G Model SYAPM-25692; No. of Pages 5

ARTICLE IN PRESS Systematic and Applied Microbiology xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Systematic and Applied Microbiology journal homepage: www.elsevier.de/syapm

Description of a novel marine bacterium, Vibrio hyugaensis sp. nov., based on genomic and phenotypic characterization夽 Yoshiko Urbanczyk a , Yoshitoshi Ogura b,c , Tetsuya Hayashi b,c , Henryk Urbanczyk a,∗ a Department of Marine Biology and Environmental Sciences, Faculty of Agriculture, University of Miyazaki, Gakuen-kibanadai-nishi-1-1, Miyazaki 889-2192, Japan b Division of Microbial Genomics, Department of Genomics and Bioenvironmental Science, Frontier Science Research Center, University of Miyazaki, 5200 Kihara, Kiyotake, Miyazaki 889-1692, Japan c Division of Microbiology, Department of Infectious Diseases, Faculty of Medicine, University of Miyazaki, 5200 Kihara, Kiyotake, Miyazaki 889-1692, Japan

a r t i c l e

i n f o

Article history: Received 27 January 2015 Received in revised form 6 April 2015 Accepted 10 April 2015 Keywords: Vibrio hyugaensis sp. nov. Vibrionaceae Vibrio Harveyi clade Genomic taxonomy

a b s t r a c t Three luminous bacteria strains have been isolated from seawater samples collected in the coastal regions of the Miyazaki prefecture in Japan. Analysis of the 16S rRNA gene sequences identified the three strains as members of the genus Vibrio (Vibrionaceae, Gammaproteobacteria), closely related to bacteria in the so-called ‘Harveyi clade.’ The genomes of the three strains were estimated to be between 5.49 Mbp and 5.95 Mbp, with average G + C of 43.91%. The genome sequence data was used to estimate relatedness of the three strains to related Vibrio bacteria, including estimation of frequency of recombination events, calculation of average nucleotide identity (ANI), and a phylogenetic analysis based on concatenated alignment of nucleotide sequences of 135 protein coding genes. Results of these analyses in all cases showed the three strains forming a group clearly separate from previously described Vibrio species. A phenotypic analysis revealed that the three strains have character similar to Vibrio bacteria in the ‘Harveyi clade’, but can be differentiated from previously described species by testing for hydrolysis of esculin. Based on results of genomic, phylogenetic and phenotypic analyses presented in this study, it can be concluded that the three strains represent a novel species, for which the name Vibrio hyugaensis sp. nov. is proposed. The type strain is 090810aT (=LMG 28466T = NBRC 110633T ). © 2015 Elsevier GmbH. All rights reserved.

Introduction Bacteria in the family Vibrionaceae (Gammaproteobacteria) are widely distributed in the marine environment. Vibrionaceae have been found in the coastal seawater, marine sediments, and associated with a variety of marine animals [17]. Some species of Vibrionaceae are important human pathogens [4]. The family includes over 150 species in seven genera, with most species classified into the genera Vibrio, Photobacterium and Aliivibrio [4,15,17]. Over 20 species in the family have been characterized as luminous, i.e. bacteria that carry the lux genes organized as the lux operon, which code for proteins involved in light production [5]. Luminous phenotype was observed in Vibrio bacteria since the earliest days of microbiology, and is frequently used in identification of marine bacterial isolates [5,6,13]. In Vibrionaceae, the luminous species have

夽 Accession numbers for 16S rRNA sequences generated in this study are LC004912–LC004914. ∗ Corresponding author. Tel.: +81 985 58 7226; fax: +81 985 58 7226. E-mail address: [email protected] (H. Urbanczyk).

been classified in the genera Vibrio, Photobacterium and Aliivibrio, as well as in the genus ‘Candidatus Photodesmus’ [2,5,9,18,19]. Studies of origin and evolutionary history of the luminous genes offer a unique insight into processes shaping the evolution and diversity of Vibrionaceae. The lux operon evolution was proposed to involve recruitment of regulatory genes, duplication of some genes, loss of some luminous genes from the lux operon, as well as horizontal transfer of complete and functional lux operon [1,5,20,21]. Studies of the lux genes evolutionary history rely on the accurate taxonomic classification of luminous Vibrio isolates and understanding of evolutionary relationship between luminous species in the family. However, luminous Vibrio are notoriously difficult to accurately taxonomically classify due to similar phenotypic characteristics, and frequently require the use of genomic characterization for classification [5]. Recent analysis of inter- and intraspecies recombination frequencies in Vibrio bacteria identified three luminous strains as different from known Vibrionaceae species [23]. Based on results of genomic analysis the three strains were initially identified as members of the genus Vibrio, closely related to bacteria in the so-called ‘Harveyi clade’ [3,15,22,25]. The aim of this study was to taxonomic

http://dx.doi.org/10.1016/j.syapm.2015.04.001 0723-2020/© 2015 Elsevier GmbH. All rights reserved.

Please cite this article in press as: Y. Urbanczyk, et al., Description of a novel marine bacterium, Vibrio hyugaensis sp. nov., based on genomic and phenotypic characterization, Syst. Appl. Microbiol. (2015), http://dx.doi.org/10.1016/j.syapm.2015.04.001

G Model SYAPM-25692; No. of Pages 5

ARTICLE IN PRESS Y. Urbanczyk et al. / Systematic and Applied Microbiology xxx (2015) xxx–xxx

2

classify the three strains by a polyphasic approach that included MLSA, calculation of average nucleotide identities, and phenotypic characterization.

V. azureus NBRC 104587T V. sagamiensis NBRC 104589T 100 V. alginolyticus NBRC 15630T 100 100

Materials and methods Strains 090810aT , 151112A and 100512A were isolated from seawater samples plated on the LSW-70 medium [1% w/v tryptone (Bacto), 0.05% w/v yeast extract (Bacto), 70% v/v artificial seawater] supplemented with 1.5% or 4% agar at 24–28 ◦ C, as recommended for isolation of luminous marine bacteria [5]. The seawater samples were collected from shallow surface water, on the coast of Miyazaki Prefecture in southern Japan in 2010 and 2012. Vibrio jasicida LMG 25398T , V. jasicida MWB 21, Vibrio campbellii NBRC 15631T , Vibrio harveyi NBRC 15634T , Vibrio owensii LMG 25443T and Vibrio rotiferianus LMG 21460T were also grown on LSW-70 at 24–28 ◦ C. Strains 090810aT , 151112A and 100512A were routinely stored at −80 ◦ C in double strength deep freeze medium (2X DFM) [1% w/v yeast extract, 10% dimethyl sulfoxide (DMSO), 10% glycerol, and 20% 1 M K2 HPO4 /NaH2 PO4 (pH 7.0)] [5]. Salt tolerance was determined on basal medium [0.25% w/v polypeptone (BBL), 0.05% w/v yeast extract (Bacto), and 1.5% w/v agar] supplemented with NaCl in the final concentrations between 0% and 10% (w/v) for 48 h at 24–28 ◦ C. The thiosulfate-citrate-bile salts-sucrose (TCBS) (Merck) and marine agar (Difco) plates were prepared according to the manufacturer’s instructions. Phenotypic analysis of the three strains was conducted using API 20E and API 20NE (bioMérieux) at 26 ◦ C and read after 24 h and 48 h according to the manufacturer’s instructions, except inoculates for API 20E tests were prepared using 3 or 8 freshly grown colonies. The tests were repeated in triplicate. Gram staining was done using the Gram-color Stain set (Merck) according to the manufacturer instructions. Microscopic observations were performed using the Leica DM500 microscope. Fatty acid analysis was performed using the Sherlock Microbial Identification System version 6.0 (MIDI, DE, USA) by the TechnoSuruga company (Japan), according to the manufacturer’s manual. Luminescence was observed in the dark. Temperature tolerance was observed after growth on LSW-70 plates for 48 h, at 7 ◦ C, 16 ◦ C, 26 ◦ C, 37 ◦ C and 42 ◦ C. Genomic DNA was isolated using the DNeasy Blood and Tissue kit (Qiagen), according to the manufacturer’s manual. The 16S rRNA sequences were amplified using primers 27f (AGAGTTTGATCCTGGCTCAG) and 1492r (TACGGYTACCTTGTTACGACTT) [10], and the GoTaq Green Master Mix (Promega) according to the manufacturer’s protocol. PCR amplified DNA was sequenced on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems) using an ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems). Sequencing was done using the 27f and 1492r primers, as well as the 669f (TAGCGGTGAAATGCGTAG) and 772r (AATCCTGTTTGCTCCCCACG) primers [10]. 16S rRNA sequences were deposited to the DNA Data Bank of Japan (DDBJ), under accession numbers LC004912 (090810aT ), LC004914 (1511112A), and LC004913 (100512a). Whole genome sequencing was done previously [23], using the MiSeq platform (Illumina). Draft genome sequences can be accesses under accession numbers BBLD01000001–BBLD01000071 (090810aT ), BBLF01000001–BBLF01000214 (1511112A), and BBLE01000001–BBLE01000081 (100512a). The draft genome sequences were not annotated. Average nucleotide identity (ANI) was calculated using the JSpecies program version 1.2.1 [12], with default settings for calculation of ANIb. Tetranucleotide signature frequency correlation coefficient (TETRA) was calculated using the JSpecies program version 1.2.1 [12], with default settings. Multilocus sequence analysis (MLSA) was done by a method similar to that described by

V. alginolyticus 40B V. parahaemolyticus RIMD 2210633

V. harveyi NBRC15634T V. harveyi CAIM 1792 100

100 V. harveyi ZJ603 V. campbellii PEL22A V. campbellii DS40M4 V. campbellii NBRC 15631T

100 100

V. campbellii ATCC BAA-1116 V. campbellii HY01 V. campbellii 200612B V. rotiferianus LMG 21460T

70

100

V. rotiferianus DAT722 V. owensii LMG 25443T

100 70

V. owensii LMG 21430 V. owensii 1DA3 V. owensii ATCC 25919

2000 97

V. hyugaensis 090810aT 100

V. hyugaensis 100512A V. hyugaensis 151112A

100 100

V. jasicida LMG 25398T V. jasicida MWB 21 V. jasicida 090810c

Fig. 1. Evolutionary relationship of Vibrionaceae based on sequences of 16S rRNA. Phylogenetic tree representing 1 of 6 equally parsimonious hypotheses resulting from the analysis of alignment of nucleotide sequences of 16S rRNA. The analysis included three strains of V. hyugaensis sp. nov., as well as representative Vibrio, Photobacterium and Aliivibrio strains. Sequence alignment had 1339 characters, including 141 informative characters. Tree length was 576. Jackknife resampling values are shown at the nodes. Accession numbers for 16S rRNA sequences used in this analysis are shown in brackets.

Urbanczyk et al. [22]. Specifically, previous study identified 138 protein coding genes conserved in bacteria in the ‘Harveyi clade’ [22]. Draft genome sequences of strains 090810aT , 151112A and 100512A were searched for homologs of the 138 genes using BLAST 2.2.28+ package. Sequences of the 138 genes from V. campbellii ATCC BAA-1116 were used as queries in the searches of an in-house database containing draft genome sequences of the three strains. Three protein coding genes (aspS, VIBHAR 00421 and VIBHAR 01564) were removed from the analysis since the genes homologs could not be confidently identified in the three strains. Sequences were aligned with the sequences of 135 protein coding genes found in the whole genome sequence data of 23 representative strains from the ‘Harveyi clade’, including 8 type strains of species in the clade. Nucleotide sequences were manually aligned in Mesquite version 3.01 [11]. Phylogenetic analyses in Figs. 1 and 2 were done using program TNT version 1.1 [7], using 100 replicates of new technology searches, followed by 10,000 replicates of parsimony ratchet. Jackknife resampling values were calculated based on 10,000 replicates. Dendrograms and phylogenetic trees shown in the Supplementary Materials were obtained in PAUP* [16]. For maximum-likelihood analyses data were examined using 100 replicates of heuristic search, while dendrograms were obtained using UPGMA. Jackknife resampling values were based on 100 replicates with 34% chance of individual character deletion per replicate. Trees were visualized using FigTree version 1.4.0 (http://tree.bio. ed.ac.uk). Accession numbers for the genome sequence data used in this study can be found in the Supplementary Table 1.

Please cite this article in press as: Y. Urbanczyk, et al., Description of a novel marine bacterium, Vibrio hyugaensis sp. nov., based on genomic and phenotypic characterization, Syst. Appl. Microbiol. (2015), http://dx.doi.org/10.1016/j.syapm.2015.04.001

G Model

ARTICLE IN PRESS

SYAPM-25692; No. of Pages 5

Y. Urbanczyk et al. / Systematic and Applied Microbiology xxx (2015) xxx–xxx

A. logei NCIMB 2252T (AJ437616) A. fischeri ATCC 7744T (X74702)

100

99

85

P. phosphoreum ATCC 11040T (D25310) P. profundum DSJ4T (D21226) V. halioticoli IAM 14596T (AB000390) V. cholerae CECT 514T (X76337) V. splendidus LMG 4042T (AJ515230) V. rumoiensis S-1T (AB013297) V. owensii DY05T (GU018180) V. hyugaensis 090810aT (LC004912) V. hyugaensis 100512A (LC004913) V. hyugaensis 151112A (LC004914)

91

V. jasicida LMG 25398T (AB562589) 78 V. harveyi NCIMB 1280T (AY750575) V. rotiferianus LMG 21460T (AJ316187) 99 V. campbellii ATCC 25920T (X56575) V. alginolyticus ATCC 17749T (X56576) V. natriegens ATCC 14048T (X74714) V. parahaemolyticus ATCC 17802T (AF388386) V. diabolicus HE800T (X99762) V. mytili ATCC 51288T (X99761) V. nereis ATCC 25917T (X74716) V. gazogenes ATCC 29988T (X74705) 89 V. corallilyticus LMG 20984T (AJ440005) V. pectenicida A365T (Y13830) V. vulnificus ATCC 27562T (X76333)

20

V. scophthalmi A089T (U46579) V. orientalis ATCC 33934T (X74719) V. mediterranei CIP 103203T (X74710)

Fig. 2. Phylogenetic analysis of V. hyugaensis sp. nov. and related ‘Harveyi clade’ species. The parsimonious analysis was based on alignment of nucleotide sequences of 135 protein coding genes (a total of 137,764 characters, including 27,778 informative characters). The analysis found a single most-parsimonious tree. Tree length was equal to 73,866. Jackknife resampling values are shown at the nodes, some were omitted for clarity.

Results and discussion Several luminous bacteria were isolated from seawater samples collected in the Miyazaki prefecture in Japan between 2010 and 2012. Seawater samples were collected from shallow, coastal water. Isolated luminous strains were provisionally classified using multilocus sequence analysis (MLSA) (data not shown). Most strains could be confidently classified into described Vibrionaceae species, but three strain, 090810aT , 151112A and 100512A could not be assigned to previously described species. Later, the three strains were included in a study analyzing frequencies of recombination events in ‘Harveyi clade’ Vibrio [23]. This investigation revealed a low rate of recombination between the three strains and related ‘Harveyi clade’ Vibrio, lower than the rate of intraspecies recombination identified for bacteria in the ‘Harveyi clade’ [23]. The apparent low rate of recombination between the three strains and related Vibrio bacteria in the ‘Harveyi clade’ suggested that the three strains could potentially represent a novel Vibrio species. In the present study, further genomic, phylogenetic and phenotypic analyses were carried out on strains 090810aT , 151112A and 100512A and related ‘Harveyi clade’ Vibrio in order to evaluate taxonomic position of the three strains. The 16S rRNA gene sequences were amplified in strains 090810aT , 151112A and 100512A, and the sequences were used for a parsimony search to establish the strains relationship to other Vibrionaceae species. The resulting phylogenetic hypothesis established the three strains as members of the genus Vibrio, and found the three strains closely related to V. jasicida and other ‘Harveyi clade’ species (Fig. 1). Comparable results were obtained when aligned 16S rRNA gene sequences were used for analyses using neighbor-joining and maximum likelihood algorithms

3

(Supplementary Figs. 1 and 2). However, the analyses of 16S rRNA gene sequences could not confidently distinguish between the three strains and other Vibrio species. In order to investigate relatedness of strains 090810aT , 151112A and 100512A to other Vibrio bacteria, draft genome sequences of the three strains were analyzed. The draft genome sequences of the three strains differ sufficiently from each other to conclude that they are not clonal varieties. Average G + C mole% values for the three strains is 43.91%. The total length of each genome was established to be 5.49 Mbp, 5.95 Mbp and 5.55 Mbp. Genome sizes of the three strains are similar to in other ‘Harveyi clade’ Vibrio, which earlier study reported to be between 4.56 Mbp and 6.37 Mbp [15]. The observed variance in genome sizes of ‘Harveyi clade’ Vibrio did not permit using comparison of genome sizes to differentiate species in the clade. Draft genome sequences of the three strains were used to determine the average nucleotide identity (ANI) between strains 090810aT , 151112A and 100512A, and 26 representative Vibrionaceae strains (Supplementary Table 1). These included representative strains from the genera Aliivibrio [14] and Photobacterium [24], a representative strain of V. cholerae (the type strain of the genus Vibrio) [8], and 23 strains from the ‘Harveyi-clade’. Strains 090810aT , 151112A and 100512A formed a group separate from any previously described ‘Harveyi clade’ Vibrio, with ANI values of 97.4% or higher, indicating their high genetic relatedness. The three strains had ANI of 93.6% or lower to other Vibrionaceae bacteria. Previous studies found that ANI of 95–96% correspond to DNA-DNA hybridization values of 70% [12], the proposed cutoff for delineation of bacterial species, which indicates that the three strains could be taxonomically classified as members of a new species in the genus Vibrio. Genetic relatedness of strains 090810aT , 151112A and 100512A to each other and to other Vibrionaceae was visualized via a dendrogram constructed using results of ANI calculations (Supplementary Fig. 3). The dendrogram shows a tight cluster formed by the strains 090810aT , 151112A and 100512A, distinct from clusters formed by other Vibrionaceae bacteria. In addition to ANI, whole genome sequence data was also used to calculate tetranucleotide signature frequency correlation coefficient (TETRA) [12] between strains 090810aT , 151112A and 100512A, and 26 representative Vibrionaceae strains (Supplementary Table 2). The analysis found high correlation coefficients >0.99 between the type strains of V. campbellii, V. jasicida, V. owensii and V. rotiferianus. Similarly, the analysis found coefficient >0.99 between strains 090810aT , 151112A and 100512A and ‘Harveyi clade’ strains classified as members of V. jasicida, V. campbellii, V. owensii and V. rotiferianus. In addition, two strains classified as members of the same species based on results of ANI calculations, V. campbellii strains ATCC BAA-1116 and PEL22A, were found to have correlation coefficient lower than 0.99. Considering high values of TETRA calculated between the type strains of different ‘Harveyi clade’ species, it can be concluded that tetranucleotide signature frequency correlation coefficient calculations are of limited use for taxonomic classification of ‘Harveyi clade’ bacteria. Evolutionary relationship of the three strains to previously described species in the ‘Harveyi clade’ was established using a phylogenetic analysis of nucleotide sequences of 135 protein coding genes conserved in bacteria in the ‘Harveyi clade.’ Results of the phylogenetic analysis (Fig. 2) found strains 090810aT , 151112A and 100512A evolutionary closely related to bacteria in the ‘Harveyi clade’, however the three strains formed a clade separate from previously described Vibrio species. Use of the concatenated alignment of 135 protein coding genes for a neighbor-joining and maximum likelihood analyses found the same relationship between the three strains and other ‘Harveyi clade’ species (Supplementary Figs. 4 and 5). These results support the classification of 090810aT , 151112A and 100512A as a novel Vibrio species.

Please cite this article in press as: Y. Urbanczyk, et al., Description of a novel marine bacterium, Vibrio hyugaensis sp. nov., based on genomic and phenotypic characterization, Syst. Appl. Microbiol. (2015), http://dx.doi.org/10.1016/j.syapm.2015.04.001

G Model

ARTICLE IN PRESS

SYAPM-25692; No. of Pages 5

Y. Urbanczyk et al. / Systematic and Applied Microbiology xxx (2015) xxx–xxx

4

Table 1 Differential phenotypic characters between V. hyugaensis sp. nov. and related Vibrio species. V. hyugaensis

V. hyugaensis

V. hyugaensis

V. jasicida

V. jasicida

V. campbellii

V. harveyi

V. owensii

V. rotiferianus

ß-galactosidase activity Lysine decarboxylase Ornithine decarboxylase Citrate utilization Urease Indole production Gelatinase

090810aT + + + − − − +

100512A + + + − − + +

151112A + + − − − + +

LMG 25398T + + + − − + −

MWB 21 + + − − − +/− +/−

NBRC 15631T − +/− − − − +/− −

NBRC 15634T − + + + − +/− +

LMG 25443T − + + − − +/− +

LMG 21460T + + + − + +/− +

Fermentation of d-Glucose Inositol d-Sorbitol l-Rhamnose d-Sucrose d-Melibose l-Arabinose NO2 production Reduction of nitrates to nitrites Hydrolisis of esculin

+ + +/− +/− − − − + + −

+ +/− +/− +/− − − − +/− + −

+ +/− +/− +/− +/− +/− − + + −

+/− − − − − − − + + +

+/− +/− +/− +/− +/− +/− − + + +/−

− +/− +/− − − − − − − +

+ +/− − − + − − + + +

+ +/− +/− +/− + − − +/− + +

+ +/− − − + +/− + +/− + +

Assimilation of d-Glucose d-Mannose d-Mannitol N-acetyl-glucosamine d-Maltose Potassium gluconate Adipic acid Malic acid Trisodium citrate Growth at 16 ◦ C Growth at 37 ◦ C Growth at 5% NaCl

− − − − − +/− − + − + − +

− +/− +/− − +/− +/− − + − + − +

− − − − − − − +/− − + − +

− +/− +/− − − − − − − + − +

− − − − − +/− − − − − − +

+/− − − − − − − +/− − − + −

+/− +/− + +/− + + − + +/− − + +/−

+/− +/− + +/− +/− +/− +/− + +/− + + +

− − − − − − − + − + + +

+ positive; −, negative; +/−, variable. All strains negative for arginine dihydrolase, H2 S production, tryptophan deaminase, Voges–Proskauer, assymilation of l-arabinose, assymilation of capric acid, assymilation of phenylacetic acid, growth at 7 ◦ C and 42 ◦ C, growth at 0% NaCl, 8% NaCl and 10% NaCl. All strains positive for fermentation of d-mannitol, fermentation of amygdalin, growth at 26 ◦ C, and growth at 2% NaCl.

Phenotypic characterization revealed cells of strains 090810aT , 151112A and 100512A as slightly curved, motile Gram-negative rods. The three strains were successfully grown on LSW-70, marine agar, basal medium supplemented with 2% or 5% NaCl (w/v), and TCBS plates. Bright luminescence was observed in the three strains on all tested media. Analysis of phenotypic character of strains 090810aT , 151112A and 100512A revealed them to be similar to ‘Harveyi clade’ Vibrio (Table 1), but the three strains can be

differentiated from related Vibrio species by their inability to hydrolyze esculin. It should be mentioned that in our study V. jasicida MWB 21 tested negative for esculin hydrolysis in one of the three repeats of the test. In other two repeats of the test strain MWB 21 hydrolyzed esculin, also Yoshizawa et al. [25] reported that six V. jasicida strains tested positive for esculin hydrolysis. The complete list of phenotypic characteristics of the three strains and related Vibrio species can be found in Table 1. The major fatty acids

Table 2 Chemotaxonomic character of V. hyugaensis sp. nov. and related Vibrio species.

C12:0 C12:03-OH iso-C13:0 C14:0 anteiso-C15:0 C15:0 iso-C16:0 C16:1␻9c C16:0 anteiso-C17:0 C17:1␻8c C17:0 C18:1␻7c C18:1␻7c and/or C18:1␻6c C18:0 C16:1 ␻7c and/or C15:0 iso 2-OH C16:1 ␻7c and/or C16:1 ␻6c

V. hyugaensis

V. hyugaensis

V. hyugaensis

V. jasicidaa

V. campbelliia

V. harveyia

V. owensiib

V. rotiferianusb

090810aT 3.3 1.4 – 6.0 – – – – 13.3 – – – 14.1 21.7 – NA 43.6

100512A 3.4 1.4 – 6.6 – – – – 15.5 – – – 17.1 21.0 – NA 43.2

151112A 2.9 1.3 – 5.7 – – – – 16.1 – 1.2 – 16.8 16.8 – NA 45.3

LMG 25398T 4.0 1.7 1.0 3.5 – – – – 14.2 – – – 18.2 NA – 49.1 NA

ATCC 25920T 4.0 1.3 – 5.6 1.1 – 1.1 – 17.7 1.6 – – 17.3 NA 1.2 41.7 NA

IFO 15634T 4.8 2.2 – 5.3 – – – – 20.0 – – – 22.3 NA 1.5 33.3 NA

DY05T 2.3 1.0 1.0 6.3 – – 3.5 – 16.7 NA 1.7 1.8 14.6 NA 1.0 37.5 NA

LMG 21460T – 2.9 – 9.5 NA – – – 25.4 NA – – 10.8 NA 1.1 37.1 NA

Data are expressed as percentages of total fatty acids. Percentages