770
Biomed Environ Sci, 2014; 27(10): 770-778
Original Article Detection and Identification of Six Foodborne Bacteria by Two-tube Multiplex Real Time PCR and Melting Curve Analysis* NIU Pei Hua^, ZHANG Chen^, WANG Ji, TAN Wen Jie#, and MA Xue Jun# Key Laboratory for Medical Virology, Ministry of Health, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing 102206, China
Abstract Objective This study is aimed to develop a two-tube melting curve-based multiplex real time PCR assay (MCMRT-PCR) for the simultaneous detection of six common foodborne pathogenic bacteria (diarrhoeagenic Escherichia coli, Salmonella, and Shigella in tube 1, Staphylococcus aureus, Vibrio parahaemolyticus, and Listeria monocytogenes in tube 2). Methods A two-tube MCMRT-PCR assay was performed on 7900HT Fast Real-Time PCR System (Applied Biosystems, USA). Amplification by PCR was optimized to obtain high efficiency. The sensitivity and specificity of assays were investigated. Results The detection limit of optimized MCMRT-PCR assay was 3.9×102 CFU/mL for S. aureus, 4.4×102 CFU/mL for L. monocytogenes, 3.0×102 CFU/mL for Salmonella, 2.5×102 CFU/mL for Shigella, 2.1×102 CFU/mL for V. parahaemolyticus, and 1.2×102 CFU/mL for E. coli. The feasibility of MCMRT-PCR was further evaluated using artificially contaminated milk, the sensitivity was at the level of 105 CFU/mL. Conclusion A two-tube MCMRT-PCR assay using six primer sets was developed for detection of multiple pathogens. Our findings demonstrates that the proposed two-tube assay is reliable, useful and rapid for simultaneous detection of six foodborne pathogenic bacteria with an intended application in provincial Centers for Diseases Control and Prevention (CDC). Key words: Detection; Real-time PCR; Melting curve; Bacteria Biomed Environ Sci, 2014; 27(10): 770-778
doi: 10.3967/bes2014.112
www.besjournal.com (full text)
CN: 11-2816/Q
INTRODUCTION
F
oodborne disease caused by pathogenic bacteria presents a serious threaten to public health in both developing countries and [1-2] industrialized nations . Staphylococcus aureus (S. aureus), Vibrio parahaemolyticus (V. parahaemolyticus), Listeria monocytogenes (L. monocytogenes), diarrhoeagenic Escherichia coli *
ISSN: 0895-3988
Copyright ©2014 by China CDC
(E. coli), Salmonella, and Shigella are six of the common foodborne pathogenic bacteria[1,3-4]. E. coli has emerged as a serious gastrointestinal pathogen which can cause diarrhoeal diseases in many [5-6] countries . It has been proved that the eaeA gene encodes an outer membrane adhesin (intimin), which mediates intimate attachment to host cell and is essential for establishment of attaching and effacing lesion. It is also involved in pathogenicity. In
This work was supported by the China Mega Project for Infectious Disease (2013ZX10004-001, 2012ZX10004-215, 2013ZX10004-202, and 2013ZX10004804-007). ^NIU Pei Hua and ZHANG Chen contributed equally to the study. # Correspondence should be addressed to MA Xue Jun and TAN Wen Jie, Tel: 86-10-58900810; Fax: 86-10-58900810; E-mail: [email protected], [email protected] Biographical notes of the first authors: NIU Pei Hua, female, born in 1985, MD, majoring in Clinical Laboratory Diagnostics; ZHANG Chen, female, born in 1978, PhD, majoring in molecular biology.
Detection and identification of six foodborne bacteria by MCMRT-PCR assay this study, eaeA is used as target gene in identification of E. coli. Salmonella, one of the most serious pathogens, also can cause serious [7] salmonellosis, both in animals and humans . It is reported that nearly 2000 Salmonella serovars contain the invA gene, which is a virulence gene encoding an invasion protein. Generally, the invA gene has been proven to be Salmonella-specific, which is proved to exist only in Salmonella[8-9]. Shigella is an important source of bacterial diarrhea[10-12]. The invasion plasmid antigen H (ipaH) gene is carried by four Shigella species. It has been considered that the ipaH gene is the main target for detection of Shigella in many researches[13-14]. L. monocytogenes, a gram-positive rod, could cause severe infections including encephalitis, meningitis, and septicemia[15-16]. The hlyA encoding a 58-kDa listerio lysin O, which has been classically regarded as one of the three significant virulence markers, is unique to the species L. monocytogenes[17-19]. V. Parahaemolyticus is a major pathogen of food-borne gastroenteritis in many Asian countries, including Taiwan, China, and Japan[20-22]. The tlh gene (thermolabile hemolysin gene) is a species-specific marker of V. parahaemolyticus[23]. S. aureus is one of the most prevalent causes of gastroenteritis worldwide. Human is common carrier of S. aureus in the nose, throat, and skin infections[3]. S. aureus produces an extracellular thermostablenuclease [thermonuclease (TNase)]. Enzymatic test for TNase production and its encoded gene (nuc gene) are used in many laboratories in identification of S. aureus isolates[24-25]. Molecular detection methods based on DNA analysis, such as PCR[3,26-28], DNA hybridization[29-31], and biochip[1,32] have been applied in detection of food pathogens. Probe-based real time PCR is a method that can simultaneously identify more than one pathogen. The high specificity and accuracy makes it a commonly adopted resolution in food [9,33-34] testing . However, these methods are either time consuming or expensive, which makes them not suitable for less equipped laboratories in developing countries. There is therefore a growing demand for simple and cost-effective molecular tests. Multiplex real time PCR method coupled with melting curve analysis and SYBR green I , the most commonly adopted dye, was used in the detection of multiple genes[35], however, few study of simultaneous detection of foodborne pathogens using this method was reported. Additionally, SYBR
771
green I was reported to inhibit PCR in a concentration-dependent manner[36-37], affect melting temperature (Tm) of PCR products[38], and [39] prefers certain amplicons to others , while DNA-intercalating dye SYTO 9 does not inhibit PCR in a broader range of concentration, and is unbiased among different amplicons[40-41]. This study is aimed to develop a two-tube melting curve-based multiplex real time PCR assay (MCMRT-PCR) method with SYTO to simultaneously detect S. aureus, V. parahaemolyticus, L. monocytogenes, E. coli, Salmonella, and Shigella. The potential application of this method for pathogen detection is also discussed. MATERIALS AND METHODS Bacterial Strains and Culture Media Cultured E. coli, V. parahaemolyticus, S. aureus, L. monocytogenes, Salmonella, and Shigella were used as target bacteria in this study. These bacterial strains were obtained from American Type Culture Collection (ATCC), Chinese Medical Current Content (CMCC), and China Center of Industrial Culture Collection (CICC). E. coli was collected and preserved by Chinese Center for Disease Control and Prevention (Table 1). Enrichment Procedure All bacterial strains were grown for 12 h in LB broth at 37 °C in a Shaking Water Bath (approximately 108 CFU/mL), collected into 2 mL microcentrifuge tubes, and resuspended in 1.5 mL PBS, followed by 10-fold serial dilutions using PBS. These dilutions were used in further sensitivity and quantification tests. For each dilution, 100 μL suspension was plated and incubated at 37 °C for 16 h, followed by counting of colonies. Table 1. Reference Bacteria Strains Used in This Study Taget Bacteria
Strains/Source
diarrhoeagenic Escherichia coli
Escherichia coli O157:H7/ Xuzhou21/EDL933
Salmonella
Salmonella Enteritidis/CMCC50041
Shigella
Shigella flexneri/CMCC51537
Listeria monocytogenes
CMCC54004
Vibrio parahaemolyticus
CICC21617
Staphylococcus aureus
ATCC29213
772
Biomed Environ Sci, 2014; 27(10): 770-778
Genomic DNA Extraction For each dilution mentioned above, 1 mL cell suspension was processed as follows to extract genomic DNA. All bacterial samples were centrifuged at 13,000×g for 15 min. The cell pellets were resuspended in 50 µL of 50 mmol/L NaOH and placed in a 95 °C heating block for 10 min. After the mixtures were cooled at room temperature, 10 µL of 1 mol/L Tris (pH 8.0) was added, followed by centrifuge at 13,000×g for 5 min. The supernatants were used as PCR templates and stored at -20 °C. Primers Specific primers for E. coli, Salmonella, L. monocytogenes and V. parahaemolyticus were previously reported[19,23,42-43] Reference sequences of nuc (region: 894264-894950, numbering based on NC_002758) and ipaH (region: 74821-75075, numbering based on NC_017319) were used to modify and design specific primers for S. aureus and Shigella using Primer Premier 5.0, respectively. The specificities of all the primers were verified by comparison with the GenBank database through BLASTn search. All of the primers were synthesized and HPLC-purified by Sangon Biotech (Shanghai, China) Co., Ltd.. The primer information is listed in Table 2. Multiplex PCR and Melting Curve Analysis A Two-tube MCMRT-PCR assay was developed for the detection of six foodborne pathogens. In each tube, 10 µL reaction system was constructed with 5 µL of 2×Multiplex PCR Master Mix (Qiagen), 1.6 µmol/L SYTO9 green fluorescence dye (Invitrogen,
USA), 0.5 µL each of DNA template, and the following amount of primer pair, 150 nmol/L invA, 250 nmol/L ipaH, and 250 nmol/L eaeA in tube 1, 300 nmol/L each of nuc and hlyA and 100 nmol/L tlh in tube 2. All the reactions were performed on 7900HT Fast Real-Time PCR System (Applied Biosystems, USA). The cycling conditions were one cycle at 95 °C for 10 min, 45 cycles at 95 °C for 15 s, 57 °C for 30 s, 72 °C for 30 s. Dissociation analysis was performed by incubating the reaction at 95 °C for 15 s, annealing at 60 °C for 15 s, followed by increasing the temperature to 95 °C over 20 min. Four replicates were performed for each real-time PCR run and each run was repeated at least twice. Specificity of the Multiplex PCR Assays To evaluate the specificity of the primer pairs for their respective target genes, PCR assays were carried out to test all the strains reported in Table 1 by using the primers in Table 2. Deionized water was included in each PCR assay as a negative control. Determination of Detection Sensitivity and Linear Range of Multiplex Real-time PCR To determine the sensitivity and quantification capability of this test, DNA was extracted from cell pellets quantified by colony counting followed by 10-fold dilution from 108 to 102 CFU/mL and used as templates. The detection sensitivity was determined for each template individually and equally premixed templates in both of the two tubes in a multiple format. For each template, a standard curve was plotted and R2 was calculated to describe the linear range and quantification capability of the test.
Table 2. Primer Pairs Used to Detect Foodborne Bacteria in This Study Taget Bacteria
Target Gene
Primer Sequence (5’-3’)
Tm of PCR Product (°C)
Reference
diarrhoeagenic Escherichia coli
eaeA
AGGTCGTCGTGTCTGCTA CCGTGGTTGCTTGCGTTTG
80.5
[42]
Salmonella
invA
GTGAAATTATCGCCACGTTCGGGCAA TCATCGCACCGTCAAAGGAACC
86.2
[43]
Listeria monocytogenes
hlyA
ATTGCGAAATTTGGTAC CGCCACACTTGAGATAT
81.0
[19]
Vibrio parahaemolyticus
tlh
ACTCAACACAAGAAGAGATCGACAA GATGAGCGGTTGATGTCCAA
84.8
[23]
Staphylococcus aureus
nuc
GCGATTGATGGTGATACGGT ACTTGCTTCAGGACCATA
77.5
Modified
[25]
Shigella
ipaH
TGACAACATTACCCGACTT CGACAATGGATTCCCTGA
78.0
Modified
[13]
Detection and identification of six foodborne bacteria by MCMRT-PCR assay Determination of Detection Sensitivity of Multiplex Real-time PCR in Artificially Contaminated Food Sample Cell pellets quantified by colony counting were 10-fold diluted from 108 to 102 CFU/mL and spiked into milk. DNA extraction from spiked milk followed the protocol of genomic DNA extraction of the pure culture. Sensitivity and linear correlation tests were also performed with spiked milk. RESULTS Specificity of the Primer Sets and Tm of PCR Products Six pairs of real time PCR primers (Table 2) were used to detect the following bacteria respectively: E. coli, Salmonella, L. monocytogenes, V. parahaemolyticus, S. aureus and Shigella targeting genes eaeA, invA, hlyA, tlh, nuc, and ipaH, respectively. Genomic DNA of reference strains listed in Table 1 was used to test the specificity of primers and to determine Tm value of each amplicon. Tm values of PCR products were listed in Table 2. All six pairs of primers successfully amplified the corresponding genes as expected, with dissociation plot of single peak. According to Tm values determined above, the six pairs of primers were divided into two groups to construct a two-tube triplex real time PCR assay, with primers of E. coli, Salmonella, and Shigella in tube 1 and primers for S. aureus, L. monocytogenes and V. parahaemolyticusin tube 2, which can be used to detect and differentiate all six bacteria simultaneously. The negative controls produced no dissociation profile. Sensitivity for Selected Primer Sets Sensitivity of multiplex real time PCR was evaluated with reference strains (as listed in Table 1), which had been quantified using colony counting. Both single pathogen and equally combined mixture of the six quantified pathogens were used in detection limit test, and standard curves were plotted for each single pathogen test. Standard curves generated by plotting the Ct values against log of the CFU/mL were shown in Figure 1. Detection limits of single and multiplex pathogens and correlation coefficient (R2 values) are listed in Table 3, indicating the detection limits of multiple
773
template tests were of no difference with those of single template tests. Figure 2 demonstrated the amplification plots and melting curves of multiple pathogen assays. Detection of Artificially Contaminated Sample To evaluate the validity of the multiplex real time PCR method in detection of pathogens in food products, milk samples artificially contaminated with six food pathogens were tested. As expected, Tm value and dissociation curve detected from spiked food sample were of the same from pure culture (data not shown). Of all the examined target genes in individual real time PCR, the detection limits of artificially contaminated samples were of no difference from those of the pure cultures, the correlation coefficients of spiked samples for each pathogen are slightly lower than those with pure culture (Table 4). However, sensitivity decreased in the testing of mixed pathogens, suggesting that the two-tube MCMRT-PCR assay was able to simultaneously detect six food pathogens in the artificially contaminated milk when six pathogens are present at the level of 105 CFU/mL (Table 4). DISCUSSION Rapid and accurate methods for simultaneous identification of foodborne pathogens are becoming increasingly important[1,3,44]. In previous study, real time PCR methods have been used for the detection and quantification of target organisms with TaqMan probes or molecular beacons to generate a fluorescent signal. With this method, E. coli[45], Salmonella, Shigella[46], V. parahaemolyticus[23], S. aureus[47], and L. monocytogenes[29,48] were successfully detected from food products. To detect more than one target gene at the same time, the method would be at a high cost. High-resolution melting (HRM) analysis is another very effective method for genotyping and mutation scanning[49-50], however the high cost of HRM equipment limits its wide use. A potentially cheaper alternative to HRM is to follow real-time PCR by melting curve analysis (MCA) which can be performed on the conventional real-time PCR equipment already available in most laboratories in local CDCs of China. MCA provides a much faster and cheaper alternative to gel electrophoresis and sequencing, and greatly decreases chances of contamination[42]. Generally, MCA only adds up to 30 min compared to Taqman probe-based assays,
774
Biomed Environ Sci, 2014; 27(10): 770-778
Figure 1. Standard curves generated by plotting the Ct values against log of the CFU/mL of six single pure cultures (A-F) and spiked milk (a-f) by real time PCR and formulas for linear regression of the data. A/(a), diarrhoeagenic Escherichia coli Y=-2.37x+34.01/ Y=-2.89x+37.40; B/(b), Salmonella Y=-3.82x+ 37.78/ Y=-2.99x+33.83; C/(c), Shigella Y=-3.66x+40.40/ Y=-2.68x+33.94; D/(d), Listeria monocytogenes Y=-3.23x+37.40/ Y=-2.67x+32.75; E/(e), Vibrio parahaemolyticus Y=-2.89x+33.09/ Y=-2.67x+41.78; F/(f), Staphylococcus aureus Y=-3.03x+38.83/ Y=-3.30x+41.64. Table 3. Sensitivity and Linear Correlation of Two-tube Multiplex Real-time PCR Test with Pure Culture Target Pathogen
Detection Limit (CFU/mL) Single pathogen
Mixed pathogen
R
2
1.2×10
2
1.2×10
2
Salmonella
3.0×10
2
3.0×10
2
0.998
Shigella
2.5×10
2
2.5×10
2
0.994
Listeria monocytogenes
4.4×10
2
4.4×10
2
0.990
Vibrio parahaemolyticus
2.1×10
2
2.1×10
2
0.990
Staphylococcus aureus
3.9×10
2
3.9×10
2
0.995
diarrhoeagenic Escherichia coli
0.997
Detection and identification of six foodborne bacteria by MCMRT-PCR assay but greatly improves adaptability and reduces cost, since it omits the need of probe designing and requires only the conventional fluorescence channel, which is equipped in all of the real-time PCR machines. In the present study, a MCMRT-PCR assay was developed to simultaneously detect E. coli, Salmonella, Shigella, L. monocytogenes, V. parahaemolyticus, and S. aureus. The eaeA
775
(intimin-encoding gene), invA (invasion protein A gene) and ipaH (invasion plasmid antigen H gene) were targeted to allow simultaneous detection of E. coli, Salmonella and Shigella in tube 1. hlyA (listeriolysin O gene), tlh (thermolabilehemolysin gene) and nuc (heat stable nuclease gene) genes were targeted for simultaneous detection of L. monocytogenes, V. Parahaemolyticus, and S. aureus in tube 2.
Figure 2. Multiplex real-time PCR amplification for simultaneous detection of six foodborne pathogens in quadruplicate. (A) amplification plots in tube 1, of 10-fold serial mixed dilution of diarrhoeagenic 2 7 Escherichia coli, Salmonella, and Shigella. a-f, 10 to 10 CFU/mL; g, negative control. (B) dissociation plots obtained from (A). a, ipaH of Shigella; b, eaeA of Escherichia coli; c, invA of Salmonella; d, negative control. (C) amplification plots in tube 2, of 10-fold serial mixed dilution of Staphylococcus aureus, Listeria monocytogenes and Vibrio parahaemolyticus. a-f, 102 to 107 CFU/mL; g, negative control. (D) dissociation plots obtained from; (C) a, nuc of Staphylococcus aureus; b, hlyA of Listeria monocytogenes; c, tlh of Vibrio parahaemolyticus; d, negative control. Table 4. Sensitivity and Correlation of Two-tube Multiplex Real-time PCR Test with Artificially Spiked Milk Target Pathogen diarrhoeagenic Escherichia coli Salmonella Shigella Listeria monocytogenes Vibrio parahaemolyticus Staphylococcus aureus
Detection Limit (CFU/mL) Single pathogen Mixed pathogen 2 5 1.2×10 1.2×10 2 5 3.0×10 3.0×10 2 5 2.5×10 2.5×10 2 5 4.4×10 4.4×10 2 5 2.1×10 2.1×10 2 5 3.9×10 3.9×10
R
2
0.987 0.995 0.981 0.973 0.979 0.981
776 Specificity of the primers is a key part of the process, eaeA, invA, ipaH, hlyA, tlh, and nuc genes were adopted for detection of E. coli, Salmonella, Shigella, L. monocytogenes, V. Parahaemolyticus, and S. aureu, srespectively. To achieve the highest amplification efficiency, concentrations of all primer sets were adjusted. Amplicon Tm value is another factor that has to be taken into account. In this system, the Tm value of all amplicons ranged from 77.5-86.2 °C, making it possible to separate the six target genes in two tubes. In addition, a simple and rapid alkaline lysis method was used to extract bacterial DNA from the food samples. When MCMRT-PCR was applied to the pure cultures of the six pathogens, the detection limit was 3.9×102 CFU/mL for S. aureus, 4.4×102 CFU/mL for L. monocytogenes, 3.0×102 CFU/mL for Salmonella, 2.5×102 CFU/mL for Shigella, 2.1×102 CFU/mL for V. parahaemolyticus, 1.2×102 CFU/mL for E. coli, with correlation coefficient (R2) all above 0.99 with a dynamic range from 102 to 108. The application of this method in artificially contaminated samples was also tested. Although the real-time method performed well with mixtures of pure cultures, as well as in single pathogen challenged milk, both sensitivity and efficiency decreased when applied to multiple pathogens spiked milk. The presence of various food constituents, such as fats, glycogen, organic and phenolic compounds, may have influenced the amplification of DNA in the PCR. A major limitation of this study for the simultaneous detection of six important foodborne pathogenic bacteria is that the specificities of the targeted gene and the primer for each pathogen was not thoroughly investigated using species closely related to target organisms due to limited availability of bacterial strains in our laboratory. However, all of the six targeted genes in this study were [8-9,23,51] well-documented previously , and accordingly four pairs of specific primers for V. parahaemolyticus, L. monocytogenes, E. coli, Salmonella were cited in this study, the published primers for S. aureus and Shigella[13,24] were slightly modified in this study to meet the requirement of MCA. Nevertheless, given the main purpose of this study is to develop an improved multiple real time PCR method (probe-free), the grouping of six reported primer pairs into two tubes under the proposed optimized working condition does work functionally as evidenced by the sensitivity and quantification results obtained from this study using pure cultures.
Biomed Environ Sci, 2014; 27(10): 770-778 Another limitation of this study is that the DNA extraction method based on alkaline lysis and isopropanol precipitation remains a hindrance in high throughput application, particularly due to its poor performance in the DNA enrichment of Gram-positive strains (S. aureus, L. monocytogenes). As our current preliminary study has showed the MasterPure Complete DNA purification kit (Epicenter Technologies, Madison, WI) worked well for the DNA extraction form both Gram-positive and negative strains (data not shown), this kit will be tested to refine the DNA extraction method. The MCMRT-PCR assay is a simple, rapid and efficient technique. Further evaluation of this proposed assay with a large number of representative strains and contaminated milk is needed before this method can potentially be optimized for use with other food products. The optimized MCMRT-PCR assay will improve the accessibility to track food-contaminated outbreaks for minimally equipped laboratories in local CDCs, reducing the risks of infection from the food and helping researchers formulate effective surveillance systems that meet public health goals and safety objectives implemented by risk-informed policy. Received: November 6, 2013; Accepted: March 19, 2014
REFERENCES 1. Chiang YC, Tsen HY, Chen HY, et al. Multiplex PCR and a chromogenic DNA macroarray for the detection of Listeria monocytogens, Staphylococcus aureus, Streptococcus agalactiae, Enterobacter sakazakii, Escherichia coli O157:H7, Vibrio parahaemolyticus, Salmonella spp. and Pseudomonas fluorescens in milk and meat samples. J Microbiol Methods, 2012; 88, 110-6. 2. Alizadeh AH, Behrouz N, Salmanzadeh S, et al. Escherichia coli, Shigella and Salmonella species in acute diarrhoea in Hamedan, Islamic Republic of Iran. East Mediterr Health J, 2007; 13, 243-9. 3. Zarei M, Maktabi S, Ghorbanpour M. Prevalence of Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Salmonella spp. in seafood products using multiplex polymerase chain reaction. Foodborne Pathog Dis, 2012; 9, 108-12. 4. Park YS, Lee SR, Kim YG. Detection of Escherichia coli O157:H7, Salmonella spp., Staphylococcus aureus and Listeria monocytogenes in kimchi by multiplex polymerase chain reaction (mPCR). J Microbiol, 2006; 44, 92-7. 5. Centers for Disease control and Prevention. Outbreaks of Escherichia coli O157:H7 infections among children associated with farm visits-Pennsylvania and Washington, 2000. MMWR Morb Mortal Wkly Rep, 2001; 50, 293-7. 6. Paton JC, Paton AW. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin Microbiol Rev, 1998; 11, 450-79.
Detection and identification of six foodborne bacteria by MCMRT-PCR assay 7. Mead PS, Slutsker L, Dietz V, et al. Food-related illness and death in the United States. Emerging infectious diseases, 1999; 5, 607-25. 8. D'Souza DH, Critzer FJ, Golden DA. Real-time reverse-transcriptase polymerase chain reaction for the rapid detection of Salmonella using invA primers. Foodborne Pathog Dis, 2009; 6, 1097-106. 9. Suo B, He Y, Tu SI, et al. A multiplex real-time polymerase chain reaction for simultaneous detection of Salmonella spp., Escherichia coli O157, and Listeria monocytogenes in meat products. Foodborne Pathog Dis, 2010; 7, 619-28. 10.Kotloff KL, Winickoff JP, Ivanoff B, et al. Global burden of Shigella infections: implications for vaccine development and implementation of control strategies. Bull World Health Organ, 1999; 77, 651-66. 11. Schrijver K De, Bertrand S, Gutierrez Garitano I, et al. Outbreak of Shigella sonnei infections in the Orthodox Jewish community of Antwerp, Belgium, April to August 2008. Euro Surveill, 2011; 16. 12. Xia S, Xu B, Huang L, et al. Prevalence and characterization of human Shigella infections in Henan Province, China, in 2006. J Clin Microbiol, 2011; 49, 232-42. 13. Vu DT, Sethabutr O, Seidlein L Von, et al. Detection of Shigella by a PCR assay targeting the ipaH gene suggests increased prevalence of shigellosis in Nha Trang, Vietnam. J Clin Microbiol, 2004; 42, 2031-5. 14. Shao Y, Zhu S, Jin C, et al. Development of multiplex loop-mediated isothermal amplification-RFLP (mLAMP-RFLP) to detect Salmonella spp. and Shigella spp. in milk. Int J Food Microbiol, 2011; 148, 75-9. 15. Liu D. Identification, subtyping and virulence determination of Listeria monocytogenes, an important foodborne pathogen. J Med Microbiol, 2006; 55, 645-59. 16. Liu D, Ainsworth AJ, FW Austin, et al. Characterization of virulent and avirulent Listeria monocytogenes strains by PCR amplification of putative transcriptional regulator and internalin genes. J Med Microbiol, 2003; 52, 1065-70. 17.Jung HJ, Park SH, Ha SD, et al. Species-specific detection of Listeria monocytogenes using polymerase chain reaction assays targeting the prfA virulence gene cluster. Biosci Biotechnol Biochem, 2009; 73, 1412-5. 18. Deneer HG, Boychuk I. Species-specific detection of Listeria monocytogenes by DNA amplification. Appl Environ Microbiol, 1991; 57, 606-9. 19. Thomas EJ, King RK, Burchak J, et al. Sensitive and specific detection of Listeria monocytogenes in milk and ground beef with the polymerase chain reaction. Appl Environ Microbiol, 1991; 57, 2576-80. 20.Arakawa E, Murase T, Shimada T, et al. Emergence and prevalence of a novel Vibrio parahaemolyticus O3:K6 clone in Japan. Jpn J Infect Dis, 1999; 52, 246-7. 21. Su YC, Liu C. Vibrio parahaemolyticus: a concern of seafood safety. Food Microbiol, 2007; 24, 549-58. 22. Pan TM, Wang TK, CL Lee, et al. Food-borne disease outbreaks due to bacteria in Taiwan, 1986 to 1995. J Clin Microbiol, 1997; 35, 1260-2. 23. Nordstrom JL, Vickery MC, Blackstone GM, et al. Development of a multiplex real-time PCR assay with an internal amplification control for the detection of total and pathogenic Vibrio parahaemolyticus bacteria in oysters. Appl Environ Microbiol, 2007; 73, 5840-7. 24.Lachica RV, Genigeorgis C, Hoeprich PD. Metachromatic agar-diffusion methods for detecting staphylococcal nuclease activity. Appl Microbiol, 1971; 21, 585-7. 25. Brakstad OG, Aasbakk K, Maeland JA. Detection of Staphylococcus aureus by polymerase chain reaction
777
amplification of the nuc gene. J Clin Microbiol, 1992; 30, 1654-60. 26. Li Y, Mustapha A. Simultaneous detection of Escherichia coli O157:H7, Salmonella, and Shigella in apple cider and produce by a multiplex PCR. J Food Prot, 2004; 67, 27-33. 27. Li Y, Zhuang S, Mustapha A. Application of a multiplex PCR for the simultaneous detection of Escherichia coli O157:H7, Salmonella and Shigella in raw and ready-to-eat meat products. Meat Sci, 2005; 71, 402-6. 28.Bonetta S, Borelli E, Bonetta S, et al. Development of a PCR protocol for the detection of Escherichia coli O157:H7 and Salmonella spp. in surface water. Environ Monit Assess, 2011; 177, 493-503. 29. Bhagwat AA. Simultaneous detection of Escherichia coli O157:H7, Listeria monocytogenes and Salmonella strains by real-time PCR. Int J Food Microbiol, 2003; 84, 217-24. 30. Anklam KS, Kanankege KS, Gonzales TK, et al. Rapid and reliable detection of Shiga toxin-producing Escherichia coli by real-time multiplex PCR. J Food Prot, 2012; 75, 643-50. 31. Kagkli DM, Weber TP, Bulcke M Van den, et al. Application of the modular approach to an in-house validation study of real-time PCR methods for the detection and serogroup determination of verocytotoxigenic Escherichia coli. Appl Environ Microbiol, 2011; 77, 6954-63. 32. Warsen AE, Krug MJ, LaFrentz S, et al. Simultaneous discrimination between 15 fish pathogens by using 16S ribosomal DNA PCR and DNA microarrays. Appl Environ Microbiol, 2004; 70, 4216-21. 33.Lungu B, Waltman WD, Berghaus RD, et al. Comparison of a real-time PCR method with a culture method for the detection of Salmonella enterica serotype enteritidis in naturally contaminated environmental samples from integrated poultry houses. J Food Prot, 2012; 75, 743-7. 34. Huang Q, Hu Q, Li Q. Identification of 8 foodborne pathogens by multicolor combinational probe coding technology in a single real-time PCR. Clin Chem, 2007; 53, 1741-8. 35.Rajtak U, Leonard N, Bolton D, et al. A real-time multiplex SYBR Green I polymerase chain reaction assay for rapid screening of salmonella serotypes prevalent in the European Union. Foodborne Pathog Dis, 2011; 8, 769-80 36. Karsai A, Muller S, Platz S, et al. Evaluation of a homemade SYBR green I reaction mixture for real-time PCR quantification of gene expression. Biotechniques, 2002; 32, 790-2, 794-6. 37. Nath K, Sarosy JW, Hahn J, et al. Effects of ethidium bromide and SYBR Green I on different polymerase chain reaction systems. J Biochem Biophys Methods, 2000; 42, 15-29. 38. Ririe KM, Rasmussen RP, Wittwer CT. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Anal Biochem, 1997; 245, 154-60. 39. Giglio S, Monis PT, Saint CP. Demonstration of preferential binding of SYBR Green I to specific DNA fragments in real-time multiplex PCR. Nucleic Acids Res, 2003; 31, e136. 40. Gudnason H, Dufva M, Bang DD, et al. Comparison of multiple DNA dyes for real-time PCR: effects of dye concentration and sequence composition on DNA amplification and melting temperature. Nucleic Acids Res, 2007; 35, e127. 41. Monis PT, Giglio S, Saint CP. Comparison of SYTO9 and SYBR Green I for real-time polymerase chain reaction and investigation of the effect of dye concentration on amplification and DNA melting curve analysis. Anal Biochem, 2005; 340, 24-34. 42. Chen J, Tang J, Liu J, et al. Development and evaluation of a multiplex PCR for simultaneous detection of five foodborne pathogens. J Appl Microbiol, 2012; 112, 823-30. 43.Malorny B, Hoorfar J, Bunge C, et al. Multicenter validation of the analytical accuracy of Salmonella PCR: towards an
778 international standard. Appl Environ Microbiol, 2003; 69, 290-6. 44. Kim JS, Lee GG, Park JS, et al. A novel multiplex PCR assay for rapid and simultaneous detection of five pathogenic bacteria: Escherichia coli O157:H7, Salmonella, Staphylococcus aureus, Listeria monocytogenes, and Vibrio parahaemolyticus. J Food Prot, 2007; 70, 1656-62. 45. Miszczycha SD, Ganet S, Duniere L, et al. Novel real-time PCR method to detect Escherichia coli O157:H7 in raw milk cheese and raw ground meat. J Food Prot, 2012; 75, 1373-81. 46. Wang L, Li Y, A Mustaphai. Rapid and simultaneous quantitation of Escherichia coli 0157:H7, Salmonella, and Shigella in ground beef by multiplex real-time PCR and immunomagnetic separation. J Food Prot, 2007; 70, 1366-72. 47. Goto M, Takahashi H, Segawa Y, et al. Real-time PCR method for quantification of Staphylococcus aureus in milk. J Food Prot,
Biomed Environ Sci, 2014; 27(10): 770-778 2007; 70, 90-6. 48. OG J, Sedano-Balbas S, Maher M, et al. Rapid real-time PCR detection of Listeria monocytogenes in enriched food samples based on the ssrA gene, a novel diagnostic target. Food Microbiol, 2008; 25, 75-84. 49.Gori A, Cerboneschi M, Tegli S. High-resolution melting analysis as a powerful tool to discriminate and genotype Pseudomonas savastanoi pathovars and strains. PLoS One, 2012; 7, e30199. 50.Hsiao CC, Chang J, Wu JY, et al. High-resolution melting and real-time PCR for quantification and detection of drug-resistant HBV mutants in a single amplicon. Antivir Ther, 2012; 17, 291-303. 51.Critzer FJ, Dsouza DH, Golden DA. Transcription analysis of stx1, marA, and eaeA genes in Escherichia coli O157:H7 treated with sodium benzoate. J Food Prot, 2008; 71, 1469-74.
Biomed Environ Sci, 2014; 27(10): 770-778
Original Article Detection and Identification of Six Foodborne Bacteria by Two-tube Multiplex Real Time PCR and Melting Curve Analysis* NIU Pei Hua^, ZHANG Chen^, WANG Ji, TAN Wen Jie#, and MA Xue Jun# Key Laboratory for Medical Virology, Ministry of Health, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing 102206, China
Abstract Objective This study is aimed to develop a two-tube melting curve-based multiplex real time PCR assay (MCMRT-PCR) for the simultaneous detection of six common foodborne pathogenic bacteria (diarrhoeagenic Escherichia coli, Salmonella, and Shigella in tube 1, Staphylococcus aureus, Vibrio parahaemolyticus, and Listeria monocytogenes in tube 2). Methods A two-tube MCMRT-PCR assay was performed on 7900HT Fast Real-Time PCR System (Applied Biosystems, USA). Amplification by PCR was optimized to obtain high efficiency. The sensitivity and specificity of assays were investigated. Results The detection limit of optimized MCMRT-PCR assay was 3.9×102 CFU/mL for S. aureus, 4.4×102 CFU/mL for L. monocytogenes, 3.0×102 CFU/mL for Salmonella, 2.5×102 CFU/mL for Shigella, 2.1×102 CFU/mL for V. parahaemolyticus, and 1.2×102 CFU/mL for E. coli. The feasibility of MCMRT-PCR was further evaluated using artificially contaminated milk, the sensitivity was at the level of 105 CFU/mL. Conclusion A two-tube MCMRT-PCR assay using six primer sets was developed for detection of multiple pathogens. Our findings demonstrates that the proposed two-tube assay is reliable, useful and rapid for simultaneous detection of six foodborne pathogenic bacteria with an intended application in provincial Centers for Diseases Control and Prevention (CDC). Key words: Detection; Real-time PCR; Melting curve; Bacteria Biomed Environ Sci, 2014; 27(10): 770-778
doi: 10.3967/bes2014.112
www.besjournal.com (full text)
CN: 11-2816/Q
INTRODUCTION
F
oodborne disease caused by pathogenic bacteria presents a serious threaten to public health in both developing countries and [1-2] industrialized nations . Staphylococcus aureus (S. aureus), Vibrio parahaemolyticus (V. parahaemolyticus), Listeria monocytogenes (L. monocytogenes), diarrhoeagenic Escherichia coli *
ISSN: 0895-3988
Copyright ©2014 by China CDC
(E. coli), Salmonella, and Shigella are six of the common foodborne pathogenic bacteria[1,3-4]. E. coli has emerged as a serious gastrointestinal pathogen which can cause diarrhoeal diseases in many [5-6] countries . It has been proved that the eaeA gene encodes an outer membrane adhesin (intimin), which mediates intimate attachment to host cell and is essential for establishment of attaching and effacing lesion. It is also involved in pathogenicity. In
This work was supported by the China Mega Project for Infectious Disease (2013ZX10004-001, 2012ZX10004-215, 2013ZX10004-202, and 2013ZX10004804-007). ^NIU Pei Hua and ZHANG Chen contributed equally to the study. # Correspondence should be addressed to MA Xue Jun and TAN Wen Jie, Tel: 86-10-58900810; Fax: 86-10-58900810; E-mail: [email protected], [email protected] Biographical notes of the first authors: NIU Pei Hua, female, born in 1985, MD, majoring in Clinical Laboratory Diagnostics; ZHANG Chen, female, born in 1978, PhD, majoring in molecular biology.
Detection and identification of six foodborne bacteria by MCMRT-PCR assay this study, eaeA is used as target gene in identification of E. coli. Salmonella, one of the most serious pathogens, also can cause serious [7] salmonellosis, both in animals and humans . It is reported that nearly 2000 Salmonella serovars contain the invA gene, which is a virulence gene encoding an invasion protein. Generally, the invA gene has been proven to be Salmonella-specific, which is proved to exist only in Salmonella[8-9]. Shigella is an important source of bacterial diarrhea[10-12]. The invasion plasmid antigen H (ipaH) gene is carried by four Shigella species. It has been considered that the ipaH gene is the main target for detection of Shigella in many researches[13-14]. L. monocytogenes, a gram-positive rod, could cause severe infections including encephalitis, meningitis, and septicemia[15-16]. The hlyA encoding a 58-kDa listerio lysin O, which has been classically regarded as one of the three significant virulence markers, is unique to the species L. monocytogenes[17-19]. V. Parahaemolyticus is a major pathogen of food-borne gastroenteritis in many Asian countries, including Taiwan, China, and Japan[20-22]. The tlh gene (thermolabile hemolysin gene) is a species-specific marker of V. parahaemolyticus[23]. S. aureus is one of the most prevalent causes of gastroenteritis worldwide. Human is common carrier of S. aureus in the nose, throat, and skin infections[3]. S. aureus produces an extracellular thermostablenuclease [thermonuclease (TNase)]. Enzymatic test for TNase production and its encoded gene (nuc gene) are used in many laboratories in identification of S. aureus isolates[24-25]. Molecular detection methods based on DNA analysis, such as PCR[3,26-28], DNA hybridization[29-31], and biochip[1,32] have been applied in detection of food pathogens. Probe-based real time PCR is a method that can simultaneously identify more than one pathogen. The high specificity and accuracy makes it a commonly adopted resolution in food [9,33-34] testing . However, these methods are either time consuming or expensive, which makes them not suitable for less equipped laboratories in developing countries. There is therefore a growing demand for simple and cost-effective molecular tests. Multiplex real time PCR method coupled with melting curve analysis and SYBR green I , the most commonly adopted dye, was used in the detection of multiple genes[35], however, few study of simultaneous detection of foodborne pathogens using this method was reported. Additionally, SYBR
771
green I was reported to inhibit PCR in a concentration-dependent manner[36-37], affect melting temperature (Tm) of PCR products[38], and [39] prefers certain amplicons to others , while DNA-intercalating dye SYTO 9 does not inhibit PCR in a broader range of concentration, and is unbiased among different amplicons[40-41]. This study is aimed to develop a two-tube melting curve-based multiplex real time PCR assay (MCMRT-PCR) method with SYTO to simultaneously detect S. aureus, V. parahaemolyticus, L. monocytogenes, E. coli, Salmonella, and Shigella. The potential application of this method for pathogen detection is also discussed. MATERIALS AND METHODS Bacterial Strains and Culture Media Cultured E. coli, V. parahaemolyticus, S. aureus, L. monocytogenes, Salmonella, and Shigella were used as target bacteria in this study. These bacterial strains were obtained from American Type Culture Collection (ATCC), Chinese Medical Current Content (CMCC), and China Center of Industrial Culture Collection (CICC). E. coli was collected and preserved by Chinese Center for Disease Control and Prevention (Table 1). Enrichment Procedure All bacterial strains were grown for 12 h in LB broth at 37 °C in a Shaking Water Bath (approximately 108 CFU/mL), collected into 2 mL microcentrifuge tubes, and resuspended in 1.5 mL PBS, followed by 10-fold serial dilutions using PBS. These dilutions were used in further sensitivity and quantification tests. For each dilution, 100 μL suspension was plated and incubated at 37 °C for 16 h, followed by counting of colonies. Table 1. Reference Bacteria Strains Used in This Study Taget Bacteria
Strains/Source
diarrhoeagenic Escherichia coli
Escherichia coli O157:H7/ Xuzhou21/EDL933
Salmonella
Salmonella Enteritidis/CMCC50041
Shigella
Shigella flexneri/CMCC51537
Listeria monocytogenes
CMCC54004
Vibrio parahaemolyticus
CICC21617
Staphylococcus aureus
ATCC29213
772
Biomed Environ Sci, 2014; 27(10): 770-778
Genomic DNA Extraction For each dilution mentioned above, 1 mL cell suspension was processed as follows to extract genomic DNA. All bacterial samples were centrifuged at 13,000×g for 15 min. The cell pellets were resuspended in 50 µL of 50 mmol/L NaOH and placed in a 95 °C heating block for 10 min. After the mixtures were cooled at room temperature, 10 µL of 1 mol/L Tris (pH 8.0) was added, followed by centrifuge at 13,000×g for 5 min. The supernatants were used as PCR templates and stored at -20 °C. Primers Specific primers for E. coli, Salmonella, L. monocytogenes and V. parahaemolyticus were previously reported[19,23,42-43] Reference sequences of nuc (region: 894264-894950, numbering based on NC_002758) and ipaH (region: 74821-75075, numbering based on NC_017319) were used to modify and design specific primers for S. aureus and Shigella using Primer Premier 5.0, respectively. The specificities of all the primers were verified by comparison with the GenBank database through BLASTn search. All of the primers were synthesized and HPLC-purified by Sangon Biotech (Shanghai, China) Co., Ltd.. The primer information is listed in Table 2. Multiplex PCR and Melting Curve Analysis A Two-tube MCMRT-PCR assay was developed for the detection of six foodborne pathogens. In each tube, 10 µL reaction system was constructed with 5 µL of 2×Multiplex PCR Master Mix (Qiagen), 1.6 µmol/L SYTO9 green fluorescence dye (Invitrogen,
USA), 0.5 µL each of DNA template, and the following amount of primer pair, 150 nmol/L invA, 250 nmol/L ipaH, and 250 nmol/L eaeA in tube 1, 300 nmol/L each of nuc and hlyA and 100 nmol/L tlh in tube 2. All the reactions were performed on 7900HT Fast Real-Time PCR System (Applied Biosystems, USA). The cycling conditions were one cycle at 95 °C for 10 min, 45 cycles at 95 °C for 15 s, 57 °C for 30 s, 72 °C for 30 s. Dissociation analysis was performed by incubating the reaction at 95 °C for 15 s, annealing at 60 °C for 15 s, followed by increasing the temperature to 95 °C over 20 min. Four replicates were performed for each real-time PCR run and each run was repeated at least twice. Specificity of the Multiplex PCR Assays To evaluate the specificity of the primer pairs for their respective target genes, PCR assays were carried out to test all the strains reported in Table 1 by using the primers in Table 2. Deionized water was included in each PCR assay as a negative control. Determination of Detection Sensitivity and Linear Range of Multiplex Real-time PCR To determine the sensitivity and quantification capability of this test, DNA was extracted from cell pellets quantified by colony counting followed by 10-fold dilution from 108 to 102 CFU/mL and used as templates. The detection sensitivity was determined for each template individually and equally premixed templates in both of the two tubes in a multiple format. For each template, a standard curve was plotted and R2 was calculated to describe the linear range and quantification capability of the test.
Table 2. Primer Pairs Used to Detect Foodborne Bacteria in This Study Taget Bacteria
Target Gene
Primer Sequence (5’-3’)
Tm of PCR Product (°C)
Reference
diarrhoeagenic Escherichia coli
eaeA
AGGTCGTCGTGTCTGCTA CCGTGGTTGCTTGCGTTTG
80.5
[42]
Salmonella
invA
GTGAAATTATCGCCACGTTCGGGCAA TCATCGCACCGTCAAAGGAACC
86.2
[43]
Listeria monocytogenes
hlyA
ATTGCGAAATTTGGTAC CGCCACACTTGAGATAT
81.0
[19]
Vibrio parahaemolyticus
tlh
ACTCAACACAAGAAGAGATCGACAA GATGAGCGGTTGATGTCCAA
84.8
[23]
Staphylococcus aureus
nuc
GCGATTGATGGTGATACGGT ACTTGCTTCAGGACCATA
77.5
Modified
[25]
Shigella
ipaH
TGACAACATTACCCGACTT CGACAATGGATTCCCTGA
78.0
Modified
[13]
Detection and identification of six foodborne bacteria by MCMRT-PCR assay Determination of Detection Sensitivity of Multiplex Real-time PCR in Artificially Contaminated Food Sample Cell pellets quantified by colony counting were 10-fold diluted from 108 to 102 CFU/mL and spiked into milk. DNA extraction from spiked milk followed the protocol of genomic DNA extraction of the pure culture. Sensitivity and linear correlation tests were also performed with spiked milk. RESULTS Specificity of the Primer Sets and Tm of PCR Products Six pairs of real time PCR primers (Table 2) were used to detect the following bacteria respectively: E. coli, Salmonella, L. monocytogenes, V. parahaemolyticus, S. aureus and Shigella targeting genes eaeA, invA, hlyA, tlh, nuc, and ipaH, respectively. Genomic DNA of reference strains listed in Table 1 was used to test the specificity of primers and to determine Tm value of each amplicon. Tm values of PCR products were listed in Table 2. All six pairs of primers successfully amplified the corresponding genes as expected, with dissociation plot of single peak. According to Tm values determined above, the six pairs of primers were divided into two groups to construct a two-tube triplex real time PCR assay, with primers of E. coli, Salmonella, and Shigella in tube 1 and primers for S. aureus, L. monocytogenes and V. parahaemolyticusin tube 2, which can be used to detect and differentiate all six bacteria simultaneously. The negative controls produced no dissociation profile. Sensitivity for Selected Primer Sets Sensitivity of multiplex real time PCR was evaluated with reference strains (as listed in Table 1), which had been quantified using colony counting. Both single pathogen and equally combined mixture of the six quantified pathogens were used in detection limit test, and standard curves were plotted for each single pathogen test. Standard curves generated by plotting the Ct values against log of the CFU/mL were shown in Figure 1. Detection limits of single and multiplex pathogens and correlation coefficient (R2 values) are listed in Table 3, indicating the detection limits of multiple
773
template tests were of no difference with those of single template tests. Figure 2 demonstrated the amplification plots and melting curves of multiple pathogen assays. Detection of Artificially Contaminated Sample To evaluate the validity of the multiplex real time PCR method in detection of pathogens in food products, milk samples artificially contaminated with six food pathogens were tested. As expected, Tm value and dissociation curve detected from spiked food sample were of the same from pure culture (data not shown). Of all the examined target genes in individual real time PCR, the detection limits of artificially contaminated samples were of no difference from those of the pure cultures, the correlation coefficients of spiked samples for each pathogen are slightly lower than those with pure culture (Table 4). However, sensitivity decreased in the testing of mixed pathogens, suggesting that the two-tube MCMRT-PCR assay was able to simultaneously detect six food pathogens in the artificially contaminated milk when six pathogens are present at the level of 105 CFU/mL (Table 4). DISCUSSION Rapid and accurate methods for simultaneous identification of foodborne pathogens are becoming increasingly important[1,3,44]. In previous study, real time PCR methods have been used for the detection and quantification of target organisms with TaqMan probes or molecular beacons to generate a fluorescent signal. With this method, E. coli[45], Salmonella, Shigella[46], V. parahaemolyticus[23], S. aureus[47], and L. monocytogenes[29,48] were successfully detected from food products. To detect more than one target gene at the same time, the method would be at a high cost. High-resolution melting (HRM) analysis is another very effective method for genotyping and mutation scanning[49-50], however the high cost of HRM equipment limits its wide use. A potentially cheaper alternative to HRM is to follow real-time PCR by melting curve analysis (MCA) which can be performed on the conventional real-time PCR equipment already available in most laboratories in local CDCs of China. MCA provides a much faster and cheaper alternative to gel electrophoresis and sequencing, and greatly decreases chances of contamination[42]. Generally, MCA only adds up to 30 min compared to Taqman probe-based assays,
774
Biomed Environ Sci, 2014; 27(10): 770-778
Figure 1. Standard curves generated by plotting the Ct values against log of the CFU/mL of six single pure cultures (A-F) and spiked milk (a-f) by real time PCR and formulas for linear regression of the data. A/(a), diarrhoeagenic Escherichia coli Y=-2.37x+34.01/ Y=-2.89x+37.40; B/(b), Salmonella Y=-3.82x+ 37.78/ Y=-2.99x+33.83; C/(c), Shigella Y=-3.66x+40.40/ Y=-2.68x+33.94; D/(d), Listeria monocytogenes Y=-3.23x+37.40/ Y=-2.67x+32.75; E/(e), Vibrio parahaemolyticus Y=-2.89x+33.09/ Y=-2.67x+41.78; F/(f), Staphylococcus aureus Y=-3.03x+38.83/ Y=-3.30x+41.64. Table 3. Sensitivity and Linear Correlation of Two-tube Multiplex Real-time PCR Test with Pure Culture Target Pathogen
Detection Limit (CFU/mL) Single pathogen
Mixed pathogen
R
2
1.2×10
2
1.2×10
2
Salmonella
3.0×10
2
3.0×10
2
0.998
Shigella
2.5×10
2
2.5×10
2
0.994
Listeria monocytogenes
4.4×10
2
4.4×10
2
0.990
Vibrio parahaemolyticus
2.1×10
2
2.1×10
2
0.990
Staphylococcus aureus
3.9×10
2
3.9×10
2
0.995
diarrhoeagenic Escherichia coli
0.997
Detection and identification of six foodborne bacteria by MCMRT-PCR assay but greatly improves adaptability and reduces cost, since it omits the need of probe designing and requires only the conventional fluorescence channel, which is equipped in all of the real-time PCR machines. In the present study, a MCMRT-PCR assay was developed to simultaneously detect E. coli, Salmonella, Shigella, L. monocytogenes, V. parahaemolyticus, and S. aureus. The eaeA
775
(intimin-encoding gene), invA (invasion protein A gene) and ipaH (invasion plasmid antigen H gene) were targeted to allow simultaneous detection of E. coli, Salmonella and Shigella in tube 1. hlyA (listeriolysin O gene), tlh (thermolabilehemolysin gene) and nuc (heat stable nuclease gene) genes were targeted for simultaneous detection of L. monocytogenes, V. Parahaemolyticus, and S. aureus in tube 2.
Figure 2. Multiplex real-time PCR amplification for simultaneous detection of six foodborne pathogens in quadruplicate. (A) amplification plots in tube 1, of 10-fold serial mixed dilution of diarrhoeagenic 2 7 Escherichia coli, Salmonella, and Shigella. a-f, 10 to 10 CFU/mL; g, negative control. (B) dissociation plots obtained from (A). a, ipaH of Shigella; b, eaeA of Escherichia coli; c, invA of Salmonella; d, negative control. (C) amplification plots in tube 2, of 10-fold serial mixed dilution of Staphylococcus aureus, Listeria monocytogenes and Vibrio parahaemolyticus. a-f, 102 to 107 CFU/mL; g, negative control. (D) dissociation plots obtained from; (C) a, nuc of Staphylococcus aureus; b, hlyA of Listeria monocytogenes; c, tlh of Vibrio parahaemolyticus; d, negative control. Table 4. Sensitivity and Correlation of Two-tube Multiplex Real-time PCR Test with Artificially Spiked Milk Target Pathogen diarrhoeagenic Escherichia coli Salmonella Shigella Listeria monocytogenes Vibrio parahaemolyticus Staphylococcus aureus
Detection Limit (CFU/mL) Single pathogen Mixed pathogen 2 5 1.2×10 1.2×10 2 5 3.0×10 3.0×10 2 5 2.5×10 2.5×10 2 5 4.4×10 4.4×10 2 5 2.1×10 2.1×10 2 5 3.9×10 3.9×10
R
2
0.987 0.995 0.981 0.973 0.979 0.981
776 Specificity of the primers is a key part of the process, eaeA, invA, ipaH, hlyA, tlh, and nuc genes were adopted for detection of E. coli, Salmonella, Shigella, L. monocytogenes, V. Parahaemolyticus, and S. aureu, srespectively. To achieve the highest amplification efficiency, concentrations of all primer sets were adjusted. Amplicon Tm value is another factor that has to be taken into account. In this system, the Tm value of all amplicons ranged from 77.5-86.2 °C, making it possible to separate the six target genes in two tubes. In addition, a simple and rapid alkaline lysis method was used to extract bacterial DNA from the food samples. When MCMRT-PCR was applied to the pure cultures of the six pathogens, the detection limit was 3.9×102 CFU/mL for S. aureus, 4.4×102 CFU/mL for L. monocytogenes, 3.0×102 CFU/mL for Salmonella, 2.5×102 CFU/mL for Shigella, 2.1×102 CFU/mL for V. parahaemolyticus, 1.2×102 CFU/mL for E. coli, with correlation coefficient (R2) all above 0.99 with a dynamic range from 102 to 108. The application of this method in artificially contaminated samples was also tested. Although the real-time method performed well with mixtures of pure cultures, as well as in single pathogen challenged milk, both sensitivity and efficiency decreased when applied to multiple pathogens spiked milk. The presence of various food constituents, such as fats, glycogen, organic and phenolic compounds, may have influenced the amplification of DNA in the PCR. A major limitation of this study for the simultaneous detection of six important foodborne pathogenic bacteria is that the specificities of the targeted gene and the primer for each pathogen was not thoroughly investigated using species closely related to target organisms due to limited availability of bacterial strains in our laboratory. However, all of the six targeted genes in this study were [8-9,23,51] well-documented previously , and accordingly four pairs of specific primers for V. parahaemolyticus, L. monocytogenes, E. coli, Salmonella were cited in this study, the published primers for S. aureus and Shigella[13,24] were slightly modified in this study to meet the requirement of MCA. Nevertheless, given the main purpose of this study is to develop an improved multiple real time PCR method (probe-free), the grouping of six reported primer pairs into two tubes under the proposed optimized working condition does work functionally as evidenced by the sensitivity and quantification results obtained from this study using pure cultures.
Biomed Environ Sci, 2014; 27(10): 770-778 Another limitation of this study is that the DNA extraction method based on alkaline lysis and isopropanol precipitation remains a hindrance in high throughput application, particularly due to its poor performance in the DNA enrichment of Gram-positive strains (S. aureus, L. monocytogenes). As our current preliminary study has showed the MasterPure Complete DNA purification kit (Epicenter Technologies, Madison, WI) worked well for the DNA extraction form both Gram-positive and negative strains (data not shown), this kit will be tested to refine the DNA extraction method. The MCMRT-PCR assay is a simple, rapid and efficient technique. Further evaluation of this proposed assay with a large number of representative strains and contaminated milk is needed before this method can potentially be optimized for use with other food products. The optimized MCMRT-PCR assay will improve the accessibility to track food-contaminated outbreaks for minimally equipped laboratories in local CDCs, reducing the risks of infection from the food and helping researchers formulate effective surveillance systems that meet public health goals and safety objectives implemented by risk-informed policy. Received: November 6, 2013; Accepted: March 19, 2014
REFERENCES 1. Chiang YC, Tsen HY, Chen HY, et al. Multiplex PCR and a chromogenic DNA macroarray for the detection of Listeria monocytogens, Staphylococcus aureus, Streptococcus agalactiae, Enterobacter sakazakii, Escherichia coli O157:H7, Vibrio parahaemolyticus, Salmonella spp. and Pseudomonas fluorescens in milk and meat samples. J Microbiol Methods, 2012; 88, 110-6. 2. Alizadeh AH, Behrouz N, Salmanzadeh S, et al. Escherichia coli, Shigella and Salmonella species in acute diarrhoea in Hamedan, Islamic Republic of Iran. East Mediterr Health J, 2007; 13, 243-9. 3. Zarei M, Maktabi S, Ghorbanpour M. Prevalence of Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Salmonella spp. in seafood products using multiplex polymerase chain reaction. Foodborne Pathog Dis, 2012; 9, 108-12. 4. Park YS, Lee SR, Kim YG. Detection of Escherichia coli O157:H7, Salmonella spp., Staphylococcus aureus and Listeria monocytogenes in kimchi by multiplex polymerase chain reaction (mPCR). J Microbiol, 2006; 44, 92-7. 5. Centers for Disease control and Prevention. Outbreaks of Escherichia coli O157:H7 infections among children associated with farm visits-Pennsylvania and Washington, 2000. MMWR Morb Mortal Wkly Rep, 2001; 50, 293-7. 6. Paton JC, Paton AW. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin Microbiol Rev, 1998; 11, 450-79.
Detection and identification of six foodborne bacteria by MCMRT-PCR assay 7. Mead PS, Slutsker L, Dietz V, et al. Food-related illness and death in the United States. Emerging infectious diseases, 1999; 5, 607-25. 8. D'Souza DH, Critzer FJ, Golden DA. Real-time reverse-transcriptase polymerase chain reaction for the rapid detection of Salmonella using invA primers. Foodborne Pathog Dis, 2009; 6, 1097-106. 9. Suo B, He Y, Tu SI, et al. A multiplex real-time polymerase chain reaction for simultaneous detection of Salmonella spp., Escherichia coli O157, and Listeria monocytogenes in meat products. Foodborne Pathog Dis, 2010; 7, 619-28. 10.Kotloff KL, Winickoff JP, Ivanoff B, et al. Global burden of Shigella infections: implications for vaccine development and implementation of control strategies. Bull World Health Organ, 1999; 77, 651-66. 11. Schrijver K De, Bertrand S, Gutierrez Garitano I, et al. Outbreak of Shigella sonnei infections in the Orthodox Jewish community of Antwerp, Belgium, April to August 2008. Euro Surveill, 2011; 16. 12. Xia S, Xu B, Huang L, et al. Prevalence and characterization of human Shigella infections in Henan Province, China, in 2006. J Clin Microbiol, 2011; 49, 232-42. 13. Vu DT, Sethabutr O, Seidlein L Von, et al. Detection of Shigella by a PCR assay targeting the ipaH gene suggests increased prevalence of shigellosis in Nha Trang, Vietnam. J Clin Microbiol, 2004; 42, 2031-5. 14. Shao Y, Zhu S, Jin C, et al. Development of multiplex loop-mediated isothermal amplification-RFLP (mLAMP-RFLP) to detect Salmonella spp. and Shigella spp. in milk. Int J Food Microbiol, 2011; 148, 75-9. 15. Liu D. Identification, subtyping and virulence determination of Listeria monocytogenes, an important foodborne pathogen. J Med Microbiol, 2006; 55, 645-59. 16. Liu D, Ainsworth AJ, FW Austin, et al. Characterization of virulent and avirulent Listeria monocytogenes strains by PCR amplification of putative transcriptional regulator and internalin genes. J Med Microbiol, 2003; 52, 1065-70. 17.Jung HJ, Park SH, Ha SD, et al. Species-specific detection of Listeria monocytogenes using polymerase chain reaction assays targeting the prfA virulence gene cluster. Biosci Biotechnol Biochem, 2009; 73, 1412-5. 18. Deneer HG, Boychuk I. Species-specific detection of Listeria monocytogenes by DNA amplification. Appl Environ Microbiol, 1991; 57, 606-9. 19. Thomas EJ, King RK, Burchak J, et al. Sensitive and specific detection of Listeria monocytogenes in milk and ground beef with the polymerase chain reaction. Appl Environ Microbiol, 1991; 57, 2576-80. 20.Arakawa E, Murase T, Shimada T, et al. Emergence and prevalence of a novel Vibrio parahaemolyticus O3:K6 clone in Japan. Jpn J Infect Dis, 1999; 52, 246-7. 21. Su YC, Liu C. Vibrio parahaemolyticus: a concern of seafood safety. Food Microbiol, 2007; 24, 549-58. 22. Pan TM, Wang TK, CL Lee, et al. Food-borne disease outbreaks due to bacteria in Taiwan, 1986 to 1995. J Clin Microbiol, 1997; 35, 1260-2. 23. Nordstrom JL, Vickery MC, Blackstone GM, et al. Development of a multiplex real-time PCR assay with an internal amplification control for the detection of total and pathogenic Vibrio parahaemolyticus bacteria in oysters. Appl Environ Microbiol, 2007; 73, 5840-7. 24.Lachica RV, Genigeorgis C, Hoeprich PD. Metachromatic agar-diffusion methods for detecting staphylococcal nuclease activity. Appl Microbiol, 1971; 21, 585-7. 25. Brakstad OG, Aasbakk K, Maeland JA. Detection of Staphylococcus aureus by polymerase chain reaction
777
amplification of the nuc gene. J Clin Microbiol, 1992; 30, 1654-60. 26. Li Y, Mustapha A. Simultaneous detection of Escherichia coli O157:H7, Salmonella, and Shigella in apple cider and produce by a multiplex PCR. J Food Prot, 2004; 67, 27-33. 27. Li Y, Zhuang S, Mustapha A. Application of a multiplex PCR for the simultaneous detection of Escherichia coli O157:H7, Salmonella and Shigella in raw and ready-to-eat meat products. Meat Sci, 2005; 71, 402-6. 28.Bonetta S, Borelli E, Bonetta S, et al. Development of a PCR protocol for the detection of Escherichia coli O157:H7 and Salmonella spp. in surface water. Environ Monit Assess, 2011; 177, 493-503. 29. Bhagwat AA. Simultaneous detection of Escherichia coli O157:H7, Listeria monocytogenes and Salmonella strains by real-time PCR. Int J Food Microbiol, 2003; 84, 217-24. 30. Anklam KS, Kanankege KS, Gonzales TK, et al. Rapid and reliable detection of Shiga toxin-producing Escherichia coli by real-time multiplex PCR. J Food Prot, 2012; 75, 643-50. 31. Kagkli DM, Weber TP, Bulcke M Van den, et al. Application of the modular approach to an in-house validation study of real-time PCR methods for the detection and serogroup determination of verocytotoxigenic Escherichia coli. Appl Environ Microbiol, 2011; 77, 6954-63. 32. Warsen AE, Krug MJ, LaFrentz S, et al. Simultaneous discrimination between 15 fish pathogens by using 16S ribosomal DNA PCR and DNA microarrays. Appl Environ Microbiol, 2004; 70, 4216-21. 33.Lungu B, Waltman WD, Berghaus RD, et al. Comparison of a real-time PCR method with a culture method for the detection of Salmonella enterica serotype enteritidis in naturally contaminated environmental samples from integrated poultry houses. J Food Prot, 2012; 75, 743-7. 34. Huang Q, Hu Q, Li Q. Identification of 8 foodborne pathogens by multicolor combinational probe coding technology in a single real-time PCR. Clin Chem, 2007; 53, 1741-8. 35.Rajtak U, Leonard N, Bolton D, et al. A real-time multiplex SYBR Green I polymerase chain reaction assay for rapid screening of salmonella serotypes prevalent in the European Union. Foodborne Pathog Dis, 2011; 8, 769-80 36. Karsai A, Muller S, Platz S, et al. Evaluation of a homemade SYBR green I reaction mixture for real-time PCR quantification of gene expression. Biotechniques, 2002; 32, 790-2, 794-6. 37. Nath K, Sarosy JW, Hahn J, et al. Effects of ethidium bromide and SYBR Green I on different polymerase chain reaction systems. J Biochem Biophys Methods, 2000; 42, 15-29. 38. Ririe KM, Rasmussen RP, Wittwer CT. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Anal Biochem, 1997; 245, 154-60. 39. Giglio S, Monis PT, Saint CP. Demonstration of preferential binding of SYBR Green I to specific DNA fragments in real-time multiplex PCR. Nucleic Acids Res, 2003; 31, e136. 40. Gudnason H, Dufva M, Bang DD, et al. Comparison of multiple DNA dyes for real-time PCR: effects of dye concentration and sequence composition on DNA amplification and melting temperature. Nucleic Acids Res, 2007; 35, e127. 41. Monis PT, Giglio S, Saint CP. Comparison of SYTO9 and SYBR Green I for real-time polymerase chain reaction and investigation of the effect of dye concentration on amplification and DNA melting curve analysis. Anal Biochem, 2005; 340, 24-34. 42. Chen J, Tang J, Liu J, et al. Development and evaluation of a multiplex PCR for simultaneous detection of five foodborne pathogens. J Appl Microbiol, 2012; 112, 823-30. 43.Malorny B, Hoorfar J, Bunge C, et al. Multicenter validation of the analytical accuracy of Salmonella PCR: towards an
778 international standard. Appl Environ Microbiol, 2003; 69, 290-6. 44. Kim JS, Lee GG, Park JS, et al. A novel multiplex PCR assay for rapid and simultaneous detection of five pathogenic bacteria: Escherichia coli O157:H7, Salmonella, Staphylococcus aureus, Listeria monocytogenes, and Vibrio parahaemolyticus. J Food Prot, 2007; 70, 1656-62. 45. Miszczycha SD, Ganet S, Duniere L, et al. Novel real-time PCR method to detect Escherichia coli O157:H7 in raw milk cheese and raw ground meat. J Food Prot, 2012; 75, 1373-81. 46. Wang L, Li Y, A Mustaphai. Rapid and simultaneous quantitation of Escherichia coli 0157:H7, Salmonella, and Shigella in ground beef by multiplex real-time PCR and immunomagnetic separation. J Food Prot, 2007; 70, 1366-72. 47. Goto M, Takahashi H, Segawa Y, et al. Real-time PCR method for quantification of Staphylococcus aureus in milk. J Food Prot,
Biomed Environ Sci, 2014; 27(10): 770-778 2007; 70, 90-6. 48. OG J, Sedano-Balbas S, Maher M, et al. Rapid real-time PCR detection of Listeria monocytogenes in enriched food samples based on the ssrA gene, a novel diagnostic target. Food Microbiol, 2008; 25, 75-84. 49.Gori A, Cerboneschi M, Tegli S. High-resolution melting analysis as a powerful tool to discriminate and genotype Pseudomonas savastanoi pathovars and strains. PLoS One, 2012; 7, e30199. 50.Hsiao CC, Chang J, Wu JY, et al. High-resolution melting and real-time PCR for quantification and detection of drug-resistant HBV mutants in a single amplicon. Antivir Ther, 2012; 17, 291-303. 51.Critzer FJ, Dsouza DH, Golden DA. Transcription analysis of stx1, marA, and eaeA genes in Escherichia coli O157:H7 treated with sodium benzoate. J Food Prot, 2008; 71, 1469-74.
