FEMS MicrobiologyLetters 98 (1992) 137-144 © 1992 Federation of European Microbiological Societies 0378-1097/92/$05.00 Published by Elsevier

137

FEMSLE 05123

Detection and differentiation of Colletotrichum gloeosporioides isolates using PCR P e t e r R. Mills

a,b S.

S r e e n i v a s a p r a s a d a a n d Averil E. B r o w n a,b

a Department of Mycology and Plant Pathology, The Queen's Universityof Belfast, Belfast, UK, and h Plant Pathology Research Division, Department of Agriculture for Northern Ireland, NewforgeLane, Belfast, UK Received 29 July 1992 Revision received 13 August 1992 Accepted 13 August 1992

Key words: Colletotrichum gloeosporioides; Diagnostic PCR; Oligonucleotide primer; R A P D analysis

1. S U M M A R Y

2. I N T R O D U C T I O N

An oligonucleotide primer (CgInt), synthesised from the variable internally transcribed spacer (ITS) 1 region of ribosomal D N A (rDNA) of Colletotrichum gloeosporioides was used for P C R with primer ITS4 (from a conserved sequence of the r D N A ) to amplify a 450-bp fragment from the 25 C. gloeosporioides isolates tested. This specific fragment was amplified from as little as 10 fg of fungal DNA. A similar sized fragment was amplified from D N A extracted from C. gloeosporioides-infected tomato tissue. R A P D analysis divided 39 C. gloeosporioides isolates into more than 12 groups linked to host source and geographic origin. Based on the results obtained, the potential of P C R for detection and differentiation of C. gloeosporioides is discussed.

Colletotrichum gloeosporioides infects a wide range of crops causing a variety of diseases. Serious losses have been recorded on e.g. eggplant, grape and cashew [1]. Availability of a rapid, reliable and sensitive method for early detection of the pathogen could facilitate epidemiological studies and the implementation of appropriate control measures. However, disease symptoms caused by C. gloeosporioides, especially on leaves, are difficult to diagnose, necessitating identification of the pathogen using cultural and microscopic characteristics following isolation from diseased tissue. C. gloeosporioides is a highly variable pathogen and is considered as a group species [2]. Restriction fragment length polymorphism (RFLP) analysis of nuclear and mitochondrial D N A has revealed extensive variation among C. gloeosporioides isolates from the same as well as different hosts [3,4]. However, R F L P analysis, though extensively applied, involves long and rigorous pro-

Correspondence to: P.R. Mills, Department of Mycology and Plant Pathology, The Queen's University of Belfast, Newforge Lane, Belfast BT9 5PX, UK.

138 Table 1 Host, country of origin and RAPD groupings of Colletotrichum gloeosporioides isolates Isolates Host

Country of origin

Isolate grouping by the six RAPD primers A3

AI 1

A18

B6

B8

B10

Sri Lanka Sri Lanka Australia Australia New Zealand New Zealand New Zealand Indonesia Indonesia

la la lb lb lc lc lc ld ld

la la lb lb lc lc lc.1 ld ld

la la lb lb lc lc lc ld ld

la la lb lb lc lc lc.1 ld ld

la la lb lb lc lc lc ld ld

la la lb lb.l lc lc lc ld ld

Indonesia Indonesia Sri Lanka Sri Lanka Australia Australia

2a 2a 2b 2b.1 2c 2c

2a 2a 2b 2b.1 2c 2c

2a 2a 2b 2b.1 2c 2c

2a 2a.1 2b 2b 2c 2c.1

2a 2a.1 2b 2b.1 2c 2c

2a 2a 2b 2b.1 2c 2c

Australia Australia Australia Australia

3a 3a.l 3a.2 3a.3

3a 3a 3a 3a.1

3a 3a 3a 3a.1

3a 3a 3a 3a.1

3a 3a 3a 3a.1

3a 3a 3a 3a.1

Sri Lanka Sri Lanka Sri Lanka Sri Lanka Australia Australia Australia Australia Malaysia Malaysia

4a 4a 4a 4a 4a 4a 4a.1 4a.1 4a 4a

4a 4a 4a 4a 4a 4a 4a 4a 4b 4b

4a 4a 4a 4a 4a 4a 4a.1 4a.1 4a 4a

4a 4a.1 4a 4a 4a 4a 4a 4a.l 4a 4a

4a 4a 4a 4a 4a 4a 4a 4a 4a 4a

4a 4a 4a 4a 4a 4a 4a 4a 4a 4a

Australia Australia

5a 5a.1

5a 5a.1

5a 5a.1

5a 5a.1

5a 5a.1

5a 5a.1

Indonesia Indonesia Sri Lanka

6a 6a.1 6b

6a 6a.1 6b

6a 6a.1 6b

6a 6a.1 6b

6a 6a.1 6b

6a 6a.l 6b

Canada USA USA USA USA

7a 7a 7a 7a 7a

7a 7a 7a 7a 7a

7a 7a 7a 7a 7a

7a 7a 7a 7a 7a

7a 7a 7a 7a 7a

7a 7a 7a 7a 7a

Avocado AV1/1 AV3/I JIA1 Av01 918 1072 1152 SP 17 SP 18

Papaya SPI 1 SP 12 P2/10 P3/4 JIP1 BP1

Banana J1B1 BB4 BB7 MBL2

Mango M 1/6 M2/6 M3/4 M4/7 JIM1 BM3 BM7 BM8 MC9 MC10

Stylosantbes NT44 DPO15

Rubber RI / 1 R6/1 . R3/1

Strawberry 254 231 311 315 386

139

cessing of DNA samples. By comparison, the polymerase chain reaction (PCR) is rapid and requires only a minimal number of DNA molecules from which analysable products can be amplified. Using defined oligonucleotide primers for PCR, specific amplification of pathogen DNA can be achieved. In this study, the extent of molecular variation in a worldwide collection of C. gloeosporioides isolates from different hosts has been assessed using RAPD analysis [5]. We also describe the generation of a PCR primer for specific identification of C. gloeosporioides from infected plant tissue.

3. MATERIALS AND METHODS

3.1. Fungal isolates Host and geographical origin of the C. gloeosporioides isolates used are shown in Table 1. Colletotrichum kahawae (= C. coffeanum) (J.M. Waller, pers. comm.) isolates were supplied by Dr. J.M. Waller, International Mycological Institute Kew, Surrey, UK. The source of other isolates is given elsewhere [4,6]. 3.2. DNA extraction and quantification Fungal mycelium was produced in liquid shake culture at 25°C in glucose casamino acid medium [4]. Total DNA was extracted from freeze-dried mycelial powder (300 rag) using the method of Raeder and Broda [7], with modifications [6]. DNA was quantified by ethidium bromide fluorescence on a UV transilluminator with known quantities of lambda DNA [8]. 3.3. Inoculation of tomato fruits and DNA extraction Tomato fruits (cv Alicant6) were inoculated with 20/xl of C. gloeosporioides spore suspension (5 × 105 conidia ml ~), prepared from a 7-day-old culture grown on potato dextrose agar (Oxoid). Uninoculated fruits served as control. Fruits were incubated for 3-5 days in moist chambers at 20°C by which time watery lesions had developed. Tissue (approx. 500 mg) removed from the periphery of the lesions and from uninoculated fruits were

ground in an equal volume of PCR buffer (Tris HCL 200 txM, pH 7.5; NaC1, 250 ixM; EDTA, 25 IzM; and SDS, 0.5%); the debris removed by brief centrifugation (1 min, 14 000 x g) and DNA precipitated by addition of an equal volume of isopropanol at room temperature for 5 rain. DNA was pelleted by centrifugation (10 rain, 14 000 x g) and resuspended in 100 ~1 of 10 mM Tris. HCI and 1 mM EDTA solution, pH 8.

3.4. PCR amplification with target primers Primers CgInt (GGCCTCCCGCCTCCGGGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) [9] were supplied by Operon Technologies Inc., California. PCR reaction mixtures (100 /xl) contained 10 txl fungal DNA (approx. 50 ng), 10 /xl 10 X Taq buffer, 0.5 #I (2.5 U) Taq DNA polymerase (Promega), 200 #M each of dATP, dCTP, dGTP and dTTP (16 tzl), 1 /xM each (5/xl each) of Cglnt and ITS4 and 53.5 p~l of sterile distilled water. Mixtures were subjected to 30 cycles of 1.5 min at 94°C, 2 min at 45°C and 3 min at 72°C on a programmable thermal cycler (Hybald). 3.5. PCR amph'fication with random primers Synthetic oligonucleotides (10-mers; kits A and B) supplied by Operon were used for RAPD analysis. A typical 100-#1 reaction contained 10 txl of a single primer (15 /xg ml i stock) and all other components as described above. An annealing temperature of 30°C and 45 amplification cycles were adopted, preceded by 7 rain denaturation at 94°C and followed by 7 min extension at 72°C. The following six primers were used: A3 (AGTCAGCCAC); A l l (CAATCGCCGT); A18 (AGGTGACCGT); B6 (TGCTCTGCCC); B8 (GTCCACACGG); and B10 (CTGCTGGGAC). PCR products (10-15 txl) were analysed following etectrophoresis in 1.4% (w/v) agarose gels containing ethidium bromide (0.4 txg ml 1) by viewing on a transilluminator. 3.6. Southern blotting, probe preparation, hybridisation and autoradiography PCR products were transferred, following electrophoresis, to nylon membranes, (Hybond N, Amersham) by capillary transfer [8]. A PCR

140 C. g l o e o s p o r i o i d e s C. kahawae C. f r a g a r i a e C. f r a g a r i a e C. musae C. a c u t a t u m C. a c u t a t u m C. capsici C. lindemuthianum C.lini C. orbiculare

GGCCTC**CCGCCTCCG*GGCGG

...... ......

** **

...... ....

..... .....

** .....

C-**

.....

..... C--CC ..... C---*

C---*

.....

C--AG

....

*

2.6 1.6 1.2

---GC-GO--C--A--AC--G-A ---GC-GG--C-*GT-AC--G--T-TC-**-G---CT-TC**-C**--C-**G

....

CG-TC

---TC-GGG--T-C*****

.0.68 .0.46

..... ....

-CT-C-GG*******TAAAAG--

Fig. 1. Variable region in the ITS 1 sequence of Colletotridmm gloeo,7~orioides aligned with other Colletotrichum species.

product amplified from fungal genomic D N A with primers CgInt and ITS4 was labelled with [a32P]deoxyadenosine 5'-triphosphate ( A m e r s h a m ) using the Prime-a-gene labelling system (Promega). Hybridisation conditions were as described previously [6].

4. R E S U L T S

4.1. Selection of a C. gloeosporioides specific primer Nucleotide sequences of the ribosomal repeat unit iternally transcribed spacer (ITS) 1 region of C. gloeosporioides isolates from a range of different hosts were aligned with the same region from other Colletotrichum spp. (approx. 150-180 bp; P.R. Mills, unpublished). A 20-base region specific to C. gloeosporioides, with little or no homology to other Colletotrichum spp., was identified (Fig. 1) and used in the design of the internal primer CgInt.

AAAAAABBCC

DD

E FGH

I I J

Fig. 2. Amplification of a specific fragment from fungal DNA using the target primers Cglnt and ITS4 (A, Colletotrichum gloeosporioides; B, C. kahawae; C, C. fragariae; D, C. acuta-

turn; E, C. lindemuthianum; F, C. orbiculare; G, C. linicola; H, C. capsici; I, Trichoderma spp.; and J, Nectria galligena). M, digested pGEM used as molecular size marker.

4.3. Amplification of the C. gloeosporioides specific fragment from DNA from infected tissue A p r o d u c t of identical size (450 bp) to that amplified from fungal D N A was p r o d u c e d when primers Cglnt and ITS4 were used in P C R with total nucleic acid extracted from infected t o m a t o tissue; no amplification product was observed with nucleic acid extracted from uninoculated tissue (Fig. 3A). Hybridization analysis of the P C R product from infected tissue using the P C R product from fungal D N A yielded a strong signal. N o A

B

--2.6 --1.6 --1,2 --0.68 --0.46

4.2. PCR amphfication of fungal DNA with target primers Primer CgInt and primer ITS4, from the conserved region of the 2 5 / 2 8 S r R N A gene, were used in P C R with genomic D N A from a range of isolates of C. gloeosporioides, C. fragariae and C. kahawae and other Colletotrichum spp. as well as isolates of Nectria galligena and Trichoderma spp. A fragment of approx. 450 bp was amplified (Fig. 2) with all C. gloeosporioides isolates (25), C. fragariae isolates (9) and C. kahawae isolates (10) tested. N o amplification product was observed with D N A from any of the other fungi (Fig. 2).

M

1

2

3

4

M

1

2

3

4

Fig. 3. (A) Amplification of a fragment from DNA from C.

gloeosporioides-infected tomato tissue by Cglnt and ITS4 and (B) Southern analysis of the fragment. Amplification products in lanes 1, fungal DNA; 2, infected tomato tissue; 3, healthy tomato tissue; 4, products of healthy tomato tissue using primers ITS1 and 2, as control. M, digested pGEM used as molecular size marker).

141

using serial dilutions of a known quantity of C.

signal was observed with D N A from uninoculated tomato fruit. This confirmed that the product amplified contained the target sequence of the fungal D N A from infected tissue (Fig. 3B). The sensitivity of PCR detection was assessed

t avocado

cessful amplification with a clearly visible product on ethidium bromide stained agarose gels was achieved down to approx. 10 fg of fungal DNA.

banana

papaya I

~

gloeosporioides genomic D N A as template. Suc-

h..

O0

I

I

Stylosanthes ~r ~-,

I 0,1

0 m

m

N

z

~

M

2.6 1.6 1.2 0.68 0.52 0.35 0.22

mango

rubber

strawberry

II

~

o

~

~

M

dl

dl

61

01

--2.6 --1.6 --1.2 --0.68 --0.52 --0.35 --0.22

Fig. 4. R a n d o m amplification polymorphic D N A patterns of various CoUetorichum gloeosporioides isolates with primer A3 (M, digested p G E M used as molecular size marker). I, host source of C. gloeosporioides isolates; countries of origin are given in Table 1. C. acut, C. acutatum; C. lind, C. lindemuthianurn; C. orb, C. orbiculare; C. lin, C. linicola.

142

4.4. Differentiation of C. gloeosporioides isolates by RAPD analysis Forty oligonucleotide primers of 10 base length were screened with three C gloeosporioides isolates (data not shown), of which 32 (80%) primed DNA synthesis. The complexity of banding patterns varied with some primers (e.g. A3 and A l l ) producing multiple bands while others (e.g. B6 and B8) produced only a single or small number of bands. Six different primers (A3, A l l , A18, B6, B8 and B10) were chosen for the analysis of the 39 C. gloeosporioides isolates from different hosts and various countries. Considerable variation was apparent with RAPD patterns of C. gloeosporioides isolates from one host showing little or no similarity to isolates from another (Fig. 4). Further, C. gloeosporioides isolates from a particular host also revealed different RAPD banding and could be grouped only according to their geographical origin. However, differences in RAPD patterns were observed within the rubber isolates from Indonesia, Stylosanthes isolates from Australia and papaya isolates from Sri Lanka (Table 1; Fig. 4). In contrast, mango isolates collected worldwide revealed a uniform pattern with at least three primers (A11, B8 and B10) although primers A3, A18 and B6 gave a variable banding pattern with some isolates enabling them to be sub-grouped (Table 1). The RAPD patterns of other Colletotrichum spp. are distinct from those of C. gloeosporioides (Fig. 4). Isolate groupings of C. gloeosporioides were generally consistent for all six primers with the exception of variations detected within certain groups by one or two primers. For example, the avocado isolates 918, 1072 and 1152 from New Zealand were grouped together (group lc) by A3, A18, B8 and B10, whereas primers A l l and B6 gave a different pattern with 1152. A similar situation occurred with the papaya isolates from Indonesia (Table 1).

5. DISCUSSION In view of the phytopathogenic importance of the group species C. gloeosporioides and the ex-

tensive morphological variation among its isolates, it is desirable to develop a diagnostic test suitable for rapid and unambiguous detection of the pathogen in infected tissue. It was thought that the required sensitivity could only be achieved by diagnostic PCR rather than by developing species-specific DNA probes. The high copy number ribosomal RNA repeat unit, in particular the variable spacer regions, is an attractive target for generating species-specific primers. The ITS1 region of C. gloeosporioides was found to be 171 bp in length with 58-92% homology to the other Colletotrichum spp. analysed [10]. A hypervariable region was identified for synthesising primer CgInt. When used in PCR, primers CgInt and ITS4 yielded a 450-bp product with all the C. gloeosporioides isolates tested from our collection. No cross-reaction occurred with any other Colletotrichum spp. or other fungi tested, with the exception of C. fragariae and C. kahawae. Both these fungi, however, have been suggested as isolates of C. gloeosporioides using molecular techniques ([6]; S. Sreenivasaprasad, unpub: lished). Successful detection of C. gloeosporioides from infected tomato tissue would indicate that diagnostic PCR tests could be developed for important diseases caused by C. gloeosporioides. Amplification of the C. gloeosporioides-specific product from femtogram quantities of fungal DNA exemplifies the sensitivity of the test, which is of particular importance with low level or quiescent infections. Crude estimates of mycelial quantities based on DNA yields from fungal mycelium suggest that 10 fg of DNA could represent as little as 100 pg of mycelium. RAPD analysis divided the 39 C. gloeosporioides isolates tested into several groups. This is in general agreement with the variation reported following RFLP analysis of the nuclear and mitochondrial DNA of C. gloeosporioides isolates used in this study [4] and isolates from other hosts [3,11,12]. With the exception of the mango isolates, isolates from a single host could be grouped only within a geographical location. Mango isolates, irrespective of their geographic origin, gave a similar RAPD pattern with at least three primers (All, A18 and B10), while

143

primers A3, A18 and B6 yielded limited variation. RFLP analysis of these isolates revealed a low level of variation in mitochondrial DNA but none in rDNA. Either recent introduction of these isolates or less selection pressure have been suggested to explain this lack of variation [4]. All the major fragments amplified by RAPD PCR were reproducible under identical conditions. However, certain primers detected greater variation among a group of isolates by producing relatively different amplification patterns. On the basis of these results, we would suggest that RAPD analysis of a set of fungal isolates should be carried out using at least two primers.

ACKNOWLEDGEMENTS

We thank A.D.K. McReynolds for technical assistance. S.P. thanks the Governments of India and UK for the award of the Nehru Centenary British Post-Doctoral Fellowship administered by the British Council. This work was partially commissioned by Natural Resources Institute, Chatham, as part of its Biological Identification and Variability Programme.

REFERENCES [1] Jeffries, P., Dodd, J.C., Jeger, M.J. and Plumbley, R.A. (1990) Plant Pathol. 39, 343-366. [2] Sutton, B.C. (1992) In: Colletotrichum: Biology, Pathology and Control (Bailey, J.A., Jeger, M.J., Eds.), CAB International, UK. [3] Braithwaite, K.S., Irwin, J.A.G. and Manners, J.M. (1990) Mycol. Res. 94, 1129-Ii137. [4] Hodson, A., Mills, P.R. and Brown, A.E. (1992) Mycol. Res., in press. [5] Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990) Nucleic Acids Res. 18, 6531-6535. [6] Sreenivasaprasad, S., Brown, A.E. and Mills, P.R. (1992) Physiol. Mol. Plant Pathol., in press. [7] Raeder, U. and Broda, P. (1985) Lett. Appl. Microbiol. 1, t7-20. [8] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. [9] White, T.J., Bruns, T., Lee, S. and Taylor, J. (1990) In: PCR Protocols: A Guide to Methods and Applications (Innis, M.A., Gelfand, D.H., Shinsky, J.J., White, T.J., Eds.), pp. 315-322. Academic Press, San Diego, CA. [10] Mills, P.R., Hodson, A. and Brown, A.E. (1992) In: Colletotrichum: Biology, Pathology and Control (Bailey, J.A., Jeger, M.J., Eds.), pp. 269-288 CAB International, UK. Ill] Correll, J.C., Weidemann, G.J., TeBeest, D.O. and Giuerber, J.C. (1991) (Abstract), Phytopathology 81, 1219. [12] Liyanage, H.D., McMillan R.T. Jr. and Kistler, H.C. (1991) (Abstract), Phytopathology 81, 1161.