Accepted Manuscript Design, synthesis, biological evaluation of substituted benzofurans as DNA gyrase B inhibitors of Mycobacterium tuberculosis Janupally Renuka, Kummetha Indrasena Reddy, Konduri Srihari, Variam Ullas Jeankumar, Morla Shravan, Jonnalagadda Padma Sridevi, Perumal Yogeeswari, Kondra Sudhakar Babu, Dharmarajan Sriram PII: DOI: Reference:

S0968-0896(14)00487-8 http://dx.doi.org/10.1016/j.bmc.2014.06.041 BMC 11678

To appear in:

Bioorganic & Medicinal Chemistry

Received Date: Revised Date: Accepted Date:

8 May 2014 17 June 2014 19 June 2014

Please cite this article as: Renuka, J., Reddy, K.I., Srihari, K., Jeankumar, V.U., Shravan, M., Sridevi, J.P., Yogeeswari, P., Babu, K.S., Sriram, D., Design, synthesis, biological evaluation of substituted benzofurans as DNA gyrase B inhibitors of Mycobacterium tuberculosis, Bioorganic & Medicinal Chemistry (2014), doi: http:// dx.doi.org/10.1016/j.bmc.2014.06.041

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Design, synthesis, biological evaluation of substituted benzofurans as DNA gyrase B inhibitors of Mycobacterium tuberculosis Janupally Renuka a, Kummetha Indrasena Reddyb, c, Konduri Sriharib Variam Ullas Jeankumara, Morla Shravana, Jonnalagadda Padma Sridevia, Perumal Yogeeswaria, Kondra Sudhakar Babuc*, Dharmarajan Srirama* a

Department of Pharmacy, Birla Institute of Technology & Science-Pilani, Hyderabad campus,

Jawaharnagar, Shameerpet, Hyderabad-500078, India b

Vector Biosciences Pvt. Ltd, Gandhi Nagar, Hyderabad -500 037, India

c

Department of Chemistry, Sri Krishnadevaraya University, Anantapur -515055, India

Corresponding Author* D. Sriram Chair Professor, Department of Pharmacy, Birla Institute of Technology & Science-Pilani, Hyderabad Campus, Jawaharnagar, RangaReddy Dist, Hyderabad- 500 078. INDIA Telephone: +91-40663030506 Fax: +91-4066303998 Email: [email protected]; [email protected]

1

Abstract: DNA gyrase of Mycobacterium tuberculosis (MTB) is a type II topoisomerase and is a wellestablished and validated target for the development of novel therapeutics. By adapting the medium throughput screening approach, we present the discovery and optimization of ethyl 5-(piperazin-1yl) benzofuran-2-carboxylate series of mycobacterial DNA gyraseB inhibitors, selected from Birla Institute of Technology and Science (BITS) database chemical library of about 3000 molecules. These compounds were tested for their biological activity; the compound 22 emerged as the most active potent lead with an IC50 of 3.2±0.15

µM

against Mycobacterium smegmatis DNA gyraseB

enzyme and 0.81±0.24µM in MTB supercoiling activity. Subsequently, the binding of the most active compound to the DNA gyraseB enzyme and its thermal stability was further characterized using differential scanning fluorimetry method. Keywords: Tuberculosis, DNA gyrase B, antibacterial activity, cytotoxicity.

2

1. Introduction: Tuberculosis (TB) is caused by an aetiological agent Mycobacterium tuberculosis, the infections caused by this mycobacteria are the single largest cause of death globally. According

to

world

health organization (WHO), 8.6 million people fell ill with TB and 1.3 million died from TB in 2012.1 Existing drug resistant wild strains of TB, increasing

incidence of multidrug-resistant

(MDR-TB) and extensively drug-resistant tuberculosis (XDR-TB) pose dangerous global threat and an urgent need to develop new anti-mycobacterials.2 In the process of development of novel broad spectrum anti-bacterial agents, scientists should consider selectivity, toxicity, and satisfactory ADME properties as important parameters.3 In the recent years, DNA gyrase is considered as one of the well validated, pharmaceutically effective target for drug discovery as it causes bactericidal effect.4 It is a tetrameric enzyme involved in maintaining and regulating the DNA topology in a cell. Gyrase is a unique bacterial type II topoisomerase enzyme belonging to GHKL (gyrase, HSP 90, histidine kinase, MutL enzyme family.5-8 Mtb DNA gyrase is unique enzyme as this is the only type II topoisomerase present in the bacteria unlike other bacteria which possess a similar enzyme, type IV topoisomerase along with topoisomerase II.9 This feature incorporates enhanced relaxation, DNA cleavage and decatenation activities to the enzyme.10 The enzyme being a tetramer has A2B2 subunits, while the GyrA subunit is primarily involved in the breakage and reunion of the bacterial DNA, the GyrB subunit possesses the catalytic ATPase activity which is subsequently obtained with ATP hydrolysis.3 Till date, Quinolones are the only class of the DNA gyrase inhibitors in clinical practice.9,11 DNA gyrase enzyme inhibition results in highly mycobactericidal activity, subsequently

inhibitors

of this enzyme are also active against non-replicating and persistent mycobacteria that are responsible for shortening the duration of TB therapy.9 While their mode of action is by inhibiting the GyrA subunit, interfering with the DNA cleavage and ligation by forming ternary complex,10 the 3

GyrB subunit comparatively remains pharmaceutically under-exploited though it was reported as effective target of coumarins, cyclothialidines, indazoles, pyrazoles, pyrrolamides, benzimidazoles, bithiazoles, phenols, aminopyrazinamides and indolinones.12 In the present study, using a previously reported MTB gyrB inhibitor as a template from BITS library database, a series of ethyl 5- (piperazin-1-yl) benzofuran-2-carboxylate derivatives were developed as highly selective inhibitors of the mycobacterial DNA Gyrase ATPase domain exhibiting promising antitubercular potency. The thermal stability of the protein with the most active ligand was also ascertained biophysically through differential scanning fluorimetry experiment. 2. Results and discussion 2.1. Design and chemistry In our efforts to increase the molecular diversity in the series of antimicrobial gyrB inhibitors;

we

have previously designed and developed a novel class of thiazole-amiopiperdine analogues as mycobactertial gyrase B inhibitors utilizing the concept of molecular hybridization.13 The molecules though displayed only moderate gyrB inhibitory potential but exhibited good specificity towards the myocbacterial gyrB domain. The preliminary structure–activity profiling studies of these leads provided valuable information regarding the basic structural requirements for

achieving

selective

inhibition of mycobacterium GyrB. Further in silico investigation into binding profile of these molecules in the gyrase ATPase domain revealed the importance of the hydrophobic interactions in increasing the specificity of the molecule towards the mycobacterial protein. Concordantly, the crystal structure of MS GyrB in complex with one of the

aminopyrazinamides

class

reported

by

AstraZeneca researchers revealed that the presence of a hydrophobic pocket, unique to the mycobacterial gyrB protein and reinstated the importance of hydrophobic interaction in improving the gyrB inhibitory potential. 4

Having understood the important structural requisite for bringing about the specificity and potency towards the mycobacterial gyrB domain, it was decided to re-engineer the previously reported thiazole-amiopiperdine analogues to tailor novel inhibitor for the mycobacterial GyrB domain. Overall, we have attempted a rationalized effort to enhance the hydrophobicity of the lead molecule to facilitate the affinity towards the gyrB domain. As a result a more hydrophobic benzofurane nucleus came in as a possible replacement for the thiazole core present in the previously reported hit (compound 1) on the left hand side. The aminopiperdine linker was replaced by a piperazine linker as a recent literature from GSK cites that the hERG toxicity and QTc prolongation observed aroused from the aminopiperdine core which was the central linking unit in these classes of molecules.14,15 The strategy followed for designing the inhibitor has been depicted in Figure 1. Various amide derivatives were introduced as the right hand core to increase stability and to evaluate steric and electronic effects on the antimycobacterial potency. The designed ligand (compound 2) in the subsequent in vitro biological evaluation exhibited a MS GyrB inhibitory IC50 of 6.14±0.21 µM, gyrase supercoiling inhibitory IC50 of 3.125±0.11 µM and a MTB MIC of 11.57 µM. MIC value of potent lead 2 is comparatively better than the standard drug novobiocin and less active than first-line anti-tubercular drug ethambutol. Encouraged by these promising results, we further designed and synthesized a library of twenty six compounds (Table 1) by consequent hit expansion step with the goal of obtaining a lead series with tractable SAR and potencies than the initial leads. It was decided to retain the left and linking core in the further structure activity exploration and the structural diversity was brought in by modifying the right hand substituent’s as shown in Table 1.

5

Figure 1. Chemical structure of the linker used as a template for designing of inhibitors of DNA gyraseB bearing a 4-amino piperidine nucleus, through lead optimization and chemical synthesis resulting in piperazine nucleus MTB, Mycobacterium tuberculosis; LHS, left-hand substituent; RHS, right-hand substituent.

6

Scheme 1. Synthetic pathway used to achieve the target compounds We adopted a simple and straightforward strategy to develop the designed molecules. The construction of the target molecule began by nitrating commercially available salicylaldehyde (3). The so obtained 2-hydroxy-5-nitrobenzaldehyde (4) on subsequent treatment with ethylbromoacetate in presence of sodium carbonate in N-methyl pyrrolidine gave ethyl 5-nitrobenzofuran-2-carboxylate in good yield and purity. Subsequent reduction of the nitro group at the 5th position of the benzofurane core gave the corresponding ethyl 5-aminobenzofuran-2- carboxylate (6) in excellent yield. This (6) on further alkylation with bis-(2-chloroethyl)amine using sodium carbonate as base gave the scaffold ethyl 5(piperazin-1-yl)benzofuran-2-carboxylate (7). The final library (8 - 33) was then assembled by coupling the so obtained ethyl 5-(piperazin-1-yl) benzofuran-2-carboxylate with various commercially available carboxylic acids using propylphosponic anhydride as the coupling agent.

2.2. DNA gyraseB enzyme inhibition and docking studies The ATPase assay was performed as per the procedure illustrated in Section 4.2.2. The kinetics of the M. smegmatis DNA gyraseB enzyme follows greater than first-order kinetics. 16 However at a 7

constant enzyme concentration of 15μM there was a hyperbolic dependence of rate on substrate (ATP) concentration because the GyrB ATPase activity of M. smegmatis does not follow Michaelis– Menten kinetics. Thus the apparent KMapp and Vmaxapp determined experimentally were 300μM and 2.1μmol/s as illustrated in Figure 2. The assay was performed on Mycobacterium smegmatis DNA gyraseB protein contrary to MTB gyraseB protein because of its slow growing nature when compared to M. smegmatis.16 Ideally, the sequence similarity between the gyraseB protein domains is 87% between the two organisms considered, while much of the catalytic site remains the same proving a higher degree of conservation in the ATP binding pocket. Secondly, novobiocin was considered as a standard inhibitor in these assays furthermore, a correlation of 3–5 fold variation in IC50 between the ATPase activity of M. smegmatis and the supercoiling activity of MTB was seen; this had given us enough confidence to use M. smegmatis as a surrogate enzyme for DNA gyraseB ATPase activity.17 All the molecules inhibited gyrB ATPase activity, with IC50 values ranging between 9.18 to 52.1 µM. Dose response curve was plotted for the most potent lead 22 which showed an IC50 of 0.81µM in M. smegmatis gyrB using GraphPad Prism software (GraphPad Software Inc., La Jolla, CA) by taking log (inhibitor concentration) on the X-axis and response (% inhibition) on the Y-axis as shown in Figure 6, while the standard novobiocin showed an IC50 of 180 ± 3.9 nM. Furthermore, the molecule selectively inhibited mycobacterial gyrB and was not active against Staphylococcus aureus gyrB and Escherichia coli DNA gyrB proteins even at 50 µM concentration. Subsequently, the active molecules were docked into the crystal structure of DNA gyrB protein co crystallized with 6-(3,4-dimethylphenyl)-3-[[4-[3-(4-methylpiperazin- 1- yl) propoxy]phenyl]amino]pyrazine-2-carboxamide (PDB Id: 4B6C) using Schrödinger Suite 2012 to establish the structure activity relationship.17 The molecular modelling studies were done according to the section 4.2.7. The structure of the crystal ligand and the potent ligand 22 are shown in Figure 3. Closer analysis of the crystal structure bound with ligand showed key hydrogen bonding Asp 79. 8

While the hydrophobic pocket included Val49, Ala53, Ile84, Val128, Ile171, Leu135, Val128, Val123 and Val99 residues in close proximity to the hydrogen bonded Asp79 and few of the other polar amino acid residues were in the vicinity of the pocket consisting of Glu48, Ser126, Glu56, Gln102. Arg82 showed π bonding with the p-hydroxy aniline moiety substituted on either side with pyrimidine derivative of the piperizine. The reference ligand 6-(3, 4 dimethylphenyl)-3-[[4-[3-(4methylpiperazin-1-yl) propoxy] phenyl] amino] pyrazine-2-carboxamide was re-docked into the active site of DNA gyraseB to validate as illustrated in Figure 4. The reference ligand exhibited highest glide score of -8.43 kcal/mol and was found in the vicinity of the important amino acids. Further, re-docking results with ligand preparation showed that this ligand exhibited similar interactions as that of the original crystal structure with an RMSD of 0.28 0A. Our most active ligand tert-butyl 4-[4-(2-ethoxycarbonyl) benzofuran-5-yl)-piperazine-1-carbonyl]-piperidine-1carboxylate (22) on docking gave a glide score of -8.66 kcal/mol. Though the ligand had no hydrogen bonding with Asp79, it showed a H-bond with Arg141 with a well fitted pose in the active site in the hydrophobic pocket within the vicinity of Ile84, Val128, Ile171, Val49, Ala53, Leu135, Val128, Val123 and Val99 and few polar amino acid residues Glu 48, Ser 126, Glu 56, Gln 102 respectively. The binding pattern within the active site pocket of the crystal ligand and reference ligand was quite similar and additionally the vander waal’s and columbic forces between Thr170, Asn52, Ala53, Ile84 and Glu48 and the ligand constituted for a stable binding profile of the molecule as shown in the Figure 5.

9

Figure 2. ATPase activity of Mycobacterium smegmatis DNA gyraseB protein as a function of substrate (ATP) concentration at a constant enzyme concentration (15 µM).

O N N

O

O NH2

NH

O N O

N

N

O O

N

N O

Crystal ligand (4B6C)

Most active compound 22

Figure 3. Structures showing crystal ligand (4B6C) and the most active compound 22

10

Figure 4. Surface overview and interaction profile of crysligand 6-(3, 4-dimethylphenyl)-3 [[4-[3(4-methylpiperazin- 1-yl) propoxy] phenyl] amino]pyrazine-2-carboxamide with the GyrB ATPase domain of Mycobacterium smegmatis with the active site residues. Blue indicates the polar interaction, while the red dots indicate the H-bond with Asp79 residue; yellow is the hydrophobic part of the pocket and grey indicates the polar residues in the vicinity of the pocket.

11

Figure 5. Surface overview and interaction profile of the most active compound 22 Tert-butyl 4-[4-(2ethoxycarbonyl) benzofuran-5-yl) piperazine-1-carbonyl] piperidine-1-carboxylate with the GyrB ATPase domain of Mycobacterium smegmatis with the active site residues. Blue indicates the polar interaction, while the red dots show the H-bond with Arg141, yellow is the hydrophobic part of the pocket and grey indicates the polar residues in the vicinity of the pocket.

12

Figure 6. Dose response curve of most active lead compound 22

2.3. Supercoiling assay Compounds inhibiting the ATPase assay of gyraseB protein should also inhibit the supercoiling assay as the gyraseA and gyraseB constitute the holoenzyme gyrase. The assay

was

performed

using the DNA supercoiling kit as per the protocol described in section 4.4. Further, to eliminate the possibilities of aggregation and non-specific inhibition surfactants were added in our biological experiments.12 The reactions were performed on MTB DNA gyrase enzyme dose dependently of about 8 concentrations starting from 100, 50, 25, 12.5, 6.25, 3.125, 1.56 and 0.75µM. The most active compound showed an IC50 of 0.81 µM as illustrated in Figure.7. Novobiocin was considered as a standard compound in this assay. Subsequently, IC50 was calculated based on relative quantification using Image lab software.

13

Figure 7. Depicting the supercoiling assay picture of compound 22 at four different concentrations of 3.2 µM, 1.6 µM, 0.81 µM and 0.4 µM where R-Relaxed DNA substrate +DMSO; C- Relaxed DNA substrate +DNA Gyrase+ DMSO; N-Novobiocin.

2.4. In vitro MTB screening The synthesized ethyl 5-(piperazin-1-yl) benzofuran-2-carboxylate derivatives were screened their in vitro anti-tubercular activity against Mycobacterium tuberculosis H37Rv strain

for

(ATCC

27294) by agar dilution method.18 The minimum inhibitory concentration was determined for each compound with a range from 50µg/mL to 0.78µg/mL in triplicates. Ethambutol, ofloxacin and novobiocin were considered as standard compounds. Overall, a good correlation was observed between the MTB DNA gyrase supercoiling assay IC50 values and the in vitro MTB minimum inhibitory concentration (MIC), however a slight deviation in the M. smegmatis GyrB IC50 was observed, probably owing to the minute difference in the protein because of change in the organism, as MIC was evaluated on MTB (M. tuberculosis H37Rv) and the GyrB assay was performed on M. smegmatis protein respectively.17 All the synthesized compounds showed activity against MTB with MIC ranging from 9 to 54 µM as illustrated in Table 1. Observation of the MIC confirmed that these compounds were slightly better in activity than the first-line anti-tubercular drug ethambutol (MIC = 9.84 µM) but were less active when compared with isoniazid (MIC=0.66), moxifloxacin (MIC= 8.6 µM). The standard compound novobiocin was not active at 200 µM. Fifteen compounds showed decent MIC 50

8.1±0.36

IC50, 50% inhibitory concentration; MTB, Mycobacterium tuberculosis; MS, Mycobacterium smegmatis; MIC, minimum inhibitory concentration; ND, Not determined

2.6. Biophysical characterization For performing the DSF experiments pure gyraseB protein is required. The DNA gyraseB protein production, purification and DSF experiments were performed as described in the protocols in 5.4 to 5.6 respectively. The purified protein of concentration 2mg/mL was subjected to sequentially 16

(0.60C/min) increasing temperature starting from 25 0C. The protein and the protein-ligand complexes were heated from 25 0C to 95 0C in steps of 0.1 0C in the presence of 50 X Sypro orange dye. The fluorescence increases with increase in the exposure and binding of the dye to the hydrophobic residues of the protein.20 Thus the stability of the protein–ligand complex is proportional to temperature shift between the melting temperature of the native protein and the protein-ligand complex. A bigger temperature shift towards right is a positive shift with higher stability than the shift towards left. The best result was obtained by taking the gyraseB protein in complex with compound 22 as the shift in Tm was 2.7 0C. The native protein Tm was 47.1 0C (green) whereas the protein-ligand (red) showed Tm of 49.8 0C as depicted in the Figure.8.

Figure 8. DSF experiment for compound 22 showing an increase in thermal stability with increase in Tm shift of 2.7 0C between the native Mycobacterium smegmatis protein (green) and Mycobacterium smegmatis protein−ligand complex (red).

3. Conclusion: Utilizing a previously reported moderately active gyrB inhibitor as a structural framework, we have successfully developed and experimentally characterized novel class of mycobacterial DNA gyraseB 17

inhibitors. Subsequently, screening a focused library of compounds for GyraseB protein inhibiting profile of Mtb DNA gyrase through supercoiling, gyraseB biological assays and consequently evaluating the potent leads computationally, through available Mycobacterium smegmatis crystal structure has given us additionally, excellent data regarding the binding profile of these promising potent leads. Furthermore, exploring the binding affinity and thermal stability of the most active compound 22 to the gyraseB protein by DSF experiments, good SAR analysis coupled with molecular docking, biological assays, slightly better antimycobacterial activity, when compared to standard ethambutol, safety profile with regards to cell cytotoxicity when compared with reference drugs have highlighted few possibilities for further optimisation of the hit series to increase the inhibitory activity of selected compounds. 4. Experiments: 4.1. Chemistry Melting points (mp) reported in this work were recorded in capillary tubes on a Elchem lab melting point apparatus and uncorrected. 1H NMR and 13C NMR were recorded either in Bruker 500 MHz and 400MHz FT-NMR spectrometer with 5 mm PABBO BB-1H tubes. 1H NMR spectra recorded using approximately 0.03 M solutions in CDCl3 with TMS as internal reference.

13

C NMR spectra were

recorded using approximately 0.05 M solutions in CDCl3 at 100 MHz or 125 MHz with TMS as internal reference. The chemical shift values were reported in parts per million (δ, ppm) from internal standard TMS. Mass spectra were obtained from JEOL GC Mate HRMS analyzer. The UV–visible spectra were recorded on a SYSTRONIC AU-2701 UV–Vis spectrophotometer. All reagents were purchased from Aldrich and used as received. Solvents were removed under reduced pressure on a rotovapour. Organic extracts were dried with anhydrous Na2SO4. Silica gel 60F254 aluminum sheets were used in analytical thin- layer chromatography (TLC) and silica gel for column chromatography purification (230-400 mesh). Visualization of spots on TLC plates was effected by UV illumination, 18

exposure to iodine vapor and heating the plates dipped in KMnO4 stain. General procedure for the synthesis of the 5-nitro salicylaldehyde (4): The compound salicylaldehyde (1mmol) was allowed to react with nitric acid (5 vol) in presence of Acetic acid (10 vol) as a solvent and maintain for 6hr at RT to produce substituted 5-nitro salicylaldehyde. White solid, 96% yield, m.p. 155.5-157.4 0C, 1H NMR (300 MHz, CDCl3): δ = 10.02 (s, 1H), 7.62 (s, 1H), 7.29 (m, 2H):

13

C NMR (75 MHz, DMSO+CDCl3): 189.6, 167.5, 146.7, 127.0,

126.5, 118.5, MS calcd. For C7H5NO4: 167.12 Found: 168.2 (M+). Anal. Calcd. for C7H5NO4: C, 50.31; H, 3.02; N, 8.38; Found: C, 50.33; H, 3.01; N, 8.34. General procedure for the synthesis of ethyl 5-nitrobenzofuran-2-carboxylate (5): To the solution of 5-nitro salicylaldehyde (1 mmol) in NMP (8 vol), Na2CO3 (2.5 mmol) was added stirred for 1/2 hr, followed by addition of ethyl bromo acetate (1.5 mmol) and stirred for overnight at 1000C. RM was dissolved in water and then extracted with ethyl acetate (2 x 100ml), the combined organic layer was washed with brine solution, dried over Na2SO4 and then evaporated to dryness. Compound purified by column chromatography. Off White solid, 89% yield, m.p. 176.4-178.4 0C, 1H NMR (300 MHz, CDCl3): δ = 8.12 (s, 1H), 7.87 (s, sH), 7.32 (m, 2H), 4.35 (q, J = 7.5, 14.4 Hz, 2H), 1.33 (m, 3H) 6H);

13

C NMR (75 MHz, DMSO+CDCl3): 158.6, 157.9, 144.2, 130.6, 119.8, 114.2,

111.5, 110.2, 106.2, 58.8, 13.2. MS calcd. for C11H9NO5: 235.1. Found: 236.0, (M+). Anal. Calcd. for C11H9NO5: C, 56.17; H, 3.86; N, 5.96; Found: C, 56.15; H, 3.87; N, 5.94. General procedure for the synthesis of ethyl 5-aminobenzofuran-2-carboxylate (6): To the solution of ethyl 5-nitrobenzofuran-2-carboxylate (3) (1 mmol) in Ethanol solvent and degas with N2. Raney-Ni (3.0 mmol) was added to the reaction mass. Then put H2 pressure. The RM was stirred for 6hr at RT. RM was filter through the high-flow; the combined organic layer was evaporated to dryness. Yellow solid, 91% yield, m.p. 189.6-191.4 0C, 1H NMR (300 MHz, CDCl3): δ = 7.62 (s, 1H), 7.47 (d, J = 7.2 Hz, 1H), 6.74 (m, 2H), 4.35 (q, J = 7.5, 14.4 Hz, 2H), 1.33 (m, 3H) 6H); 13C NMR 19

(75 MHz, DMSO+CDCl3): 157.3, 154.9, 142.5, 129.7, 120.8, 112.2, 110.4, 109.2, 107.2, 58.8, 13.2. MS calcd. for C11H11NO3: 205.2. Found: 206.6, (M+). Anal. Calcd. for C11H11NO3: C, 64.38; H, 5.40; N, 6.83; Found: C, 64.39; H, 5.42; N, 6.81. General procedure for the synthesis of ethyl 5-(piperazin-1-yl) benzofuran-2-carboxylate (7): To the solution of ethyl 5-aminobenzofuran-2-carboxylate (4) (1 mmol), bis-(2-chloro ethyl) amine (1.5 mmol), and sodium carbonate (2.0 mmol), in 1-propanol solvent. Reaction mass is heat to reflux for 24 hrs and filtered. Add mixture of water and MDC. Extract the compound with MDC twice.The combined organic layer was dried over Na2SO4 and then evaporated to dryness. Compound purified by column chromatography. 35% yield. Get the ethyl-5-(1-piperazinyl) benzofuran-2-carboxylate. White solid, 89% yield, m.p. 269.4-271.4 0C, 1H NMR (300 MHz, CDCl3): δ = 7.68 (s, 1H), 7.36 (m, 1H), 6.84 (m, 2H), 4.35 (q, J = 7.5, 14.4 Hz, 2H), 3.89 (t, J = 4.4 Hz, 4H), 3.15 (t, J = 4.8 Hz, 4H), 1.33 (m, 3H) 6H); 13C NMR (75 MHz, DMSO+CDCl3): 157.3, 154.9, 142.5, 129.7, 120.8, 112.2, 110.4, 109.2, 107.2, 58.8, 59.2, 49.8, 48.2, 43.4, 13.2. MS calcd. for C19H23N3O4: 357.4. Found: 358.6, (M+). Anal. Calcd. for C19H23N3O4: C, 63.85; H, 6.49; N,11.76; Found: C, 63.82; H, 6.48; N, 11.78. General procedure for compounds (8-33) preparation: To a solution of ethyl 5-(piperazin-1-yl) benzofuran-2-carboxylate (1 mmol) in dry dichloromethane (3 mL) was added triethylamine (2 mmol) and corresponding acid (1 mmol) at 0oC. Propylphosphonic anhydride solution (≥50 wt. % in ethyl acetate; 2.5 mmol) was then added drop wise to the reaction mixture and was stirred at rt for 6 hours (monitored by TLC & LCMS for completion). The reaction mixture was then washed with water (2 mL), brine (2 mL), and dried over anhydrous sodium sulphate and evaporated in vacuo. The residue obtained was then recyrstallised from diethylether.

4.1.1. Ethyl 5-(4-(2-phenylacetyl)piperazin-1-yl)benzofuran-2-carboxylate (8): White solid, 96% yield, m.p. 285.5-286.4 0C, 1H NMR (300 MHz, DMSO): δ = 7.61 (m, 2H), 7.29 (m, 4H), 7.08 (m, 2H), 4.35 (q, J = 7.5, 14.4 Hz, 2H), 3.80 (s, 2H), 3.76 (t, J = 4.8 Hz, 4H), 3.10 (t, J = 4.4 20

Hz, 4H), 1.33 (t, J = 6.9 Hz, 3H);

13

C NMR (75 MHz, DMSO+CDCl3): 167.1, 156.7, 149.7, 144.2,

133.5, 127.0, 126.5, 125.4, 124.6, 118.5, 112.0, 110.8, 109.1, 59.2, 49.9, 49.6, 42.9, 12.3. MS calcd. For C23H24N2O4: 392.43. Found: 393.2, (M+). Anal. Calcd. for C23H24N2O4: C, 70.39; H, 6.16; N,7.14; Found: C, 70.37; H, 6.15; N, 7.16. 4.1.2. Ethyl 5-(4-(2-(4-chlorophenyl)acetyl)piperazin-1-yl)benzofuran-2-carboxylate (9): White solid, 92% yield, m.p. 265.3-267.6 0C, 1H NMR (300 MHz, DMSO): δ = 7.63 (m, 2H), 7.30 (m, 6H), 4.35 (q, J = 7.5, 14.4 Hz, 2H), 3.80 (s, 2H), 3.76 (t, J = 4.8 Hz, 4H), 3.10 (t, J = 4.4 Hz, 4H), 1.33 (t, J = 6.9 Hz, 3H);

13

C NMR (75 MHz, DMSO+CDCl3): 168.3, 155.5, 149.3, 143.2, 132.5, 127.6,

124.5, 123.3, 122.6, 118.5, 114.3, 110.8, 108.2, 56.2, 49.6, 49.2, 41.9, 12.6. MS calcd. for C23H23ClN2O4: 426.89. Found: 427.6, (M+). Anal. Calcd. for C23H23ClN2O4: C, 64.71; H, 5.43; N,6.56; Found: C, 64.72; H, 5.44; N, 6.55. 4.1.3. Ethyl 5-(4-(2-(4-fluorophenyl)acetyl)piperazin-1-yl)benzofuran-2-carboxylate (10): Off white solid, 91% yield, m.p. 235.1-236.3 0C, 1H NMR (300 MHz, DMSO): δ = 7.63 (m, 2H), 7.29 (m, 4H), 7.12 (m, 2H), 4.35 (q, J = 7.5, 14.4 Hz, 2H), 3.80 (m, 6H), 3.10 (s, 4H), 1.33 (t, J = 6.9 Hz, 3H);

13

C NMR (75 MHz, DMSO+CDCl3): 167.9, 161.8, 158.7, 157.8, 151.1, 145.4, 143.5, 129.7,

126.3, 119.4, 119.2, 114.2, 114.0, 112.5, 111.8, 110.6, 60.26, 51.3, 51.0, 43.6, 13.1. MS calcd. for C23H23FN2O4: 410.44. Found: 411.6, (M+). Anal. Calcd. for C23H23FN2O4: C, 67.31; H, 5.65; N,6.83; Found: C, 67.33; H, 5.66; N, 6.81. 4.1.4. Ethyl 5-(4-(2-(2,4,6-trifluorophenyl)acetyl)piperazin-1-yl)benzofuran-2-carboxylate (11): White solid, 89% yield, m.p. 320.4-3226.6 0C, 1H NMR (300 MHz, DMSO): δ = 7.67 (m, 2H), 7.29 (m, 4H), 4.34 (m, J = 7.5, 14.4 Hz, 2H), 3.79 (m, 6H), 3.10 (s, 4H), 1.33 (t, J = 6.9 Hz, 3H); 13C NMR (75 MHz, DMSO+CDCl3): 160.4, 158.6, 158.1, 149.5, 146.8, 144.6, 125.9, 119.9, 118.6, 115.3, 113.5 110.9, 107.7, 104.5, 97.8, 95.7, 59.6, 54.6, 49.6, 49.6, 45.5, 41.2, 12.8. MS calcd. for C23H21F3N2O4: 446.42. Found: 447.3, (M+). Anal. Calcd. for C23H21F3N2O4: C, 61.88; H, 4.74; N,6.28; Found: C, 21

61.86; H, 4.77; N, 6.26. 4.1.5. Ethyl 5-(4-(2-(4-bromophenyl)acetyl)piperazin-1-yl)benzofuran-2-carboxylate (12): Brown solid, 91% yield, m.p. 268.5-269.6 0C, 1H NMR (300 MHz, DMSO): δ = 7.63 (m, 2H), 7.30 (m, 4H), 7.12 (m, 2H), 4.35 (q, J = 7.5, 14.4 Hz, 2H), 3.80 (m, 6H), 3.10 (s, 4H), 1.33 (t, J = 6.9 Hz, 3H);

13

C NMR (75 MHz, DMSO+CDCl3): 167.4, 154.5, 149.6, 144.2, 142.5, 126.6, 126.5, 124.6,

121.5, 119.5, 114.6, 111.8, 108.8, 56.4, 49.9, 49.6, 42.9, 13.6. MS calcd. for C23H23BrN2O4: 471.34. Found: 472.2, (M+). Anal. Calcd. for C23H23BrN2O4: C, 58.61; H, 4.92; N, 5.94; Found: C, 58.63; H, 4.93; N, 5.92. 4.1.6. Ethyl 5-(4-(2-(4-methoxyphenyl) acetyl)piperazin-1-yl)benzofuran-2-carboxylate (13): White solid, 93% yield, m.p. 289.2-290.4 0C, 1H NMR (300 MHz, DMSO): δ = 7.67 (m, 4H), 7.42 (m, 2H), 7.12 (m, 2H), 4.34 (q, J = 7.5, 14.4 Hz, 2H), 3.81 (m, 6H), 3.13 (s, 4H), 1.33 (t, J = 6.9 Hz, 3H); 13

C NMR (75 MHz, DMSO+CDCl3): 168.1, 157.7, 156.9, 149.5, 146.9, 144.5, 128.3, 126.0, 118.9,

112.6, 111.0, 107.5, 59.8, 53.8, 49.5, 49.1, 44.5, 40.2, 29.4, 12.9. MS calcd. for C24H26N2O5: 422.47. Found: 423.6, (M+). Anal. Calcd. for C24H26N2O5: C, 68.23; H, 6.20; N, 6.63; Found: C, 68.22; H, 6.19; N, 6.61. 4.1.7. Ethyl 5-(4-(3-(4-fluorophenyl) propanoyl)piperazin-1-yl)benzofuran-2-carboxylate (14): Off white solid, 96% yield, m.p. 301.5-302.6 0C, 1H NMR (400 MHz, CDCl3): δ = 7.48 (d, J = 8.8 Hz, 1H), 7.43 (s, 1H), 7.19 (m, 2H), 7.12 (dd, J = 6.4, 2.4 Hz, 1H), 7.07 (d, J = 2.4 Hz, 1H), 6.978 ( t, J = 6.8 Hz, 2H ), 4.43 (q, J = 7.2, 14.0 Hz, 2H), 3.80 (t, J = 4.8 Hz, 2H), 3.57 (t, J = 4.4 Hz, 2H), 3.09 (t, J = 4.8 Hz, 2H), 3.01 (m, 4H), 2.65 ( t, J = 7.6 Hz, 2H ), 1.42 (t, J = 7.2 Hz, 3H); 13C NMR (75 MHz, DMSO+CDCl3): 168.8, 161.3, 157.7, 149.5, 147.0, 144.5, 135.6, 128.6, 126.0, 118.9, 113.5, 112.4, 111.0, 107.5, 59.8, 49.5, 44.0, 40.1, 33.2, 29.0, 12.9. MS calcd. for C24H25FN2O4: 424.46. Found: 425.4, (M+). Anal. Calcd. for C24H25FN2O4: C, 67.91; H, 5.94; N, 6.60; Found: C, 67.93; H, 5.92; N, 6.61. 22

4.1.8. Ethyl 5-(4-(2-phenoxyacetyl) piperazin-1-yl)benzofuran-2-carboxylate (15): White solid, 86% yield, m.p. 269.3-270.4 0C, 1H NMR (300 MHz, DMSO): δ = 7.62 (m, 2H), 7.28 (m, 4H), 6.94 (m, 3H), 4.85 (s, 2H), 4.35 (q, J = 7.5, 14.4 Hz, 2H), 3.80 (m, 4H), 3.10 (m, 4H), 1.33 (t, J = 6.9 Hz, 3H);

13

C NMR (75 MHz, DMSO+CDCl3): 164.6, 157.4, 156.4, 149.5, 146.0, 144.4, 127.9,

125.8, 119.7, 118.8, 113.0, 112.2, 110.9, 107.9, 65.1, 59.6, 49.6, 49.2, 43.4, 39.9, 12.7. MS calcd. for C23H24N2O5: 408.45. Found: 409.2, (M+). Anal. Calcd. for C23H24N2O5: C, 67.63; H, 5.92; N, 6.86; Found: C, 67.61; H, 5.94; N, 6.83. 4.1.9. Ethyl 5-[4-(Naphthalene-1-carbonyl)-piperazin-1-yl]-benzofuran-2-carboxylate (16): White solid, 85% yield, m.p. 253.5-255.4 0C, 1H NMR (300 MHz, DMSO): δ = 8.02 (m, 2H), 7.82 (m, 1H), 7.56 (m, 6H), 7.25 (m, 2H), 4.35 (q, J = 7.5, 14.4 Hz, 2H), 3.90 (b, 2H), 3.25 (m, 3H), 3.05 (b, 2H), 1.33 (t, J = 6.9 Hz, 3H) 6H);

13

C NMR (75 MHz, DMSO+CDCl3): 168.7, 158.9, 151.2, 150.4,

145.4, 135.4, 135.2, 132.6, 129.6, 128.4, 127.3, 126.8, 125.5, 123.5, 114.5, 112.6, 106.4, 58.5, 49.5, 48.2, 13.2. MS calcd. For C26H24N2O4: 428.1. Found: 428.2, (M+). Anal. Calcd. for C26H24N2O4: C, 72.88; H, 5.65; N, 6.95; Found: C, 72.85; H, 5.66; N, 6.94. 4.1.10. Ethyl 5-{4-[4-(Tetrahydro-pyran-4-yl)-benzoyl]-piperazin-1-yl}-benzofuran-2-carboxylate (17): White solid, 86% yield, m.p. 245.6-246.4 0C, 1H NMR (400 MHz, CDCl3): δ = 7.49 (d, J = 9.2 Hz, 1H), 7.43 (m, 3H), 7.15 (dd, J = 6.8, 2.4 Hz, 1H), 7.11 (d, J = 1.6 Hz, 1H), 6.90 ( d, J = 8.8 Hz, 2H ), 4.43 (q, J = 7.2, 14.0 Hz, 2H), 3.86 (m, 9H), 3.27 (t, J = 4.8 Hz, 4H), 3.09 (s, 4H), 1.42 (t, J = 7.2 Hz, 3H);

13

C NMR (75 MHz, DMSO+CDCl3): 168.9, 157.8, 150.9, 149.6, 147.1, 144.6, 131.3, 127.6,

126.1, 124.3, 123.6, 119.1, 112.9, 112.5, 111.9, 111.1, 107.7, 65.1, 64.9, 59.9, 49.7, 46.9, 45.5, 13.0. MS calcd. for C27H30N2O5: 462.2. Found: 463.1, (M+). Anal. Calcd. for C27H30N2O5: C, 70.11; H, 6.54; N, 6.06; Found: C, 70.13; H, 6.55; N, 6.08. 4.1.11. Ethyl 5-(4-(2-cyclohexylacetyl) piperazin-1-yl)benzofuran-2-carboxylate (18): 23

Brown solid, 76% yield, m.p. 311.3-313.4 0C, 1H NMR (400 MHz, CDCl3): δ = 7.44 (d, J = 8.8 Hz, 1H), 7.44 (s, 1H), 7.15 (dd, J = 6.8, 2.8 Hz, 1H), 7.10 (d, J = 2.4 Hz, 1H), 4.43 (q, J = 7.6, 14.4 Hz, 2H), 3.38 (t, J = 4.8 Hz, 2H), 3.67 (t, J = 4.8 Hz, 2H), 3.12 (s, 4H), 2.26 (d, J= 6.8 Hz, 1H), 1.81 (m, 6H), 1.42 (t, J = 7.2 Hz, 3H), 1.31 ( m, 2H ), 1.19 ( m, 2H ), 0.97 ( m, 2H );

13

C NMR (75 MHz,

DMSO+CDCl3): 169.2, 158.8, 151.8, 150.6, 144.2, 142.6, 114.2, 114.0, 112.5, 60.1, 51.2, 51.0, 39.8, 32.5, 31.2, 29.4, 26.2, 13.5. MS calcd. For C23H30N2O4: 398.5. Found: 399.6, (M+). Anal. Calcd. for C23H30N2O4: C, 69.32; H, 7.59; N, 7.03; Found: C, 69.31; H, 7.58; N, 7.02. 4.1.12. Ethyl 5-[4-(2-Adamantan-1-yl-acetyl)-piperazin-1-yl]-benzofuran-2-carboxylate (19): White solid, 89% yield, m.p. 245.5-246.4 0C, 1H NMR (400 MHz, CDCl3): δ = 7.48 (d, J = 8.8 Hz, 1H), 7.43 (s, 1H), 7.15 (dd, J = 6.8, 2.4 Hz, 1H), 7.09 (d, J = 2.4 Hz, 1H), 4.43 (q, J = 7.2, 14.0 Hz, 2H), 3.88 (t, J = 4.8 Hz, 4H), 3.13 (t, J = 5.2 Hz, 2H), 2.04 (m, 9H), 1.74 (m, 6H), 1.42 (t, J = 7.2 Hz, 3H);

13

C NMR (75 MHz, DMSO+CDCl3): 170.1, 158.8, 149.6, 146.2, 134.2, 131.2, 112.5, 111.0,

109.6, 108.2, 59.8, 49.8, 49.6, 48.7, 44.2, 38.6, 35.5, 32.6, 28.6, 13.2. MS calcd. for C27H34N2O4: 450.5. Found: 451.4, (M+). Anal. Calcd. for C27H34N2O4: C, 71.97; H, 7.61; N, 6.22; Found: C, 71.95; H, 7.63; N, 6.23. 4.1.13. Ethyl 5-[4-(2,3-Dihydro-1H-indole-2-carbonyl)-piperazin-1-yl]-benzofuran-2-carboxylate (20): Off white solid, 84% yield, m.p. 285.3-2866.4 0C, 1H NMR (300 MHz, DMSO): δ = 7.99 (d, J = 7.8 Hz, 1H), 7.60 (m, 2H), 7.34 (m, 3H), 7.13 (m, 1H), 6.95 (m, 2H), 6.57 (m, 2H), 5.64 (s, 1H), 4.70 (m, 1H), 4.35 (q, J = 6.6, 13.8 Hz, 2H), 3.66 (m, 4H), 3.19 (m, 6H), 1.33 (t, J = 6.9 Hz, 3H) 6H); 13C NMR (75 MHz, DMSO+CDCl3): 171.1, 163.6, 158.4, 150.4, 150.2, 147.4, 145.1, 128.9, 126.8, 126.1, 124.2, 123.9, 123.4, 119.5, 118.3, 114.5, 112.9, 111.7, 109.7, 108.3, 60.6, 60.4, 57.0, 50.1, 49.9, 44.1, 41.3, 34.0, 28.9, 13.4. MS calcd. for C24H25N3O4: 419.4. Found: 420.6, (M+). Anal. Calcd. for C24H25N3O4: C, 68.72; H, 6.01; N, 10.02; Found: C, 68.74; H, 6.03; N, 10.01. 24

4.1.14. Ethyl 5-[4-(Furan-2-carbonyl)-piperazin-1-yl]-benzofuran-2-carboxylate (21): Off white solid, 93% yield, m.p. 185.5-186.4 0C, 1H NMR (300 MHz, DMSO): δ = 7.57 (m, 4H), 7.24 (m, 2H), 7.13 (d, J = 7.6 Hz, 1H), 4.35 (q, J = 7.5, 14.4 Hz, 2H), 3.320 (m, 4H), 3.10 (m, 4H), 1.33 (t, J = 6.9 Hz, 3H) 6H);

13

C NMR (75 MHz, DMSO+CDCl3): 157.4, 157.1, 149.2, 146.7, 145.9, 144.3,

142.6, 125.8, 118.7, 114.5,112.3, 110.8, 109.7, 107.3, 59.6, 49.3, 12.7. MS calcd. for C20H20N2O5: 368.3. Found: 369.2, (M+). Anal. Calcd. for C20H20N2O5: C, 65.21; H, 5.47; N, 7.60; Found: C, 65.23; H, 5.44; N, 7.59. 4.1.15. Tert-butyl 4-[4-(2-ethoxycarbonyl) benzofuran-5-yl) piperazine-1-carbonyl] piperidine-1carboxylate (22): White solid, 91% yield, m.p. 269.5-271.4 0C, 1H NMR (400 MHz, CDCl3): δ = 7.82 (d, J = 8.2 Hz, 1H), 7.43 (m, 3H), 7.13 (d, J = 6.8, Hz, 1H), 7.10 (d, J = 6.6 Hz, 1H), 6.90 (m, 2H ), 4.43 (q, J = 7.2, 14.0 Hz, 2H), 4.32 (m, 4H), 3.27 (m, 4H), 3.09 (m, 9H), 1.42 (t, J = 7.2 Hz, 3H) 1.09 (s, 9H);

13

C

NMR (75 MHz, DMSO+CDCl3): 172.1, 158.9, 157.9, 151.2, 145.3, 143.6, 129.9, 119.3, 118.6, 114.6, 111.3, 80.6, 60.6, 51.6, 48.6, 45.2, 41.6, 30.2, 29.8, 13.5. MS calcd. for C26H35N3O6: 485.5. Found: 486.4, (M+). Anal. Calcd. for C26H35N3O6: C, 64.31; H, 7.27; N, 8.65; Found: C, 64.33; H, 7.26; N, 8.64. 4.1.16. Ethyl 5-[4-(2-Chloro-pyridine-3-carbonyl)-piperazin-1-yl]-benzofuran-2-carboxylate (23): White solid, 95% yield, m.p. 295.6-297.4 0C, 1H NMR (300 MHz, DMSO): δ = 8.72 (s, 1H), 7.82 (m, 3H), 7.36 (m, 2H), 7.25 (m, 2H), 4.35 (q, J = 7.5, 14.4 Hz, 2H), 3.90 (m, 4H), 3.25 (m, 4H), 1.33 (t, J = 6.9 Hz, 3H) 6H); 13C NMR (75 MHz, DMSO+CDCl3): 168.9, 158.6, 154.2, 151.6, 150.9, 148.4, 142.1, 139.9, 136.4, 133.2, 128.0, 118.6, 109.2, 108.7, 60.7, 51.6, 48.9, 13.2. MS calcd. for C21H20ClN3O4: 413.8. Found: 414.7, (M+). Anal. Calcd. for C21H20ClN3O4: C, 60.95; H, 4.87; N, 10.15; Found: C, 60.91; H, 4.88; N, 10.13. 4.1.17. Ethyl 5-[4-(3-Chloro-pyrazine-2-carbonyl)-piperazin-1-yl]-benzofuran-2-carboxylate (24): 25

Off White solid, 84% yield, m.p. 259.6-261.4 0C, 1H NMR (300 MHz, DMSO): δ = 8.82 (m, 2H), 7.63 (m, 2H), 7.56 (s, 1H), 7.06 (m, 3H), 4.35 (q, J = 7.5, 14.4 Hz, 2H), 3.80 (m, 4H), 3.10 (m, 4H), 1.33 (t, J = 6.9 Hz, 3H) 6H);

13

C NMR (75 MHz, DMSO+CDCl3): 162.2, 158.2, 150.1, 148.0, 147.2, 145.0,

144.5, 143.7, 141.1, 126.5, 119.7, 112.9, 111.6, 108.4, 60.3, 50.1, 49.7, 45.5, 40.7, 29.9, 13.4. MS calcd. for C20H19ClN4O4: 414.8, Found: 415.6, (M+). Anal. Calcd. for C20H19ClN4O4: C, 57.90; H, 4.62; N, 13.51; Found: C, 57.93; H, 4.61; N, 13.53. 4.1.18.

5-[4-(3-Trifluoromethyl-pyridine-2-carbonyl)-piperazin-1-yl]-benzofuran-2-

carboxylicacidethyl ester (25): White solid, 93% yield, m.p. 274.4-275.6 0C, 1H NMR (400 MHz, DMSO): δ = 8.90 (d, J = 4.8 Hz, 1H), 8.36 (d, J = 7.6 Hz, 1H), 7.74 (m, 1H), 7.60 (d, J = 7.6 Hz, 2H), 7.30 (m, 1H), 7.23 (s, 1H), 4.35 (q, J = 6.8, 14.0 Hz, 2H), 3.84 (t, J = 4.8 Hz, 2H), 3.27 (t, J = 4.4 Hz, 2H), 3.21 (t, J = 5.2 Hz, 2H), 3.04 (t, J = 4.8 Hz, 2H), 1.33 (t, J = 7.2 Hz, 3H) 6H);

13

C NMR (75 MHz, DMSO+CDCl3): 164.4, 158.5,

152.0, 151.5, 150.3, 147.7, 145.3, 134.8, 126.8, 123.7, 122.5, 120.7, 120.0, 113.4, 111.9, 108.6, 60.6, 49.9, 45.9, 40.9, 13.8. MS calcd. for C22H20F3N3O4: 447.4. Found: 448.5, (M+). Anal. Calcd. for C22H20F3N3O4: C, 59.06; H, 4.51; N, 9.39; Found: C, 59.08; H, 4.50; N, 9.38. 4.1.19. Ethyl 5-[4-(2,6-Difluoro-benzoyl)-piperazin-1-yl]-benzofuran-2-carboxylate (26): White solid, 94% yield, m.p. 312.5-313.9 0C, 1H NMR (400 MHz, CDCl3): δ = 7.51 (d, J = 9.2 Hz, 1H), 7.44 (s, 1H), 7.38 (m, 1H), 7.18 (m, 2H), 6.97 (t, J = 7.6 Hz, 2H), 4.44 (q, J = 7.2, 14.0 Hz, 2H), 3.89 (t, J = 4.8 Hz, 2H), 3.50 (m, 2H), 3.20 (t, J = 4.0 Hz, 2H), 3.16 (t, J = 5.2 Hz, 2H), 1.42 (t, J = 7.2 Hz, 3H); 13C NMR (75 MHz, DMSO+CDCl3): 159.4, 158.6, 156.2, 149.4, 145.6, 144.4, 126.5, 119.8, 112.6, 109.5, 107.9, 104.2, 60.1, 59.6, 53.4, 49.7, 49.4, 43.5, 40.6, 12.8. MS calcd. for C22H20F2N2O4: 414.4. Found: 415.6, (M+). Anal. Calcd. for C22H20F2N2O4: C, 63.76; H, 4.86; N, 6.76; Found: C, 63.75; H, 4.85; N, 6.78. 4.1.20. Ethyl 5-[4-(2-Trifluoromethyl-benzoyl)-piperazin-1-yl]-benzofuran-2-carboxylate (27): 26

Off white solid, 86% yield, m.p. 284.6-286.2 0C, 1H NMR (400 MHz, CDCl3): δ = 7.59 (m, 3H), 7.28 (m, 4H), 4.44 (q, J = 7.2, 14.0 Hz, 2H), 3.89 (t, J = 4.8 Hz, 2H), 3.50 (m, 2H), 3.20 (t, J = 4.0 Hz, 2H), 3.16 (t, J = 5.2 Hz, 2H), 1.42 (t, J = 7.2 Hz, 3H); 13C NMR (75 MHz, DMSO+CDCl3): 165.0, 157.3, 149.2, 146.6, 144.2, 133.0, 130.9, 127.8, 125.7, 125.0, 118.8, 112.2, 110.7, 107.4, 59.5, 48.8, 45.2, 39.8, 12.6. MS calcd. for C23H21F3N2O4: 446.4. Found: 447.5, (M+). Anal. Calcd. for C23H21F3N2O4: C, 61.88; H, 4.74; N, 6.28; Found: C, 61.86; H, 4.73; N, 6.26. 4.1.21. Ethyl 5-[4-(3-Methoxy-benzoyl)-piperazin-1-yl]-benzofuran-2-carboxylate (28): White solid, 91% yield, m.p. 296.5-298.1 0C, 1H NMR (400 MHz, CDCl3): δ = 7.51 (d, J = 8.8 Hz, 1H), 7.44 (s, 1H), 7.33 (m, 1H), 7.17 (m, 2H), 6.98 (t, J = 8.8 Hz, 3H), 4.44 (q, J = 7.2, 14.0 Hz, 2H), 3.97 (b, 2H), 3.83 (s, 3H), 3.65 (b, 2H), 3.17 (b, 4H), 1.42 (t, J = 7.2 Hz, 3H);

13

C NMR (75 MHz,

DMSO+CDCl3): 168.9, 158.4, 150.3, 147.1, 145.2, 136.0, 128.8, 126.5, 119.6, 118.1, 114.6, 112.9, 111.6, 108.5, 60.4, 54.5, 50.3, 13.4. MS calcd. for C23H24N2O5: 408.4. Found: 408.5, (M+). Anal. Calcd. for C23H24N2O5: C, 67.63; H, 5.92; N, 6.86; Found: C, 67.66; H, 5.93; N, 6.87. 4.1.22.

Ethyl

5-[4-(2,6-Difluoro-4-methoxy-benzoyl)-piperazin-1-yl]-benzofuran-2-carboxylate

(29): White solid, 90% yield, m.p. 265.8-266.4 0C, 1H NMR (300 MHz, DMSO): δ = 7.60 (d, J = 8.7 Hz, 1H), 7.27 (m, 2H), 6.87 (d, J = 9.9 Hz, 2H), 4.44 (q, J = 7.2, 14.0 Hz, 2H), 3.57 (m, 3H), 3.17 (d, J = 6.8 Hz, 4H), 1.42 (t, J = 7.2 Hz, 3H); 13C NMR (75 MHz, DMSO+CDCl3): 160.4, 158.2, 157.5, 149.4, 146.5, 144.4, 125.8, 118.9, 112.3, 110.9, 107.7, 104.2, 97.1, 96.7, 59.6, 54.6, 49.7, 49.2, 45.1, 40.2, 12.8. MS calcd. for C23H22F2N2O5: 444.4. Found: 445.6, (M+). Anal. Calcd. for C23H22F2N2O5: C, 62.16; H, 4.99; N, 6.30; Found: C, 62.18; H, 4.97; N, 6.33. 4.1.23. Ethyl 5-[4-(4-Trifluoromethyl-benzoyl)-piperazin-1-yl]-benzofuran-2-carboxylate (30): Off white solid, 87% yield, m.p. 301.6-303.1 0C, 1H NMR (400 MHz, CDCl3): δ = 7.71 (d, J = 8.0 Hz, 2H), 7.56 (d, J = 8.0 Hz, 2H), 7.50 (d, J = 8.8 Hz, 1H), 7.44 (s, 1H), 7.17 (m, 2H), 4.43 (q, J = 7.2, 14.0 27

Hz, 2H), 4.00 ( b, 2H ), 3.59 (b, 2H), 3.20 (b, 4H), 1.42 (t, J = 7.2 Hz, 3H);

13

C NMR (75 MHz,

DMSO+CDCl3); 167.8, 158.5, 150.4, 147.2, 145.3, 138.5, 126.7, 124.7, 119.7, 112.9, 111.8, 108.6, 60.5, 50.4, 46.6, 13.5. MS calcd. for C23H21F3N2O4: 446.4. Found: 447.5, (M+). Anal. Calcd. for C23H21F3N2O4: C, 61.88; H, 4.74; N, 6.28; Found: C, 61.86; H, 4.73; N, 6.27. 4.1.24. Ethyl 5-[4-(2,6-Dichloro-benzoyl)-piperazin-1-yl]-benzofuran-2-carboxylate (31): White solid, 85% yield, m.p. 324.5-325.4 0C, 1H NMR (400 MHz, CDCl3): δ = 7.69 (d, J = 8.8 Hz, 2H), 7.45 (m, 4H), 7.10 (d, J = 8.0 Hz, 2H), 4.43 (q, J = 7.2, 14.0 Hz, 2H), 3.89 (t, J = 5.2 Hz, 4H ), 3.20 (t, J = 4.0 Hz, 4H), 1.42 (t, J = 7.2 Hz, 3H); 13C NMR (100 MHz, DMSO+CDCl3); 160.9, 156.9, 148.8, 146.3, 143.8, 132.8, 129.2, 126.4, 125.4, 118.5, 112.0, 110.5, 107.1, 59.2, 48.8, 48.4, 44.0, 39.4, 12.4. MS calcd. for C22H20Cl2N2O4: 447.3. Found: 448.1, (M+). Anal. Calcd. for C22H20Cl2N2O4: C, 59.07; H, 4.51; N, 6.26; Found: C, 59.09; H, 4.53; N, 6.25. 4.1.25. Ethyl 5-[4-(2-Trifluoromethoxy-benzoyl)-piperazin-1-yl]-benzofuran-2-carboxylate (32): White solid, 91% yield, m.p. 283.6-285.4 0C, 1H NMR (400 MHz, CDCl3): δ = 7.89 (d, J = 7.6 Hz, 2H), 7.56 (d, J = 8.0 Hz, 2H), 7.25 (m, 2H), 7.17 (m, 2H), 4.43 (q, J = 7.2, 14.0 Hz, 2H), 3.89 ( b, 2H ), 3.60 (b, 2H), 3.10 (b, 4H), 1.42 (t, J = 7.2 Hz, 3H); 13C NMR (75 MHz, DMSO+CDCl3); 163.8, 157.9, 149.8, 147.0, 144.7, 143.4, 129.7, 128.3, 127.5, 126.2, 119.3, 112.5, 111.2, 107.9, 60.1, 49.8, 45.6, 40.5, 13.1. MS calcd. for C23H21F3N2O5: 462.4. Found: 463.6, (M+). Anal. Calcd. for C23H21F3N2O5: C, 59.74; H, 4.58; N, 6.06; Found: C, 59.76; H, 4.55; N, 6.07. 4.1.26. Ethyl 5-[4-(3-Methyl-butyryl)-piperazin-1-yl]-benzofuran-2-carboxylate (33): White solid, 93% yield, m.p. 296.4-298.2 0C, 1H NMR (400 MHz, CDCl3): δ = 7.49 (d, J = 9.2 Hz, 1H), 7.44 (s, 1H), 7.13 (dd, J = 6.8, 2.4 Hz, 1H), 4.43 (q, J = 7.2, 14.0 Hz, 2H), 3.82 (t, J = 4.8 Hz, 2H), 3.67 (t, J = 4.0 Hz, 2H), 3.13 (m, 4H), 2.26 (d, J = 6.8 Hz, 2H), 2.14 (m, 1H ), 1.42 (t, J = 7.2 Hz, 3H); 13

C NMR (75 MHz, DMSO+CDCl3): 169.4, 157.9, 149.7, 147.1, 144.7, 126.2, 119.1, 112.5, 111.2,

107.7, 60.0, 49.9, 49.5, 44.4, 40.6, 40.1, 24.4, 21.5, 13.1. MS calcd. for C20H26N2O4: 358.4. Found: 28

359.6, (M+). Anal. Calcd. for C20H26N2O4: C, 67.02; H, 7.31; N, 7.82; Found: C, 67.04; H, 7.33; N, 7.81. 4.2. Biological activity 4.2.1. Protein cloning, expression and purification: Cloning of M. smegmatis GyraseB gene was done separately by amplifying the gene from mc2155 genomic DNA using the specific forward and reverse primers using specific restriction enzymes 5' CACCCATATGGTGGCTGCCCAGAAGAACAA

3'

(NdeI),

and

5'

AGCTAAGCTTTTAAACATCCAGGAAGCGAA 3' (Hind III) respectively. The final PCR amplicons obtained were cloned in expression vector pQE2 (Qiagen) with a 6-His-tag and was then transformed into host BL21 (DE3) pLysS cells, specifically because of the compatibility of the host system for GyrB protein expression and structurally similar protein folding. The vector transformed cells were later grown at 37°C in LB broth containing 100µg/ml ampicillin upto an optical density (OD) of 0.4 to 0.6 at (A595). Further for the increased production of protein the bacterial cells, were induced with isopropylβ-D-thiogalactopyranoside (IPTG) at a final concentration of 0.1mM while the cells were in exponential growth phase, and the cell growth was continued for another 12h at 18oC, as low temperature promotes the slow release of the desired protein. The bacterial cells were then centrifuged at 7000rpm, 4°C for 15 min. The cell pellets were re-suspended in PBSG buffer (PBS containing 5% glycerol), further lysed using sonicator (20sec pulse and 45sec halt) and centrifuged the crude lysate at 8000 rpm, 4°C for 10 min, subsequently centrifugation was repeated for the supernatant of previous step at 10000 rpm at 4°C for 35min for a clear supernatant. The cell extract was later applied to preequilibrated Ni-NTA column (GE), and the column was washed with wash buffer (5% glycerol in PBS and 500mM NaCl) and the protein was eluted using different concentration of imidazole ranging from 10mM to 200mM in the elution buffer (5% Glycerol, 140mM NaCl in 25 mM Tris-Cl (pH 8.0)). Fractions containing the desired GyrB enzyme was confirmed by running an SDS-PAGE(sodium 29

dodecyl sulphate-polyacrylamide gel electrophoresis), subsequently pooled the 100mM and 200mM fractions and dialyzed against the dialyses buffer (15% Glycerol, 140mM NaCl in 25 mM Tris-HCl (pH 7.4)), aliquoted and stored at -80°C. 4.2.2. Mycobacterium smegmatis GyrB ATPase assay: ATPase assay was performed using gyraseB enzyme, it was performed in 30 μL reaction volume consisting of assay buffer (60 mM HEPES-KOH pH 7.7, 250 mM potassium glutamate, 200 mM KCl, 2 mM magnesium chloride, 1 mM DTT, 4% DMSO, 2% glycerol 0.001% BriJ) incubated with 870nM GyrB, 300nM ATP and varied concentrations of inhibitors for about 100 min at 25 0C in 96 V-shaped well plate. The reaction was initiated by the addition of 16 µL of MgCl 2 solution, as metal ion triggers the GyrB enzymatic function. Subsequently, the reaction was quenched by the addition of 20 µL of malachite green (Bioassay systems) and incubated for 20 min, absorbance was measured at 635 nm wavelength against the blank.13 In this assay, novobiocin was considered as positive control and moxifloxacin as the negative control. 4.2.3. Mycobacterium tuberculosis DNA supercoiling assay: Supercoiling assay was performed in 1.5mL eppendrof tubes with 30 µL reaction volume consisting of assay buffer (50mM HEPES. KOH (pH 7.9), 6mM magnesium acetate, 100mM potassium glutamate, 4mM DTT, 2mM spermidine, 1mM ATP, and 0.05 mg/ml of albumin) incubated with 1U of DNA gyrase with 0.5 µg of relaxed pBR322 and at varied inhibitor concentrations for 30 min at 370C, to calculate their IC50, eventually the reaction was quenched by the addition of 30µl of chloroform: Isoamylalcohol (24:1) and STEB buffer (40% sucrose, 100mM Tris–HCl (pH 8.0), 100mM EDTA and 0.5mg/ml bromophenol blue) in equal volume. Later the samples were vortexed, centrifuged and loaded onto 1% Agarose gel in TAE buffer. Further, samples were analysed after staining with ethidium bromide using Image lab software (Bio-Rad).12

30

4.2.4. Antibacterial activity: The compounds were further screened for their in vitro antimycobacterial activity against Mtb H37Rv strain by microplate Alamar blue assay method. Briefly, the inoculum was prepared from fresh LJ medium, re-suspended in 7H9-S medium (7H9 broth, 0.1% casitone, 0.5% glycerol, supplemented oleic acid, albumin, dextrose, and catalase [OADC]), adjusted to a McFarland tube No. 1, and diluted 1:20; for each 100 µl was used as inoculum.18 Each drug stock solution was thawed and diluted in 7H9S at four-fold the final highest concentration tested. Serial two-fold dilutions of each drug were prepared directly in a sterile 96-well microtiter plate using 100 µl 7H9-S. A growth control containing no antibiotic and a sterile control were also prepared for each plate. In order to avoid evaporation during incubation of 7 days, sterile water was added to all perimeter wells. The plate was covered, sealed in plastic bags and incubated at 37oC in normal atmosphere. After 7 days of incubation, 30 µl of alamar blue solution was added to each well, and the plate was further re-incubated overnight. A change in color from blue (oxidized state) to pink (reduced) indicated the growth of bacteria, and the MIC was defined as the lowest concentration of drug that prevented this change in color. 4.2.5. Cytotoxicity: The cytotoxic activity against RAW 264.7 (mouse macrophages) was measured by incubating the test compounds in 96- well plate containing 5 × 105 cells at different concentrations at 37 °C, with 5% CO2 and 95% O2 atmosphere for 48 h.19 About 4 h, before the end of incubation period 10 μL of MTT reagent (10 mg mL−1) was added, the 96-well plate was centrifuged at 1200 rcf for about 3 min and the supernatants were removed, subsequently to each well 200 μL of DMSO was added. The absorbance was measured at a wavelength of 560 nm on Perkin Elmer Victor X3 microplate reader against the blank. Three replicate wells were done for each concentration of drug to minimize the error rate. The cytotoxicity of each compound was expressed as % inhibition.

31

4.2.6. Differential Scanning fluorimetry: DSF technique helps in understanding the thermal stability of a protein. Alternately, the affinity of most potent ligand with the protein of our interest can be known by measuring the fluorescence by SYPRO orange dye. This dye has specific affinity towards non-polar residues of the protein exposed during denaturation.3 This assay was done in 15 µL reaction volume consisting of (7.5 µL of protein (1.5 mg/mL), 3.5 µL of buffer (50mM Tris pH 7.4, 1 mM EDTA, 5 mM DTT)) and 2.5 µL of Sypro orange (1:100) (Sigma) was subjected to stepwise heating in a PCR instrument (Bio-Rad) from 25oC to 100oC with an increment of 0.60C/min. With increase in temperature the protein slowly unfolds and the inner hydrophobic residues get exposed, eventually more dye binds to the protein and fluorescence increases till it reaches equilibrium.20 Consequently, As the temperature increases, the stability of the protein decreases and becomes zero at equilibrium, which is termed Tm of the protein, at this point the concentrations of folded and unfolded protein becomes equal. When the affinity of inhibitor is strong we observe a positive shift or increase in Tm compared to the Tm of native protein which signifies strong affinity of protein ligand complex.

4.2.7. Molecular modelling studies

The most potent lead 22 which showed good inhibition profile in biological assays was docked onto the active pocket of the GyrB ATPase domain of M. smegmatis crystal structure retrieved from Protein Data Bank (PDB ID: 4B6C). The protein was initially processed and prepared using the Protein Preparation Wizard of Schrödinger Suite 2012.21 Further, the optimization of the hydrogen-bonding network, the energy minimization and e-pharmacophore hypothesis generation along with the ligands to be docked were sketched in Maestro panel of Schrödinger and optimized with OPLS force field The docking of these molecules with the protein was done using Glide v5.8 version.23

32

22

Acknowledgments: DS thank University Grants Commission (UGC), government of India for UGC Researcher award and one of the authors JR (SRF) is thankful for CSIR for the financial assistance provided. References: [1]. http://www.who.int/mediacentre/factsheets/fs104/en/ 28/04/2014. [2] Aboul-Fadl, T.; Abdel-Aziz, HA.; Abdel-Hamid, MK.; Elsaman, T.; Thanassi, J.; Pucci, MJ.; Molecules. 2011,16, 7864. [3] Brvar, M.; Perdih, A.; Hodnik, V.; Renko, M.; Anderluh, G.; Jerala, R.; Solmajer, T.; Bioorg. Med. Chem. Lett. 2009, 19, 2668 [4] Mdluli, K.; Ma, Z.; Infect Disord Drug Targets. 2007, 7, 159. [5] Maxwell, A.; Lawson, DM.; Curr. Top. Med. Chem. 2003, 3, 283. [6] Maxwell, A.; Trends Microbiol. 1997, 5, 102. [7] Champoux, JJ.; Annu. Rev. Biochem. 2001, 70, 369. [8] Collin, F.; Karkare, S.; Maxwell, A.; Appl. Microbiol. Biotechnol. 2011, 92, 479. [9] Cole, ST.; Brosch, R.; Parkhill, J.; Garnier, T.; Churcher, C.; Harris, D.; Gordon, SV.; Eiglmeier, K.; Gas, S.; Barry, CE.; Tekaia, F.; Badcock, K.; Basham, D.; Brown, D.; Chillingworth, T.; Connor, R.; Davies, R.; Devlin, K.; Feltwell, T.; Gentles, S.; Hamlin, N.; Holroyd, S.; Hornsby, T.; Jagels, K.; Krogh, A.; McLean, J.; Moule, S.; Murphy, L.; Oliver, K.; Osborne, J.; Quail, MA.; Rajandream, MA.; Rogers, J.; Rutter, S.; Seeger, K.; Skelton, J.; Squares, R.; Squares, S.; Sulston, JE.; Taylor, K.; Whitehead, S.; Barrell, BG.; Nature, 1998, 393, 537.

33

[10] Aubry, A.; Fisher, L.M.; Jarlier, V.; Cambau, E.; Biochem. Biophys. Res. Commun. 2006, 348, 158. [11] Borcherding, S.M.; Stevens, R.; Nicholas, R.A.; Corley, C.R.; Self, T.; J. Fam. Pract. 1996, 42, 69. [12] Jeankumar, VU.; Renuka, J.; Pulla, VK.; Soni, V.; Sridevi, JP.; Suryadevara, P.; Shravan, M.; Medishetti, R.; Kulkarni, P.; Yogeeswari, P.; Sriram, D.; Int J Antimicrob Agents. 2014, 43, 269. [13] Jeankumar, VU.; Renuka, J.; Santosh, P.; Soni, V.; Sridevi, JP.; Suryadevara, P.; Yogeeswari. P.; Sriram, D.; Eur J Med Chem. 2013, 70, 143-53.

[14] Bax, BD.; Chan, PF.; Eggleston, DS.; Fosberry, A.; Gentry, DR.; Gorrec, F.; Giordano, I.; Hann, MM.; Hennessy, A.; Hibbs, M.; Huang, J.; Jones, E.; Jones, J.; Brown, KK.; Lewis, CJ.; May EW.; Saunders MR.; Singh, O.; Spitzfaden, CE.; Shen, C.; Shillings, A.; Theobald, AJ.; Wohlkonig, A.; Pearson, ND.; Gwynn, MN.; Nature. 2010, 466, 935-40. [15] Geng, B.; Comita-Prevoir, J.; Eyermann, CJ.; Reck, F.; Fisher, S.; Bioorg Med Chem Lett. 2011, 21, 5432-5. [16] Ali, JA.; Jackson, AP.; Howells, AJ.; Maxwell, a.; Biochemistry 1993, 32, 2717. [17] Shirude, PS.; Madhavapeddi, P.; Tucker, JA.; Murugan, K.; Patil, V.; Basavarajappa, H.; Raichurkar, AV.; Humnabadkar, V.; Hussein, S.; Sharma, S.; Ramya, VK.; Narayan, CB.; Balganesh, TS.; Sambandamurthy, VK.; ACS Chem Biol. 2013, 8, 519. [18] Franzblau, SG.; Witzig, RS.; McLaughlin, JC.; Torres, P.; Madico, G.; Hernandez, A.; Degnan, MT.; Cook, MB.; Quenzer, VK.; Ferguson, RM.; Gilman, RH.; J Clin Microbiol. 1998, 36, 362. [19] Gerlier, D.; Thomasset, N.; J Immunol Methods. 1986, 94, 57. [20] Niesen, FH.; Berglund, H.; Vedadi, M.; Nat Protocol. 2007, 2, 2212.

34

[21] (a) Schrödinger Suite 2012, Protein Preparation Wizard; (b) Epik Version 2.2, Schrödinger, LLC, New York, NY, 2012; (c) Impact Version 5.7, Schrödinger, LLC, New York, NY, 2012; (d) Prime Version 2.3, Schrödinger, LLC, New York, NY, 2012. [22] Kar, RK.; Suryadevara, P.; Sahoo, BR.; Sahoo, GC.; Dikhit, MR.; Das, P.; SAR QSAR Environ Res. 2013, 24, 215. [23] Glide, Version 5.8, Schrödinger, LLC, New York, NY, 2012.

35

Graphical Abstract

Design, synthesis, biological evaluation of substituted Benzo-furans as DNA gyrase B inhibitors of Mycobacterium tuberculosis Janupally Renuka a, Kummetha Indrasena Reddyb, c, Konduri Sriharic, Variam Ullas Jeankumara, Jonnalagadda Padma Sridevia, Perumal Yogeeswaria, Kondra Sudhakar Babuc*, Dharmarajan Srirama*