LM, Kruger SC, McAlice BT, Ramsey CS, Prioli R, Kohn B. 1999. Quantification of deoxynivalenol in wheat using an immunoaffinity column and liquid chromatography. J Chromatogr A. 859:23–28. Chang HL, DeVries JW, Larson PA, Patel HH. 1984. Rapid determination of deoxynivalenol (vomitoxin) by liquid chromatography using modified Romer column cleanup. J AOAC Int. 67:52–54. Chow TYK, Ka¨fer E. 1993. A rapid method for isolation of total nucleic acids from Aspergillus nidulans. Fung Genet Newslett. 40:25–27. Creppy E. 2002. Update of survey, regulation and toxic effects of mycotoxins in Europe. Toxicol Lett. 127:19–28. Desjardins AE, Proctor RH. 2001. Biochemistry and genetics of Fusarium toxins. In: Summerell BA, Leslie JF, Backhouse D, Bryden WL, Burgess LW, editors. Fusarium. Paul E. Nelson Memorial Symposium. St. Paul (MN): American Phytopathological Society Press. p. 50–69. Dexter JE, Marchylo BA, Clear RM, Clarke JM. 1997. Effect of Fusarium head blight on semolina milling and pasta-making quality of durum wheat. Cereal Chem. 74:519–524. European Commission. 2003. Collection of occurrence data of Fusarium toxins in food and assessment of dietary intake by the population of EU member states, Report on Tasks for Scientific Cooperation (SCOOP) 3.2.10. Brussels: European Commission. European Commission. 2006a. Commission Regulation (EC) No 401/2006 of 23 February 2006 laying down the methods of sampling and analysis for the official control of the levels of mycotoxins in foodstuffs. Off J Eur Union. L70:12.
Food Additives and Contaminants: Part B European Commission. 2006b. Commission Regulation (EC) No. 1881/2006 of 19 December 2006 setting maximum levels for certain contaminants in foodstuffs. Off J Eur Union. L364:17. Fazekas B, Tar A. 2001. Determination of zearalenone content in cereals and feedstuffs by immunoaffinity column coupled with liquid chromatography. J AOAC Int. 84:1453–1459. Fekete C, Logrieco A, Giczey G, Hornok L. 1997. Screening of fungi for the presence of the trichodiene synthase encoding sequence by hybridization to the Tri5 gene cloned from Fusarium poae. Mycopathologia. 138:91–97. Food and Agriculture Organization of the United Nations. Statistical Databases and Data-sets. Food Balance Sheets: Mexico. Available from: http://faostat.fao.org/ Forsyth OM, Yoshizawa T, Morooka N, Tuite J. 1997. Emetic and refusal activity of the deoxynivalenol to swine. Appl Environ Microbiol. 34:547–552. Funnell HS. 1979. Mycotoxins in animal feedstuffs in Ontario, 1972 to 1977. Can J Comp Med. 43:243–246. Goswami RS, Kistler HC. 2004. Heading for disaster: Fusarium graminearum on cereal crops. Mol Plant Pathol. 5:515–525. Hagler Jr WM, Towers NR, Mirocha CJ, Eppley RM, Bryden WL. 2001. Zearalenone: mycotoxin or mycoestrogen? In: Summerell BA, Leslie JF, Backhouse D, Bryden WL, Burgess LW, editors. Fusarium. Paul E. Nelson Memorial Symposium. St. Paul (MN): American Phytopathological Society Press. p. 321–331. Hald B, Wood GM, Boenke A, Schurer B, Finglas P. 1993. Ochratoxin A in wheat: An intercomparison of procedures. Food Addit Contam A. 10:185–207. Hohn T, Desjardins AE. 1992. Isolation and gene disruption of the tox5 gene encoding trichodiene synthase in Gibberella pulicaris. Mol Plant Microbiol Int. 5:249–256. Joint FAO/WHO Expert Committee on Food Additives (JECFA). 2000. Opinion of the Scientific Committee on Food on Fusarium Toxins Part 2: Zearalenone (ZEA). Rome: Food and Agriculture Organization. p. 2–9. Joint FAO/WHO Expert Committee on Food Additives (JECFA). 2001. Safety Evaluation of Certain Mycotoxins in Food. Rome: Food and Agriculture Organization. p. 281–320. Klotzel M, Lauber U, Humpf H-U. 2006. A new solid phase extraction clean-up method for the determination of 12 type A and B trichothecenes in cereals and cereal-based food by LC-MS/MS. Mol Nutr Food Res. 50:261–269. Krska R, Josephs R. 2001. The state-of-the-art in the analysis of estrogenic mycotoxins in cereals. Fresenius J Anal Chem. 369:469–476. Kruger SC, Kohn B, Ramsey CS, Prioli RV. 1999. Rapid immunoaffinity-based method for determination of zearalenone in corn by fluorometry and liquid chromatography. J AOAC Int. 82:1364–1368. Kuiper GJ, Lemmen JG, Carlsson B, Corton C, Safe SH, Van der Saag PT, van der Burg B, Gustafsson JA. 1998. Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor . Endocrinology. 139:4252–4263. Kuiper-Goodman T, Scott PM, Watanabe H. 1987. Risk assessment of the mycotoxin zearalenone. Regul Toxicol Pharmacol. 7:253–306.
77
Llorens A, Mateo R, Mateo JJ, Jimenez M. 2002. Comparison of extraction and clean-up procedures for analysis of zearalenone in corn, rice and wheat grains by high-performance liquid chromatography with photodiode array and fluorescence detection. Food Addit Contam A. 19:272–281. Lysøe E, Klemsdal SS, Bone KR, Frandsen RJN, Johansen T, Thrane U, Giese H. 2006. The PKS4 gene of Fusarium graminearum is essential for zearalenone production. Appl Environ Microbiol. 72:3924–3932. Manova R, Mladenova R. 2009. Incidence of zearalenone and fumonisins in Bulgarian cereal production. Food Control. 20:362–365. McMullen M, Jones R, Gallenberg D. 1997. Scab of wheat and barley: a re-emerging disease of devastating impact. Plant Dis. 81:1340–1348. Miksicek RJ. 1994. Interaction of naturally occurring nonsteroidal estrogens with expressed recombinant human estrogen receptor. J Steroid Biochem. 49:153–160. Niessen ML, Vogel RF. 1998. Group specific PCR-detection of potential trichothecene-producing Fusarium species in pure cultures and cereal samples. Syst Appl Microbiol. 21:618–631. Placinta CM, D’Mello JPF, Macdonald AMC. 1999. A review of worldwide contamination of cereal grains and animal feed with Fusarium mycotoxins. Anim Feed Sci Technol. 78:21–37. Plaza GA, Upchurch R, Brigmon RL, Whitman WB, Ulfig K. 2004. Rapid DNA extraction for screening soil filamentous fungi using PCR amplification. Pol J Environ Stud. 13:315–318. Quiroga N, Resnik S, Pacin A, Martinez E, Pagano A, Riccobene I, Neira S. 1995. Natural occurrence of trichothecenes and zearalenone in Argentine wheat. Food Control. 6:201–204. Resnik S, Neira S, Pacin A, Martinez E, Apro N, Latreite S. 1996. A survey of the natural occurrence of aflatoxins and zearalenone in Argentine field maize: 1983–1994. Food Addit Contam A. 13:115–120. Schothorst RC, van Egmond HP. 2004. Report from SCOOP task 3.2.10: collection of occurrence data of Fusarium toxins in food and assessment of dietary intake by the population of EU member states. Subtask: trichothecenes. Toxicol Lett. 153:133–143. Scott PM. 1997. Multi-year monitoring of Canadian grains and grain based foods for trichothecenes and zearalenone. Food Addit Contam A. 14:333–339. Scott PM, Lau PY, Kanhere SR. 1981. Gas chromatography with electron capture and mass spectrometric detection of deoxynivalenol in wheat and other grains. J AOAC Int. 64:1364–1371. Stratton GW, Robinson AR, Smith HC, Kittilsen L, Barbour M. 1993. Levels of five mycotoxins in grains harvested in Atlantic Canada as measured by high performance liquid chromatography. Arch Environ Contam Toxicol. 24:399–409. Tanaka T, Yoneda A, Inoue S, Sugiura Y, Ueno Y. 2000. Simultaneous determination of trichothecene mycotoxins and zearalenone in cereals by gas chromatography–mass spectrometry. J Chromatogr A. 882:23–28. Trenholm HL, Warner RM, Prelusky DB. 1985. Assessment of extraction procedures in the analysis of naturally
78
L. Gonza´lez-Osnaya and A. Farre´s
contaminated grain products for deoxynivalenol (vomitoxin). J AOAC Int. 68:645–649. Trigo-Stockli DM, Deyoe CW, Satumbaga RF, Pedersen JR. 1996. Distribution of deoxynivalenol and zearalenone in milled fractions of wheat. Cereal Chem. 73:388–391. Valle-Algarra FM, Medina A, Gimeno-Adelantado JV, Llorens A, Jime´nez M, Mateo R. 2005. Comparative assessment of solid-phase extraction clean-up procedures, GC columns and perfluoroacylation reagents for determination of type B trichothecenes in wheat by GC–ECD. Talanta. 66:194–201.
Visconti A, Pascale M. 1998. Determination of zearalenone in corn by means of immunoaffinity clean-up and highperformance liquid chromatography with fluorescence detection. J Chromatogr A. 815:133–140. Wannemacher RJ, Stanley Z, Wiener MD. 2000. Trichothecenes mycotoxins. In: Zajtchuk R, editor. Medical aspects of chemical and biological warfare. Washington (DC): Department of the Army. p. 656–670. Zinedine A, Soriano JM, Molto JC, Man˜es J. 2007. Review on the toxicity, occurrence, metabolism, detoxification, regulations and intake of zearalenone: An oestrogenic mycotoxin. Food Chem Toxicol. 45:1–18.
