215

Detection of a carrier state in Theileria parva- infected cattle by the polymerase chain reaction R. BISHOP1, B. SOHANPAL1, D. P. KARIUKI 2 , A. S. YOUNG2, V.NENE 1 , H. BAYLIS3, B. A. ALLSOPP3, P. R. SPOONER1, T. T. DOLAN1 and S. P. MORZARIA1 1

International Laboratory for Research on Animal Diseases, P.O. Box 30709, Nairobi, Kenya National Veterinary Research Centre Muguga, Kenya Agricultural Research Institute, P.O. Box 32, Kikuyu, 3 University of Cambridge, Department of Biochemistry, Tennis Court Road, Cambridge CB2 1QW, UK

2

Kenya

(Received 21 June 1991 ; accepted 30 August 1991) SUMMARY

Two sets of oligonucleotide primers, one derived from a repetitive sequence and the other from the gene encoding a 67 kDa sporozoite antigen of Theileria parva, were used to amplify parasite DNA from the blood of T. parva-infected carrier cattle using the polymerase chain reaction (PCR). PCR amplification products were obtained from 15 carrier cattle infected with one of 4 different T. parva stocks. Successful amplifications were performed using DNA from 2 cattle infected with T. p. parva Pemba Mnarani, 10 cattle infected with T. p. parva Marikebuni, 2 cattle infected with T. p. bovis Boleni and 1 animal infected with T. p. lawrencei 7014. No amplification products were obtained from any of 7 cattle which had been infected with the T. p. parva Muguga stock. A synthetic oligonucleotide, which hybridized specifically to T. p. parva Marikebuni DNA among 6 T. parva stocks tested, was designed using sequence data from within the region of the T. parva genome amplified by the repetitive sequence primers. The oligonucleotide was used to probe PCR products and to increase the sensitivity and specificity of carrier animal detection. Southern blot analysis using a T. parva repetitive sequence probe demonstrated the existence of restriction fragment length polymorphisms between parasites isolated from T. p. parva Marikebuni-infected carrier cattle. The use of the PCR and other methods of carrier animal detection are discussed. Key words: Theileria parva, polymerase chain reaction (PCR), carrier cattle, synthetic oligonucleotide.

INTRODUCTION

East Coast fever (ECF) is an economically important disease of cattle in eastern, central and southern Africa, caused by a tick-transmitted protozoan parasite Theileria parva. The main vector of the parasite is the ixodid tick Rhipicephalus appendiculatus. Current classification recognizes three subspecies of T. parva, T. p. lawrencei, T. p. parva and T. p. bovis, defined on the basis of clinical and epidemiological criteria (Uilenberg, 1981). Cattle can be immunized against East Coast fever by an infection and treatment procedure (Radley et al. 1975). The carrier state of T. parva has been defined as the ability of parasites present in an infected and recovered (and therefore asymptomatic) host to infect ticks which are then able to transmit the parasites to a susceptible host (Young et al. 1986; Maritim et al. 1990). A carrier state has long been recognized in buffalo and cattle naturally recovered from T. p. lawrencei infection (Barnett & Brocklesby, 1966). More recent work has revealed that a high proportion of cattle in some districts of Kenya exhibit a carrier state for T. p. parva (Young et al. 1986, 1990). The carrier state is therefore a significant factor in the epidemiology of ECF. The definitive method for carrier state detection is tick application to animals and transmission of Parasitology (1992) 104, 215-232

Printed in Great Britain

infection to susceptible hosts (xeno-diagnosis) but it is not practical on a large scale. Of the methods for detecting animals persistently infected with T. parva, thin blood film examination for piroplasms lacks sensitivity and antibody detection using the schizont antigen indirect fluorescent antibody (IFA) test (Burridge & Kimber, 1972; Goddeeris et al. 1982) shows cross-reactivity with other Theileria species and may not always distinguish current and previous infections. Additionally the IFA and other serological tests do not always detect carriers whose infection can be confirmed by xeno-diagnosis (Dolan, 1986). Improved methods for detection of long-term T. parva-miected animals, many of which may be carriers capable of transmitting disease to susceptible cattle, are therefore required. The polymerase chain reaction (PCR), a technique for the enzymic amplification of specific DNA sequences in vitro (Mullis & Faloona, 1987; Saiki et al. 1988) has allowed the development of sensitive diagnostic assays for viruses such as hepatitis B (Kaneko et al. 1989) and HIV (Ou et al. 1988). PCR has also been used for detection of Trypanosoma cruzi in patients with chronic Chagas' disease (Sturm et al. 1989). In this paper we show that the PCR using T. parva-specific primers can be used for the detection of T. parva carrier cattle. We also describe the use of the PCR to develop an oligonucleotide which

R. Bishop and others

216

Table 1. Theileria stocks Parasite

Stock

Parasite stage

Stabilate no.

T. p. parva

Muguga

T. p. parva T. p. parva

Mariakani Marikebuni

T. p. parva T. p. parva T. p. parva T. p. bovis

Uganda Kilifi Pemba Mnarani Boleni

Sporozoite Piroplasm Piroplasm Piroplasm Schizont Schizont Schizont Sporozoite Sporozoite Piroplasm Piroplasm Sporozoite

T. p. lawrencei

7014

T. mutans T. taurotragi

Intona East African Orphanage

3087 3087 1937 2246 1581 2246 3014 3014 3262* 3066 1149 2913 3165 3039 3039 3230* 3081 3081 3008

Piroplasm Schizont Sporozoite Sporozoite Schizont Piroplasm Schizont

* Cloned stabilate.

specifically hybridizes to the D N A of T. p. parva Marikebuni, a stock which is being employed in vaccination trials in Kenya (Mutugi et al. 1990).

MATERIALS AND METHODS

Theilerial parasites Three species of Theileria, T. parva (comprising the subspecies T. p. parva, T. p. lawrencei and T. p. bovis), T. mutans and T. taurotragi, were used in the study. Details of the parasite stocks are given in Table 1. The T. p. parva Marikebuni stabilates 2246 and 3014 were derived by one and two tick/cattle passages respectively from the reference stabilate 1581. The T. p. parva Pemba Mnarani 3165 stabilate was derived by a single tick passage from the reference stabilate 2913. The T. p. bovis Boleni 3230 and T. p. parva Marikebuni 3262 stabilates are putatively cloned parasites derived respectively from the 3039 and 3014 stabilates (S. P. Morzaria, T. T . Dolan and P. R. Spooner, personal communication). All other T. parva stocks have been described previously (Minami et al. 1983; Irvin et al. 1983, Morzaria et al. 1990). The T. mutans Intona stock was isolated from Mara, Kenya (Mutugi, 1986), and the T. taurotragi-iniected bovine cell line was established in vitro by Stagg et al. (1983). Animals The cattle used were exotic Bos taurus breeds

purchased from farms where tick control by dipping was practised and Boran cattle (Bos indicus) born to dams on a farm free from ECF. The animals were maintained under strict tick control by regular acaricide application, except when ticks were being applied. They had no antibodies to T. parva or T. mutans in the I FA test (Goddeeris et al. 1982) before experimentation. Some cattle were experimentally infected with T. parva sporozoite stabilates (Cunningham et al. 1973) and allowed to recover naturally, others were immunized by infection and treatment (Radley et al. 1975). Blood samples for PCR amplification were collected into EDTA at periods ranging from 2 to 30 months after infection and stored frozen until processed. Clean nymphs of Rhipicephalus appendiculatus were applied to longterm infected cattle essentially as described by Bailey (1960), and T. parva infection rates were determined as described by Young & Leitch (1982). Cultures of Theileria-iniected lymphocytes were established from infected cows using the procedure of Brown (1979). Details of the infection and serological status of the cattle used are given in Table 2.

Preparation of DNA and processing of samples for the PCR Theileria parva piroplasm purification was as described by Conrad et al. (1987) while T. mutans piroplasm purification followed the procedure of Morzaria et al. (1990). Preparation of DNA from

Table 2. Theilerta parva-iniected cattle: infection history, serological status, tick transmission attempts and PCR amplification (IFA titres marked * are maximum IFA titres, other IFA titres are at time of taking samples for PCR. Under 'Tick isolation', the time given is the time after infection at which ticks were applied, +ve/ —ve refers to whether sporozoites were detected microscopically in dissected R. appendiculatus salivary glands after tick application. Under 'Tick transmission', + ve/ —ve refers to whether or not ticks applied to an animal transmitted East Coast fever to susceptible cattle. Under 'Infection duration', the time given refers to the length of time for which the animal had been infected when samples were taken for PCR amplification. Under 'PCR', +ve/ —ve relates to whether or not a TPRl PCR amplification product, detectable either by ethidium bromide staining or by hybridization with a TPRl DNA probe, was generated from the blood DNA of an animal.)

Animal

Mode of infectionf

Parasite stock

F202

nat. rec.

F199

nat. rec.

E211

nat. rec.

E166

nat. rec.

E31

inf. + trt.

G373

inf. + trt.

BH5

inf. + trt.

BH18

inf. + trt

Gill

nat. rec.

G101

nat. rec.

G100

nat. rec.

G95

nat. rec.

G90

nat. rec.

F40

nat. rec.

G94

nat. rec.

F338

nat. rec.

F374

nat. rec.

954

inf. + trt.

962

inf. + trt.

963

inf. + trt.

T. p. bovis 3230 Boleni T. p. bovis 3230 Boleni T. p. lawrencei 3081 7014 T. p. lawrencei 3081 7014 T. p. parva 2913 Pemba Mnar. 3165 T. p. parva Pemba Mnar. T. p. parva 3165 Pemba Mnar. 3165 T. p. parva Pemba Mnar. T. p. parva 3087 Muguga 3087 T. p. parva Muguga 3087 T. p. parva Muguga 3087 T. p. parva Muguga 3087 T. p. parva Muguga T. p. parva 3087 Muguga 3087 T. p. parva Muguga 3262 T. p. parva Marikebuni 3262 T. p. parva Marikebuni 3014 T. p. parva Marikebuni 3014 T. p. parva Marikebuni 3014 T. p. parva Marikebuni 3014 T. p. parva Marikebuni 3014 T. p. parva Marikebuni 3014 T. p. parva Marikebuni 3014 T. p. parva Marikebuni 3014 T. p. parva Marikebuni — — — —

971

inf. + trt.

972

inf. + trt.

973

inf. + trt.

978

inf. + trt.

979

inf. + trt.

109 116

Uninfected Uninfected

Stabilate number

IFA titre

Tick isolation|

PCR

Transmission of infection

Infection duration

5000*

6 weeks —ve

+ ve

— ve

3 months

5000*

6 weeks —ve

+ ve

— ve

3 months

+ ve

— ve

25 months

5000*

16 mon.-ve 24 mon.-ve 6 mon.-ve

— ve

— ve

7 months

250§

22 mon.+ve

+ ve

+ ve

30 months

5000*

3 mon.-ve

— ve

— ve

5 months

1250*

3 mon. — ve

+ ve

— ve

5 months

1250*

3 mon.—ve

— ve

— ve

5 months

N.D.

— ve

N.D.

2 months

40-ve

N.D.

— ve

N.D.

8 months

40-ve

N.D.

— ve

N.D.

9 months

— ve

+ ve

9 months

N.D.

— ve

N.D.

10 months

N.D.

— ve

N.D.

12 months

200*

1000

40-ve 40-ve 200

2 weeks+ ve

200*

2 weeks —ve

— ve

— ve

6 months

5000*

2 weeks+ ve

+ ve

+ ve

4 months

5000*

2 weeks+ ve

+ ve

+ ve

4 months

3 7 3 7 3 7 3 7 3 7 3 7 3 7 3 7

+ ve

+ ve + ve + ve + ve

14 months

+ ve

14 months

160 160 640 640 160 40-ve 160 160

< 40-ve < 40-ve

f inf. + trt., Infection and treatment; nat. rec, natural recovery.

— —

mon. + ve mon. + ve mon.+ve mon.+ve mon.+ve mon. + ve mon. +ve mon. + ve mon. +ve mon.+ve mon.+ve mon. + ve mon. + ve mon. +ve mon.+ve mon. +ve

+ ve + ve + ve + ve + ve + ve + ve — ve — ve

+ ve + ve + ve + ve + ve + ve + ve + ve + ve + ve + ve — —

X mon., month; N.D. , not done.

14 months

14 months 14 months 14 months 14 months 14 months — —

§ ELISA titre.

218

R. Bishop and others

purified piroplasms and from Theileria-miected lymphoblastoid cell lines was as detailed by Conrad et al. (1987). Preparation of DNA for PCR from whole blood of T. parva-infected cattle was essentially as described by Ausubel et al. (1987) except that the blood was first lysed with 0-1 % NP40. Resuspended DNAs were sheared 100 times through a 27-gauge needle, boiled for 5 min and passed through a spun column of G50 Sephadex prior to amplification (de Franchis et al. 1988). For direct PCR on blood, 100 ft\ of whole blood, or 50/*1 of blood which had been spotted on nitrocellulose and kept at ambient temperature for up to 10 weeks, was processed as described by Higuchi (1989). Lymphnode biopsy samples were stored frozen in 0-5 ml of PBS and Theileria-iniected tick salivary glands were stored frozen in 100 ji\ of PBS. These samples were also processed as described by Higuchi (1989) except that the washing steps were omitted in the case of the salivary glands. DNA amplification by the polymerase chain reaction For purified DNAs, 100/^1 reactions contained 50 mM KC1; 10 mM Tris-HCl, pH 8 3 ; 1-5 mM MgCl 2 ; 0-1 % (w/v) gelatin; 200 /im each deoxyribonucleotide triphosphate; 1 /IM each oligonucleotide primer; 50 ng schizont-containing DNA or 5 ng purified piroplasm DNA or approximately 400 ng of whole blood DNA. For direct amplification from blood samples reactions were as for purified DNA but contained 25 mM MgCl 2 , and 0-5 % Tween 20 instead of gelatin (Kawasaki, 1990) and either 1 (i\ of processed blood in PCR buffer or 5 fi\ of processed ex-nitrocellulose blood in PCR buffer. Amplification of lymph node (1 /i\ of processed material/reaction) and infected tick salivary gland samples (95 fi\ of processed material/reaction) was as described for blood. Reactions were overlaid with 200 /i\ of fine mineral oil (Sigma), denatured at 95 °C for 5 min and then cooled to 60 °C. Then 2#5 units of Thermus aquaticus (Taq) polymerase (Perkin Elmer Cetus Corporation, Norwalk, CT, USA) were added and the mixture subjected to 30 cycles of extension (72 °C, initial experiments used 90 sec subsequently reduced to 45 sec), denaturation (94 °C, 1 min) and annealing (60 °C, 1 min). Cycling was performed in a commercial DNA cycler (Perkin Elmer Cetus Corporation).

Cloning of PCR amplification products Amplification products were electroeluted after agarose gel electrophoresis and purified by phenol/ chloroform extraction and ethanol precipitation (Maniatis, Fritsch & Sambrook, 1982). They were then ligated into the Smal site of plasmid pUC19 and the ligation mixture used to transform E. coli strain JM83. Recombinants containing inserts were

identified by the single colony lysate procedure (Maniatis et al. 1982). Blotting, radio-isotope labelling and hybridization Restriction enzyme digestion of Theileria-infected lymphoblastoid cell DNA with EcoRl and agarose gel electrophoresis used the conditions described by Conrad et al. (1987). Southern blotting (Southern, 1975) was performed as described by Maniatis et al. (1982) on to nylon filters (Hybond N + ; Amersham International, Buckinghamshire, UK) with fixation by treatment with 0-4 M NaOH or by exposure to UV light for 3-5 min. Dot and slot blotting used Bio-dot and Bio-dot SF apparatus (Bio-Rad Laboratories, Richmond, CA, USA). Slot blotting of PCR products on to Hybond-N+ followed the procedure of Saiki et al. (1986), dot blotting of genomic DNA followed the manufacturers instructions. Labelling of probes with [a- 32 P]dCTP was either by random priming (Feinberg & Vogelstein, 1983) using a Prime-it kit (Stratagene, La Jolla, CA, USA), or using a nick translation system (BRL, Gaithersburg, MD, USA). Pre-hybridization and hybridization of filters were as described by Conrad et al. (1987). Washing conditions for filters are described in individual figure legends.

Construction and screening of a sheared genomic DNA library in Agtll A library of T. p. bovis Boleni piroplasm genomic DNA fragments was constructed in the bacteriophage vector, Agtll, using the procedure described by Young et al. (1985). Approximately 5 x 105 independent recombinant phage were produced in a library with 80 % recombinants. Duplicate filter lifts of 50000 plaques from this library were screened with radio-isotope labelled total T. p. bovis Boleni piroplasm DNA (first lift) and total bovine lymphocyte DNA (second lift) using the conditions described by Conrad et al. (1987). Twenty primary positive plaques which hybridized strongly with T. p. bovis piroplasm DNA but did not hybridize with bovine DNA were twice re-screened with total T. p. bovis DNA and purified to single plaques. Smallscale bacteriophage DNA preparations were made from these purified plaques by the plate lysate method (Maniatis et al. 1982) and the inserts were released by EcoRl digestion. The inserts from two of these bacteriophage clones were subcloned into the EcoRl site of pUC19.

Synthetic oligonucleotides Synthetic oligonucleotides to act as primers for the PCR or as stock specific probes were made using an Applied Biosystems (Warrington, UK) 381A synthesizer and purified on columns supplied by

Carrier state of Theileria parva detected by PCR

the company. The T. p. parva Marikebuni specific oligonucleotide IL159 was end-labelled with [y-32P]ATP using T4 polynucleotide kinase as described (Maniatis et al. 1982) and added to the hybridization solution without removal of unincorporated label. For probing Southern or slotblotted PCR products with this oligonucleotide, filters were pre-hybridized for 6 h in 6 x SSC (1 x SSC = 150 mM NaCl, 15 mM sodium citrate), 5 x Denhardt's (0-1 % each of bovine serum albumin, Ficoll 400 and poly vinyl pyrollidone), 0-05 % sodium pyrophosphate and 0-5 % SDS at 45 °C. Labelled probe was then added and the filter incubated for a further 16 h at the same temperature. After hybridization the filter was washed in 5 x SSC for 30 min at room temperature and then for 10 min at 53 °C prior to autoradiographic exposure. DNA sequencing

219

designated pBOLREPl, was used to probe Southern blots of EcoRl- digested T. p. bovis DNA, it hybridized to multiple restriction fragments, suggesting that the sequence was repeated in the T. p. bovis genome (data not shown). A portion of this T. p. bovis repetitive sequence was found to exhibit DNA sequence homology with a repetitive region of the T. p. parva Muguga genome. The unit repetitive element within this region in T. p. parva Muguga has been designated TPR1 (Allsopp et al. 1989; Baylis et al. 1991) and DNA probes derived from this region have been demonstrated not to crosshybridize with other Theileria species (Conrad et al. 1987). Based on the observed homologies, two 32mer synthetic oligonucleotides conserved between the T. p. parva and T. p. bovis repetitive sequences but flanking a more variable region were chosen to act as PCR primers. The primers, IL194 and IL197, whose 5' ends were 405 bp apart in the T. p. parva Muguga genome are shown in Fig. 1, together with the homology alignment between the Muguga and Boleni repetitive sequences in this region of TPR1. When these primers were tested in PCR reactions using T. p. parva Muguga piroplasm and infected lymphocyte DNA they yielded a product of the expected size (approximately 400 bp). When used on T. mutans piroplasm DNA and T. taurotragiinfected lymphocyte DNA the primers did not generate specific PCR amplification products.

The 2-3 kb T. p. bovis repetitive DNA clone was sequenced by making a series of overlapping deletion mutants of the clone in pUC19, using exonuclease BAL 31, and cloning these into bacteriophage Ml 3. This was carried out essentially as described by Ausubel et al. (1987) except that the BAL 31 timepoints were not gel-purified prior to cloning into Ml3. Preparation of single-stranded DNA from Ml 3 recombinants was as described in Maniatis et al. (1989). For double-stranded sequencing of cloned The organization of TPR1-related sequences has PCR products miniprep DNA made using the been shown to be highly polymorphic in the T. parva alkaline lysis procedure (Maniatis et al. 1982) was genome (Conrad et al. 1987; Allsopp et al. 1989), processed as described by Ausubel et al (1987). and it was found that although the DNA of most Single-stranded DNA for direct sequencing of PCR T. p. parva stocks would amplify with the TPR1 products from carrier cattle was generated using the primers, DNA from many T. p. lawrencei stocks did procedure of Kreitman & Landweber (1989). All not (not shown). In an attempt to create a more sequencing reactions were performed by the chain universally conserved pair of primers for amplitermination method (Sanger, Nicklen & Coulson, fication of DNA from all T. parva stocks, two 201977), with a modified T7 polymerase using a mer synthetic oligonucleotides were designed to Sequenase DNA sequencing kit (United States amplify a 233 bp fragment of DNA encoding amino Biochemical Corporation, Cleveland, Ohio, USA). acid residues 274-340 of a T. parva Muguga Each base was determined at least once on each sporozoite surface antigen, p67 (Nene et al. 1991). strand in the case of the cloned PCR products and at The p67 gene is thought, on the basis of the absence least twice on each strand for the T. p. bovis repetitive of observed restriction fragment length polyclone. morphisms, to be relatively conserved among T. parva stocks. These primers are shown in Fig. 2, together with the relevant region of the p67 seRESULTS quence. When used in PCR reactions with T. parva Development of Theileria parw a-specific primers for piroplasm and infected lymphocyte DNA the p67 the PCR primers generated a PCR product of the expected size (approximately 230 bp) but also, in the case of A sheared genomic DNA library was constructed in the infected lymphocyte DNA, three additional bacteriophage Agtl 1 from T. p. bovis Boleni pirolarger products presumably due to mispriming on plasm DNA and screened with isotope-labelled total bovine sequences. These products were eliminated piroplasm DNA from the same stock. Several by reducing the extension time in the PCR reaction strongly hybridizing clones which did not crossfrom 90 to 45 sec. Using the reduced extension time hybridize with isotope-labelled bovine DNA were these primers did not yield a specific PCR ampliisolated and the insert from one of these, which was fication product with T. mutans or T. taurotragi approximately 2-3 kb in size, was subcloned into DNA. plasmid pUC19 and sequenced. When this plasmid,

220

R. Bishop and others

Muguga Boleni

Oligo IL194 -> ATATATCCAGCCATaGCtCCTGGAATGATTGTtCCATTtTACCTcqTqGAtAAGATTGAGATGG ATATATCCAGCCATtGCaCCTGGAATGATTGTqCCCTTcTACCTtaTtGAcAAGATTGAGATGG

Muguga Boleni

TtCTgTTGATagCCACCATATTtCCAgCtcTgtatGTGGCaaTTgccAGAAGTgGTAAACtGAT TaCTtCTGATccTTACCATATTcCCAcCagTcacaGTGGCtcTTctgAGAA—aGTA—CgG—

Muguga Boleni

ACCAggTTTTGGTGGTTTCTTCAATCCCGTGTCtCCtAcATgTaAtTGGGgaGcCAaaAAtgAA —CAaa GGTGGT CA GTCaCCaAtATcTcAcTGGGacGaCActAAccAA

Muguga Boleni

CTAcCcTgGatACCTggaGtaCCaTTaggCCaaGGaTaccacTGGCAccTaacTGAcCtAgTgA —AaCtTcGtcAC-TaagGctCCgTTgccTTctGGcTttggtTGGCAtgTtctTGAtCcAcTtA

Muguga Boleni

TTCCcacCATGATCATttTAGCctattTATTtATTTACTCACTGCATTACAGAGAcTCatcagT TTCCactCATGATCATacTAGCtatcaTATTcATTTACTCACTGCATTACAGAGAaTCcagtcT

Muguga Boleni

tqCCAGATCaATCATCAAcCAACCCAAAATGTCTACATqTCTaACCATtcTaTTCTATATGTGT atCCAGATCcATCATCAAtCAACCCAAAATGTCTACATtTCTgACCATcaTgTTCTATATGTGT

Muguga Boleni

«- Oligo IL197 CATGAGATCTCatTqGCTGTA CATGAGATCTCtcTtGCTGTA

Oligonucleotide IL194 5'-ATATATCCAGCCATAGCTCCTGGAATGATTGT-3' Oligonucleotide IL197 5'-TACAGCCAATGAGATCTCATGACACATATAGA-3' Fig. 1. TPR1 Theileria parva-specific PCR primers. Oligonucleotide primers were designed to amplify a 405 bp segment of the TPR1 region of the T. p. parva Muguga genome. The primers were 90 ° 0 conserved between T. p. bovis Boleni and T. p. parva Muguga but flanked a more variable region. An alignment between TPR1 DNA sequences from T. p. bovis Boleni (378 bp) and T. p. parva Muguga (405 bp) in the specific region used for PCR amplification is shown. The overall homology between the 2 sequences is 67%. Bases not conserved between the 2 sequences are shown in lower case alphabets. The conserved sequences chosen for oligonucleotide primers IL194 and IL197 are underlined.

Oligo IL144 -+ TCAGGCGCAGCATCAACAGGTAAGAGATGGAGATGGTAGAGTTATTGAGCCTAAAATTGGATTAC Q A Q H Q Q V R D G D G R V I E P K I G L CCGGACCTCCATCTGCGCCAGTACCATCACCAGGAGCGCCCGGAATAATTGTTAGAGAATCAGgt P G P P S A P V P S P G A P G I I V R E S ttgtttttttgagtatatgggttttagGCAATAGGGCAATGGATATTGTACAGTTTTTAGGAAG G N R A M D I V Q F L G R *• Oligo IL145 ATTTAAACCAGAACCAAGGGCATATGAAGGGGAAAGAAC F K P E P R A Y E G E R

Oligonucleotide IL144 Oligonucleotide IL145

5'-TCAGGCGCAGCATCAACAGGT-3' 5'-GTTCTTTCCCCTTCATATGCCC-3•

Fig. 2. p67 sporozoite antigen Theileria parva-specific PCR primers. Oligonucleotide primers IL144 and IL145 were designed to amplify a 233 bp fragment coding for amino acid residues 274—340 of a T. parva sporozoite surface antigen p67. The DNA sequence of the amplified region of p67 is shown with the primer sequences underlined and the corresponding protein sequence underneath (single letter code). This DNA contains a 29 bp intron (Nene et al. 1991) which is shown in lower case alphabets.

Development of stock-specific probes The pBOLREPl plasmid containing the T. p. bovis Boleni repetitive sequence was radio-isotope labelled and probed to dot-blotted whole infected lymphocyte or piroplasm DNA from this parasite and 3

T. p. parva stocks, Muguga, Mariakani and Marikebuni. Significant hybridization was observed only with Boleni DNA under high-stringency washing conditions (Fig. 3 A). Subsequently pBOLREPl was found to hybridise to DNA from T. p. parva Uganda, a stock not used in the carrier cattle experi-

221

Carrier state of Theileria parva detected by PCR 1

2

1

2

3

3

8

ments (not shown). The Boleni probe was thus not completely stock-specific but was useful for discriminating among the limited range of stocks involved in the carrier cattle experiment. In an attempt to isolate a probe specific for the T. p. parva Marikebuni stock, the IL194 and IL197 TPR1 primers described in the previous section were used to amplify TPR1 sequences from a lymphocyte line infected with the Marikebuni 3262 stabilate. The PCR-amplified TPR1 sequences were ligated into plasmid pUC19 and a number of recombinant clones isolated. One of these recombinants designated pMKB63, was isotope-labelled and probed to dot-blotted piroplasm or infected lymphocyte DNA from Marikebuni and 6 other T. p. parva, T. p. bovis and T. p. lawrencei stocks. The result of this hybridization is shown in Fig. 3 B; the probe hybridized strongly to T. p. parva Marikebuni piroplasm DNA (position 1), less strongly to T. p. lawrencei-infected lymphocyte DNA (positions 4 and 8) and weakly to T. p. parva Uganda piroplasm DNA (position 6).

4

4

5

6

10

Fig. 3. Characterization of stock-specific probes. (A) Dot blot of Theileria parva piroplasm (1 fig) or infected lymphoblastoid cell (20 fig) DNA probed with T. p. bovis repetitive clone pBOLREPl and washed at high stringency in 0-1 x SSC and 04 ° 0 SDS, at 65 °C for 1 h. (1) T. p. bovis Boleni-infected cell DNA (in vitro infection of T cell clone G57.G6); (2) T. p. parva Muguga piroplasm DNA; (3) T. p. parva Mariakani piroplasm DNA; (4) T. p. parva Marikebuni-infected cell DNA (in vitro infection of PBL from bovine D211). (B) Dot blot of T. parva piroplasm (1 jug) or infected lymphoblastoid cell (20 fig) DNA probed with T. p. parva Marikebuni TPR1 PCR product clone pMKB63 and washed at high stringency in 0-1 x SSC and 0-1 ° 0 SDS, at 65 °C, for 1 h. (1) T. p. parva Marikebuni piroplasm DNA; (2) T. p. bovis Boleni piroplasm D N A ; (3) T. p. parva Mariakani piroplasm DNA; (4) T. p. lawrencei 7014-infected cell DNA (in vivo isolate from bovine 768); (5) T. p. parva Muguga piroplasm DNA; (6) T. p. parva Uganda piroplasm DNA; (7) T. p. parva Kilifi piroplasm DNA; (8) T. p. lawrencei 7014-infected cell DNA (in vivo isolate from bovine E91). (C) Slot blot of TPR1 PCR products, generated from either piroplasm or infected lymphoblastoid cell DNA using oligonucleotides IL194 and IL197 as primers, probed with T. p. parva Marikebuni TPR1 oligonucleotide IL159. Wasing was in 5 x SSC at 53 °C for 15 min. (1) No DNA control; (2) T. p. parva Muguga piroplasm

In an attempt to improve the specificity of the probe, 2 amplification products generated from T. p. parva Marikebuni DXA using the TPR1 primers were sequenced. These sequences were compared to a TPR1 sequence from T. p. parva Muguga (Allsopp et al. 1989), and TPR1 -homologous sequences derived from PCR amplification products generated from T. p. parva Uganda and T. p. bovis Boleni DNA. A 20-mer synthetic oligonucleotide, IL159, was chosen which was conserved between the 2 Marikebuni sequences but differed among the sequences from the other stocks. The IL159 oligonucleotide sequence is shown in Fig. 4 together with the alignment between the DNA sequences from the different stocks in this region of T P R 1 . The IL159 oligonucleotide was radio-isotope labelled and used to probe slot-blotted TRP1 PCR products generated from several T. parva stocks using oligonucleotides IL194 and IL197 as primers. Hybridization was observed only to products derived from Marikebuni piroplasm and infected lymphocyte DNAs (Fig. 3 C positions 6, 7, 8) and not to products derived from piroplasm or infected lymphocyte DNA of five other T. parva stocks (Fig. 3C positions 2-5 and 9, 10). The IL159 synthetic oligonucleotide thus exhibited greater specificity for the Marikebuni stock than the

DNA; (3) T. p. parva Mariakani piroplasm DNA; (4) T. p. parva Uganda piroplasm DNA; (5) T. p. bovis Boleni piroplasm DNA; (6) T. p. parva Marikebuni piroplasm DNA; (7) T. p. parva Marikebuni-infected cell DNA (in vivo isolate from bovine 171 infected with cloned parasite); (8) T. p. parva Marikebuni-infected cell DNA (in vitro infection of PBL from bovine D211); (9) T. p. lawrencei 7014-infected cell DNA (in vivo isolate from bovine 768); (10) T. p. lawrencei 7014infected cell DNA (in vivo isolate from bovine E90).

R. Bishop and others

222

Muguga Uganda Boleni Marikebuni 1 Marikebuni 2

ATATATCCtGCCATAGCTCCTGGAATGATTGTTCCATTTTACCTcATTGAtAAGATTGA GGAATGATTGTTCCATTTTACCTgATTGACAAGATTGA GGAATGATTGTTCCATTTTACCTtATTGAtAAGATTGA ATATATCCAGCCATAGCTCCTGGAATGATTGTaCCATTTTACCTaATTGACAAGATTGA ATATATCCAGCCATAGCTCCTGGAATGATTGTaCCATTcTACCTaATTGACAAGATTGA

Muguga Uganda Boleni Marikebuni 1 Marikebuni 2

GATGGTtCTgtTGATagcTACCATATTtCCAGCtCTgTaTGTAGCaATTGCCAGAagtgg GATGGTACTTCTGATCcTTACCATATTCCCAcCAtTCTtTGTAGCtgcaGCCAGAggCAA GATGGTACTTCTGATCcTTACCATATTCCCAcCAgTCaCaGTgGCtcT—tCtGAgA-AA aATGacACTTCTaATaaTgACCATAgTCCCAGCACTCTCTGTAGCcATTGCaAGAcACAA aATGacACTTCTGATCaTgACCATAgTCCCAGCACTCTCTGTAGCcATTGCaAGAcACAA

Muguga Uganda Boleni Marikebuni 1 Marikebuni 2

tAaaCtGaT-acCAggtTtTGGTGGttTcTtTG-ATcccGt-GTCTCCTAcATgTAAtTG g tgGTTTGGCtA TGGTGGgtTcTcT—AgtccatgGTCaCCTAcATcTAAgTG g tA cGGCAA aGGTGG Tc AGTCaCCaAtggcTAAgTG cACTCAGTTTGGtAACATATtGcaGccTacaTGCATatgGcAGgCTgaTgaAcagggcTG aACTCAGTTTGGtAACATActGcaGccTacaTGCATatgGgAGgCTgaTcaATggctcct

Muguga Uganda Boleni Marikebuni 1 Marikebuni 2

GGGAGcCAccAATAAACcTGTttGGCta-cCaAgT GaTTTAGgCACTGGaTAccacT GGGAccaggTAAcAAAGAT-TggGGtggaaCagaT TTgGgCAaTGGtgcTgGtT GGacGaCAcTAAccAAGAc-TtctaCAcTaaggCTcCg TTgccttCTGGtctTgGtT GGGAGgCAaTtATAGtAAc-TctGGCA CtACTACAccTTcAca TGGcTATtGgT tGG-GgtgtgtATAG~AT-TccGGtAaTcCtACTAaAGgTTcCGa TGGcTActGgT

Muguga Uganda Boleni Marikebuni 1 Marikebuni 2

GGCAcCTaacTGAcCTAgTgATTCCcAccATGATcATtTTAGCctATtTATTtATTTACT GGCActTcTTTGATaTTgTaATTCCtcTTATGATaATaTTAGCTGCTATATTtATTTACT GGCATgTtcTTGATCcAcTTATTCCAcTcATGATcATacTAGCTaTcATATc-ATTTACT Oligo IL159 GGCATCTqTTTGATtTAacTaTTttAATTATGATtaTaTTAtCTGCTATATTcATTTACT GGCATCTaTTTGATCTAacTaTTttAATTATGATtaTaTTAtCTGCTATATTcATTTACT

Muguga Uganda Boleni Marikebuni 1 Marikebuni 2

CACTGCATTACAGAGACTCaTCagTTgCCAGATCAATCATCAAcCAACCCAAaATGTCTA CACTGCATTACAGAGACTC CACTGCATTACAGAGACTC CACTGCATTACAGAGACTCTTCCATTTCCAGATCAATCATCAATCAACCTAAGATGTCTA CACTGCATTACAGAGACTCTTCCATTTCCAGATCAATCATCAATCAACCTAAGATGTCTA

Muguga Marikebuni 1 Marikebuni 2

CATGTtTAACCATTCTATTCTATATGTGTCATGAGATCTCATTGGCTGTA CATGTCTAACCATTCTATTCTATATGTGTCATGAGATCTCATTGGCTGTA CATGTCTAACCATTaTATTCTATATGTGTCATGAGATCTCATTGGCTGTA Oligonucleotide IL159

5'-ATTATGATTGTGTTATCTGC-3•

Fig. 4. Theileria parva parva Marikebuni-specific oligonucleotide IL159. A 20 base synthetic oligonucleotide was chosen which was conserved between 2 independent T. p. parva Marikebuni TPR1 sequences but differed from T. p. parva Muguga and Uganda and T. p. bovis Boleni sequences derived from the equivalent region of TPR1. An alignment is shown of the DNA sequences of 2 T. p. parva Marikebuni TPR1 amplification products generated using oligonucleotides IL194 and IL197 (402 bp; 91-5% homology with one another), TPR1 amplification products from T. p. parva Uganda (281 bp; 61-2% homology with Marikebuni) and T. p. bovis Boleni (266 bp; 518% homology with Marikebuni) generated using primers Al and A2 (Allsopp et al. 1989) and the homologous section of the T. p. parva Muguga TPR1 clone PMB3 (405 bp; 72% homology with Marikebuni). Bases not conserved with the majority sequence among the 5 are shown in lower case alphabets. The sequence of the oligonucleotide IL159 is underlined in the Marikebuni sequences.

pMKB63 PCR product clone from which it was derived. PCR amplification of Theileria parva sequences from purified carrier cattle blood DNA DNA was made from the whole blood of 8 cattle which had been infected with T. parva for periods of 3-25 months. The cattle comprised 2 T. p. bovisinfected animals (F202 and F199), 2 T. p. lawrencei-

infected animals (E211 and E166), 2 T. p. parva Muguga-infected animals (G94 and G95) and 2 T. p. parva Marikebuni-infected animals (F338 and F374). Details of these animals, none of which were proven carriers in terms of their ability to transmit T. parva to ticks, are given in Table 2. Initial attempts to amplify T. parva sequences from this DNA using the TPR1 primers IL194 and IL197 were unsuccessful, probably due to the presence of Thermus aquaticus thermostable polymerase in-

Carrier state of Theileria parva detected by PCR

223

4

5

6

7

8

9

10

1-3 kb872 bp 605 bp310 bp-

3 4 5 6

7

8

9

10

n

Fig. 5. Amplification of Theileria parva TPRl sequences from purified DNA made from blood of carrier cattle. (A) Samples of whole blood DNA from T. parva-'miected cattle electrophoresed on 13 % agarose and visualized under UV by ethidium bromide staining after amplification by the polymerase chain reaction using oligonucleotide primers IL194 and IL197 (Fig. 1). See text for details. (1) No DNA control; (2) T. p. parva Muguga piroplasm DNA; (3) animal G94; (4) animal G95; (5) animal F200; (6) animal E199; (7) animal F338; (8) animal F374; (9) animal E166; (10) animal E211. See Table 2 for details of these cattle. (B) Southern blot of gel shown in (A) probed with T. p. parva Marikebuni oligonucleotide IL159 and washed in 5 x SSC at 53 CC for 15 min. (C) Southern blot of gel shown in (A), stripped with 04 M NaOH, re-probed with T. p. bovis Boleni repetitive sequence pBOLREPl and washed in 0-1 x SSC, 0-1 % SDS, at 65 °C for 1 h. hibitors in bovine blood (Higuchi, 1989). The DNA was therefore further purified by shearing, boiling and passage through a spun column of G50 Sephadex. After this treatment TPRl PCR amplification products were obtained from 5 cattle. A PCR amplification product of the expected size (390 bp) was visible, following agarose gel electrophoresis and ethidium bromide staining, in samples from 2 T. p. bovis Boleni, 2 T. p. parva Marikebuni and 1 of 2 T. p. lawrencei 7014-infected cattle (Fig. 5 A). No products were visible in the case of 2 T. p. parva Muguga-infected cattle (Fig. 5A, tracks 3, 4). A

control reaction containing no DNA gave no product (Fig. 5 A, track 1) and no product was obtained from 2 uninfected control cattle (not shown), strongly indicating that the observed products were not the result of contamination with extraneous T. parva DNA. This was further supported by the absence of a PCR amplification product in the case of the 2 T. p. parva Muguga and 1 T. p. lawrencei 7014 animals. In order to characterize the observed T P R l PCR products further, the gel shown in Fig. 5 A was Southern-blotted and probed with the stock-specific probes described above. Probing of the filter with the

R. Bishop and others

IL159 oligonucleotide, derived from T. p. parva Marikebuni DNA sequences, resulted only in hybridization to products amplified from the Marikebuni-infected cattle F338 and F374 (Fig. 5B, tracks 7, 8). When the filter was stripped and reprobed with the T. p. bovis Boleni repetitive sequence pBOLREPl, hybridization occurred only to products amplified from the Boleni infected cattle F202 and F199 (Fig. 5C, tracks 5, 6). Hybridization of 2 probes derived from TPR1 -related sequences to the observed PCR amplification products confirmed that these amplification products were homologous to T P R 1 . The fact that only PCR products, amplified from cattle infected with the T. parva stock for which the probe was specific, hybridized to a particular probe provided strong evidence that these PCR products originated from carrier parasites. The nature of the PCR product from the 2 T. p. bovis Boleni-infected animals was further verified by direct DNA sequencing. High degrees of homology were observed with the sequence of the Boleni repetitive plasmid clone pBOLREPl, including a 118 bp 100% match. An experiment was also carried out to attempt to directly detect T. parva sequences in carrier cattle without the use of PCR amplification. A radioisotope labelled TPR1 plasmid clone, PMB3 (Allsopp & Allsopp, 1988), was used to probe dotblotted whole-blood DNA from the same 8 longterm T. parva-infected cattle used in the PCR experiments. The PMB3 probe, when labelled by nick translation to a specific activity of 1-5 x 108 cpm/fig, did not give any detectable signal with up to 10 jig of carrier animal blood DNA from any of the 8 cattle (not shown), although 5 had been detected as positive using PCR amplification. PCR amplification of Theileria parva sequences from blood of carrier cattle without DNA purification Direct PCR amplification from blood was attempted using blood from 18 cattle infected with T. parva for periods ranging from 2 to 30 months. Four animals were infected with T. p. parva Pemba Mnarani, 6 animals were infected with T. p. parva Muguga and 8 animals were infected with the T. p. parva Marikebuni stock. The 8 Marikebuni-infected animals and 1 of the Pemba Mnarani-infected animals were proven carriers on the basis of their ability to transmit T. parva (see Table 2 for details of these animals). Blood from the Marikebuni-infected animals was tested for the presence of piroplasms by light microscopic examination of Giemsa-stained smears at the same time as samples were taken for PCR. Five animals (962, 963, 972, 973, and 978) were positive at approximately 1/1000 erythrocytes while in 3 animals (954, 971 and 979) no parasites were detected by microscopic examination. Initial experiments, in which 100 /*1 aliquots of

224

processed blood were resuspended in PCR buffer and incorporated in PCR reactions using the TPR1 primers IL194 and IL197, yielded no visible amplification. When 1 fi\ of processed blood was diluted into a further 100/^1 of PCR buffer prior to amplification, a product visible by ethidium bromide staining was observed for 4 out of 8 Marikebuniinfected cattle and 2 out of 4 Pemba Mnaraniinfected cattle, but not for any of the 6 Mugugainfected cattle. Dilution of the sample thus appeared to be necessary for amplification. The results for the Marikebuni-infected animals and for 4 of the Muguga-infected animals are shown in Fig. 6 A. The gel was blotted and probed with the Marikebunispecific oligonucleotide IL159. A positive reaction was apparent with all 8 Marikebuni-infected animals (Fig. 6B, tracks 4-11), but not with the samples from the 4 Muguga-infected animals or the DNA-negative control (Fig. 6B, tracks 12-15 and 1). Re-probing of this gel with the TPR1 plasmid clone, PMB3, also gave a negative result on the Muguga samples. The reactivity of the IL159 Marikebuni-specific oligonucleotide with the PCR amplification products generated from the blood of the 8 Marikebuniinfected animals provided strong evidence that the observed products were the result of amplification of DNA from parasites present in these carrier animals. To investigate whether PCR could be applied to blood samples collected under field conditions, 50 fi\ of blood samples from 3 Marikebuni-infected animals (954, 972 and 973) were spotted on to nitrocellulose. These samples were kept at ambient temperature for up to 10 weeks and then processed for PCR as for the frozen whole-blood samples. The equivalent of 5 fi\ of whole blood was used for the PCR and products visible by ethidium bromide staining were obtained for all 3 animals (Fig. 7 A, t tracks 2, 3 and 4) after 3 weeks but not after 10 weeks. Probing of a blot of the gel shown in Fig. 7 A with the IL159 oligonucleotide resulted in hybridization to PCR products derived from all 3 cattle (Fig. 7B, tracks 2, 3, 4). The strongest hybridization was to the product derived from animal 973 (Fig. 7B, track 4). Re-probing of this blot, after stripping, with the T. p. parva Muguga-derived TPR1 probe PMB3, also resulted in hybridization to all products (Fig. 7C, tracks 2, 3, 4) but with the product from 954 now reacting most strongly. The differential hybridization of the PCR products with the IL159 and PMB3 TPR1 probes demonstrated the existence of genetic heterogeneity among the carrier parasites present in these 3 Marikebuni-infected cattle. Amplification of DNA from carrier cattle blood was also carried out using primers derived from the gene encoding for a T. p. parva 67 kDa sporozoite antigen, p67. Whole blood (1 /i\ equivalent) from 4 Marikebuni-infected cattle was processed as before and PCR performed using the p67 primers IL144 and IL145. PCR products visible by ethidium

Carrier state of Theileria parva detected by PCR

225

A 1 2 3

4 5 6 7 8 9

1011 12 13 H 15

123

4 5 6 7 8 9

1011 1213 1415

bp

310-

Fig. 6. Amplification of Theileria parva T P R l DNA sequences from blood of carrier cattle without DNA purification. (A) Samples of blood from T. parua-infected cattle electrophoresed on 1-3% agarose after amplification by the PCR using oligonucleotide primers IL194 and IL197. See text for details. (1) No DNA control; (2) T. p. parva Muguga in piroplasm DNA; (3) T. p. parva Marikebuni piroplasm DNA; (4) animal 954; (5) animal 978; (6) animal 962; (7) animal 963; (8) animal 971; (9) animal 972; (10) animal 973; (11) animal 979; (12) animal G i l l ; (13) animal G101; (14) animal G90; (15) animal F40. See Table 2 for details of these cattle. (B) Southern blot of gel shown in (A) probed with oligonucleotide IL159 and washed in 5 x SSC at 53 °C for 15 min.

1 2

3

4

5 6

1 2

3

4

5 6 7

1 2

3 4

5

6 7

bp

Fig. 7. Amplification of Theileria parva T P R l DNA sequences from carrier cattle blood stored at ambient temperature. (A) 13 % agarose gel showing samples of blood from T. parva-'miected cattle which had been spotted onto nitrocellulose and kept at ambient temperature for 3 weeks and then amplified, using the PCR, with oligonucleotide primers IL194 and IL197. See text for details. (1) No DNA control; (2) animal 954; (3) animal 972; (4) animal 973; (5) T. p. parva Muguga-infected lymphoblastoid cell DNA; (6) T. p. parva Marikebuni-infected lymphoblastoid cell DNA; (7) T. p. parva Muguga piroplasm DNA. See Table 2 for details of the cattle. (B) Southern blot of gel shown in (A) probed with oligonucleotide IL159 and washed in 5 x SSC at 53 °C for 15 min. (C) Southern blot shown in (A) stripped with 0 4 M NaOH and re-probed with T. p. parva T P R l clone PMB3 and washed in 1 x SSC, 0-1 % SDS at 65 °C for 1 h.

R. Bishop and others

1 2

226

3

4

5

6 7

1

2

3

4

5 6 7

Fig. 8. Amplification of Theileria parva p67 DNA sequences from blood of carrier cattle. (A) Samples of cattle blood electrophoresed on 1-3 °/o agarose after amplification by the PCR using p67 oligonucleotide primers IL144 and IL145. See text for details. (1) No DNA control; (2) T. p. parva Marikebuni-infected lymphoblastoid cell DNA; (3) animal 954; (4) animal 972; (5) animal 973; (6) animal 979; (7) animal 972 (amplified in an alternative PCR buffer containing 0-1 % gelatin instead of 0-5 ° 0 Tween 20). (B) Southern blot of gel shown in (A) probed with a plasmid clone containing the p67 gene and washed in 01 x SSC, 0-1 % SDS at 65 °C for 1 h. bromide staining were obtained from all 4 cattle (Fig. 8A, tracks 3—6), demonstrating that primers derived from a single copy gene (Nene et al. 1991) could be used for detection of T. parva DNA in carrier cattle. Probing of a blot of the gel shown in Fig. 8 A with a plasmid clone containing the p67 gene resulted in hybridization to all PCR products (Fig. 8B). This confirmed that these products were derived from the T. parva 67 kDa antigen gene and were not the result of mispriming on bovine sequences. Restriction fragment length polymorphisms (RFLPs) between parasites isolated from Theileria parva parva Marikebuni-infected carrier cattle DNA was made from infected lymphoblastoid cell cultures established either directly from a T. p. parva Marikebuni-infected carrier animal (animal 963) or from cattle infected by clean ticks which had fed on Marikebuni carrier cattle (animals 971, 972, 973, 979 and 954). This DNA together with DNA derived from several reference Marikebuni isolates of known origin (see Table 3 for details) was used for Southern blot analysis of RFLPs. When a blot of EcoRl-digested DNA was probed with a radio-

isotope labelled TPR1 plasmid clone, pgTpM-23 (Conrad et al. 1987), 3 major patterns were apparent among 9 infected lymphocyte DNAs derived from 6 Marikebuni carrier cattle (Fig. 9 A, tracks 2-10 and Fig. 9B, 1-2). Minor RFLP differences were also apparent between the DNAs showing broadly similar patterns. Seven of the parasites isolated from the carrier cattle showed patterns similar to the pattern exhibited by a twice-cloned cell line (Fig. 9 A, track 16) made by in vitro infection of peripheral blood lymphocytes with sporozoites from the 3014 Marikebuni stabilate (Goddeeris et al. 1990). The pattern shown by the parasite derived from carrier animal 973 (Fig. 9 A, track 7) was similar to that of 4 other previously characterized Marikebuni cell lines (Fig. 9A, tracks 12-15). The pattern of the line established directly from carrier animal 963, 7 months after infection (Fig. 9 A, track 2 and Fig. 9B, track 1), was not similar to any of the other isolates from carrier cattle, including the 3-month isolate from the same animal. The 7-month isolate from 963 was also not similar to any of the reference Marikebuni-infected cell lines. The parasites isolated from the Marikebuni-infected carrier cattle were thus heterogeneous, at least with respect to the genomic arrangement of their TPR1 genes.

227

Carrier state of Theileria parva detected by PCR T a b l e 3. Theileria parva parva Marikebuni-infected lymphoblastoid cell D N A samples probed with T P R 1 repetitive D N A clone Lane 2 3 4 5 6 7 8 9 10 11 12f 13f 14f 15J \b%

Description of cell line* PBL isolated from cow no. 963. 6 months p.i. PBL isolated from cow no. 402 after tick infection. Clean ticks applied to cow no. 971. 6 months p.i. PBL isolated from cow no. 554 after tick infection. Clean ticks applied to cow no. 972. 3 months p.i. PBL isolated from cow no. 273 after tick infection. Clean ticks applied to cow no. 963. 3 months p.i. PBL isolated from cow no. 963. 3 months p.i. PBL isolated from cow no. 560 after tick infection. Clean ticks applied to cow no. 973. 3 months p.i. PBL isolated from cow no. 407 after tick infection. Clean ticks applied to cow no. 972. 6 months p.i. PBL isolated from cow no. 427 after tick infection. Clean ticks applied to cow no. 979. 6 months p.i. PBL isolated from cow no. 559 after tick infection. Clean ticks applied to cow no. 954. 3 months p.i. In vitro sporozoite infection with stabilate made from clean ticks applied to control cow 980 which was infected with sporozoite stabilate no. 3014 PBL isolated from cow no. B273 infected with sporozoite stabilate no. 1581 PBL isolated from cow no. F13 infected with sporozoite stabilate no. 2246 PBL isolated from cow no. 171. Tick infection with cloned parasite derived from sporozoite stabilate no. 3014. PBL from cow no. D232 infected in vitro with sporozoite stabilate no. 3014. Infected cells twice cloned by limiting dilution. PBL from cow no. D409 infected in vitro with sporozoite stabilate no. 3014. Infected cells twice cloned by limiting dilution

* PBL, peripheral blood lymphocytes. f Morzaria, Spooner and Dolan, unpublished observations. % Goddeeris et al. (1990).

Amplification of Theileria parva sequences from bovine lymph node biopsies and infected tick salivary glands A lymph-node biopsy was taken from a T. p. parva Muguga-infected animal, which showed a schizont parasitosis of < 1/1000 on day 8 after infection. A biopsy was also taken from an animal which did not exhibit a detectable schizont parasitosis. PCR amplification of the lymph node material using the TPR1 repetitive primers generated a product visible by ethidium bromide staining from the schizont-positive animal (Fig. 10 upper section, track 2) but not from the negative animal (Fig. 10 upper section, track 1). Probing of these amplification reactions with an oligonucleotide derived from T. p. parva Muguga TPR1 sequences (Allsopp et al. 1989) resulted in hybridization to the product from the schizont-positive animal but no reactivity with the negative animal (Fig. 10 lower section, tracks 1 and 2 respectively). Amplification using the TPR1 repetitive primers was also carried out on 3 dissected R. appendiculatus salivary glands containing a single T. parva-iniected acinus and 1 salivary gland which was negative for

T. parva infection. The infected salivary glands were derived from ticks which had fed on cattle coinfected with T. p. parva Muguga and T. p. parva Uganda. Amplification products visible by ethidium bromide staining were obtained from the 3 infected salivary glands (Fig. 10 upper section, tracks 3, 5 and 6) but not from the uninfected salivary gland (Fig. 10 lower section, track 4). Probing of these products with the T. p. parva Muguga-specific oligonucleotide resulted in weak hybridization to the infected salivary gland products. This suggested that the ticks may have picked up principally T. p. parva Uganda parasites from the co-infected cattle. No hybridization was observed to the uninfected salivary gland amplification mix (Fig. 10 lower section, track 4). DISCUSSION

This study has demonstrated that the PCR using T. parva-specific primers is capable of detecting T. parva parasites present at low parasitaemias in carrier cattle and can be applied to samples collected under field conditions. In some instances it was also possible to identify the specific T. parva stock by

R. Bishop and others

228 B

1

2

3

4

5

6 7

8

1

9 10 11 12 13 14 15 16

KB

2

kb

2-320-

Fig. 9. Probing of DNA from Theileria parva parva Marikebuni-infected carrier cattle cell culture isolates with Theileria parva parva Muguga TPR1 clone pgTpM-23. Each lane contains 20 fig of infected lymphoblastoid cell DNA digested for 4 h with 80 units of EcoRI. The fragments were separated on a 0-8% agarose gel prior to blotting onto Hybond N +. Hybridization with random primed pgTPM-23 was at SO °C and the filter was washed in 2 x SSC, 01 % SDS at 55 °C for 1 h. (A) (1) T. p. parva Muguga piroplasm DNA (1 fig); (2)-(10) Infected lymphoblastoid cell DNA from T. p. parva Marikebuni carrier cattle (infected with sporozoite stabilate no. 3014); (11)—(16) infected lymphoblastoid cell DNA from T. p. parva Marikebuni reference cell lines. See Table 3 for details. (B) (1) as (A) lane 2; (2) as (A) lane 4.

hybridization of PCR amplification products with TPR1 plasmid DNA probes or synthetic oligonucleotides derived from TPR1 sequences. Amplification of parasite DNA using the PCR has advantages over other methods of detecting animals persistently infected with T. parva. It is more sensitive than parasite detection by light microscopy as shown by the fact that in only 5 out of 8 T. p. parva Marikebuni-infected carrier animals could piroplasms be detected by microscopic examination whereas all 8 animals were demonstrated positive by PCR amplification in combination with hybridization using a Marikebuni-specific TPR1 oligonucleotide probe. The principal method used previously in large-scale surveys to detect animals persistently infected with T. parva (FAO, 1975; Young et al. 1986) has been the schizont antigen indirect fluorescent antibody (IFA) test (Burridge & Kimber, 1972; Goddeeris et al. 1982). Serological methods are sensitive but suffer from the disadvantage that they may sometimes give positive reactions with animals which are no longer infected with parasites. As an example, 2 of the T. p. parva Muguga-infected animals used in the study, F i l l and F40, exhibited positive IFA titres although parasites were not detected by PCR amplification. Conversely, it has been shown that serological

methods may not always detect carriers whose infection can be confirmed by xeno-diagnosis (Dolan, 1986). The schizont IFA also suffers from the problem of cross-reactivity with T. taurotragi (Grootenhuis et al. 1979), whereas the TPR1 and 67 kDa sporozoite antigen gene primers used for PCR did not yield specific amplification products with either T. taurotragi or T. mutans DNA. PCR amplification therefore has advantages of specificity compared to serology. Demonstration of transmission of theileriosis to susceptible animals, after isolation by tick feeding, is not practical as a routine test and may not always detect actual carriers. In this study 2 T. p. bovis-'mitct&A animals (F202 and F199) and 1 T. p. lawrencei-iniected animal (E211) failed to transmit T. parva to ticks although parasites were detected in these cattle by PCR amplification. This could be due to failure of the ticks to either pick up or transmit the parasite; alternatively, the parasites may not have been available for pick up at the time of tick application, as intermittent transmission has been demonstrated (Dolan, 1986). The utility of PCR detection assays for carrier animals could be improved by avoiding the use of agarose gels, u.v. transilluminators and radio-isotope labelled probes. One possibility would be slotblotting of the PCR products on to a membrane

Carrier state of Theileria parva detected by PCR

bp

•

1

2

3

4

5

6

7

8

9

1300872 605

310-

Fig. 10. Amplification of Theileria parva sequences from infected bovine lymph node biopsies and tick salivary glands. Upper section: samples of lymph node or salivary gland electrophoresed on 1 2 % agarose after amplification by the PCR using TPR1 primers IL194 and IL197. See text for details, Lower section: Southern blot of gel in upper section probed with radioisotope labelled T. p. parva Muguga oligonucleotide VI (Allsopp et al. 1989) and washed in 5 x SSC at 60 °C for 15 min. (1) Lymph node biopsy: schizont negative T. p. parva Muguga-infected cow; (2) lymph node biopsy: schizont positive T. p. parva Muguga-infected cow; (3), (5), (6) T. parva-infected tick salivary glands; (4) uninfected tick salivary gland; (7) PCR negative control (no DNA); (8) T. p. parva Muguga DNA; (9) size marker: x 174 digested with restriction enzyme HaelU.

followed by detection with a biotinylated, or directly enzyme-conjugated, oligonucleotide (McLaughlin et al. 1987) complementary to a sequence within the amplified region. If stock-specific detection was required then TPR1 primers could be employed for amplification, followed by hybridization using a stock-specific oligonucleotide derived from sequences within the amplified section of T P R 1 . For T. parva species-specific detection, amplification with the p67 primers would be more suitable. Another possibility would be to carry out a small number of cycles of PCR with a second pair of specific primers situated inside the first pair as described by Kemp et al. (1989). A site for a doublestranded DNA binding protein could be incor-

229

porated into one primer to allow purification of the PCR product by capture using double-strand DNA binding protein immobilized on a solid phase. The other could be biotinylated to allow enzymatic detection in conjunction with horseradish peroxidase streptavidin conjugate. This strategy has the advantage that it could be adapted for use with standard ELISA technology. No parasite DNA was amplified by PCR from any of the 7 T. p. parva Muguga-infected animals examined although parasite DNA was amplified from cattle infected with 4 other T. parva stocks. This correlates with the fact that a carrier state has never been demonstrated in T. p. parva Muguga by tick transmission (Young et al. 1990) and suggests that, unlike most other T. parva stocks, T. p. parva Muguga may be eliminated by the bovine immune system following recovery. Since the efficiency of PCR applied to whole blood or blood-derived DNA is unknown, failure to observe a PCR product does not prove that T. parva parasites were not present in low numbers. Assuming that there are approximately 100 copies of TPR1 in the T. p. parva Muguga genome (Baylis et al. 1991), then a single T. parva organism should contain approximately 5 x 10~5 pg of the sequence amplified by the TPR1 primers. Given also that a nick-translated probe can detect less than 1 pg of homologous target (Zolg, Andrade & Stock, 1987), target amplification of 20000-fold, in conjunction with hybridization to a nick-translated TPR1 probe, would have been sufficient for detection of a single parasite. Thus, even if T. p. parva Muguga-infected animals had contained only a single parasite in the 1 ji\ of blood used for PCR amplification, an amplification efficiency 50-fold less than that in a typical PCR reaction (Erlich, 1989) would have resulted in a detectable product. Southern blot analysis of parasites isolated from T. p. parva Marikebuni-infected carrier cattle, using a TPR1 probe, suggests that more than one component of the Marikebuni stock can induce a carrier state and that these may differ considerably from the parent stock, at least with respect to the genomic organization of the TPR1 sequences. Maritim et al. (1989) reached a similar conclusion regarding parasites present in T. p. lawrencei-intected carrier cattle. They observed that animals infected by ticks fed on carrier animals were sometimes susceptible to challenge with the parent stock which was used to infect the carrier animal. Amplification of DNA using the PCR has been applied to TPR1 homologous sequences in the T. p. parva Marikebuni genome to develop an oligonucleotide probe which is specific for the T. p. parva Marikebuni stock among those stocks so far tested. TPR1-derived oligonucleotide probes providing + discrimination for other T. parva stocks have been reported previously (Allsopp et al. 1989). The ability to identify Marikebuni is, however, particularly

230

R. Bishop and others important, since this stock has been extensively characterized in terms of ability to cross-protect against other stocks (Morzaria et al. 1987; Mutugi et al. 1989) and is currently being employed in immunization trials in Kenya (Mutugi et al. 1990). This study has also shown that PCR amplification can be used to detect T. parva schizont DNA in lymph node biopsies and T. parva sporozoite DNA in dissected tick salivary glands. The technique has potential for early detection of T. parva-intected cattle, which would be valuable since serological responses detectable by the schizont IFA are not present until 2—4 weeks after infection (Burridge & Kimber, 1972). Amplification of DNA using the PCR should also be useful for differentiation of T. parva from the morphologically similar sporozoites of T. taurotragi in infected R. appendiculatus salivary glands. In conclusion, PCR amplification of DNA using parasite-specific primers represents a potentially powerful tool for epidemiological studies in theileriosis. We are grateful to Mr J. Kiarie, Mr R. Njamunggeh and Mr L. Juma for providing technical assistance. We thank the ILRAD Tick Unit staff for performance of tick transmission experiments. Blood samples from T. p. parva Muguga-infected cattle were kindly provided by Dr P. Rwambo. This is ILRAD publication no. 991.

REFERENCES ALLSOPP, B. A. & ALLSOPP, M. T. E. p. (1988). Theileria

parva: genomic DNA studies reveal intra-specific sequence diversity. Molecular and Biochemical Parasitology 28, 77-84. ALLSOPP, B. A., CARR1NGTON, M., BAYLIS, H., SOHAL, S.,

DOLAN, T. T. & IAMS, K. (1989). Improved

characterisation of Theileria parva isolates using the polymerase chain reaction and oligonucleotide probes. Molecular and Biochemical Parasitology 35, 137-48. AUSUBEL, F. M., BRENT, R., KINGSTON, R. E., MOORE, D. D., SMITH, J. A., SEIDMAN, J. A. & STRUHL, K. ( 1 9 8 7 ) .

Current Protocols in Molecular Biology. New York: J. Wiley. BAILEY, K. p. (1960). Notes on the rearing of Rhipicephalus appendiculatus and their infection with Theileria parva for experimental transmission. Bulletin of Epizootic Diseases of Africa 8, 33^43. BARNETT, s. F. & BROCKLESBY, D. w. (1966). Passage of

Theileria lawrencei (Kenya) through cattle. British Veterinary Journal 122, 396-409. BAYLIS, H. A., SOHAL, S. K., CARRINGTON, M., BISHOP, R. P.

& ALLSOPP, B. A. (1991). An unusual repetitive gene family in Theileria parva which is stage specifically transcribed. Molecular and Biochemical Parasitology (in the Press). BROWN, c. G. D. (1979). Propagation of Theileria. In Practical Tissue Cultures Application (ed. Maramorosch, K. & Hirumi, H.), pp. 223^-5. New York: Academic Press. BURRIDGE, M. j . & KIMBER, c. D. (1972). The indirect

fluorescent antibody test for experimental East Coast

Fever (Theileria parva infection of cattle): evaluation of a cell culture schizont antigen. Research in Veterinary Science 13, 4511-15. CONRAD, P . A., IAMS, K., BROWN, W. C , SOHANPAL, B. &

OLE-MOI YOI, o. (1987). DNA probes detect genomic diversity in Theileria parva stocks. Molecular and Biochemical Parasitology 25, 213-26. CUNNINGHAM, M. P . , BROWN, C. G. D., BURRIDGE, M. J. &

PURNELL, R. E. (1973). Cryopreservation of infective particles of Theileria parva. International Journal for Parasitology 3, 583-7. DOLAN, T. T. (1986). Chemotherapy of East Coast fever: The long term weight changes, carrier state and disease manifestations of parvaquone treated cattle. Journal of Comparative Pathology 96, 137-46. ERLICH, H. A. (1989). Basic methodology. In PCR Technology : Principles and Applications for DNA Amplification (ed. Erlich, H. A.), pp. 1-5. New York: Stockton Press. FAO (1975). Epizootological survey on tick borne cattle diseases - Kenya. AG:DP/KEN/7OO/5221, Technical Report 1, U N D P / F A O Rome. FEINBERG, A. p. & VOGELSTEIN, B. (1983). A technique for

radiolabelling DNA restriction fragments to high specific activity. Analytical Biochemistry 132, 6-13. DE FRANCHIS, R., CROSS, N. C. P . , FOULKES, N. S. & COX,

T. M. (1988). A potent inhibitor of Taq polymerase copurifies with human genomic DNA. Nucleic Acids Research 16, 1035. GODDEERIS, B. M., KATENDE, J. M., IRVIN, A. D. & CHUMO,

R. s. c. (1982). Indirect fluorescent antibody test for experimental and epizootiological studies on East Coast Fever (Theileria parva infection of cattle). Evaluation of a cell culture schizont antigen fixed and stored in suspension. Research in Veterinary Science 33, 360-5. GODDEERIS, B. M., MORRISON, W. I., TOYE, P. G. & BISHOP,

R. (1990). Strain specificity of bovine Theileria parvaspecific cytotoxic T cells is determined by the phenotype of the restricting class I MHC. Immunology 69, 38-*4. GROOTENHUIS, J. G., YOUNG, A. S., DOLAN, T. T. & STAGG,

D. A. (1979). Characteristics of Theileria species (eland) infections in eland and cattle. Research in Veterinary Science 27, 59-68. HIGUCHI, R. (1989). Simple and rapid preparation of samples for PCR. In PCR Technology : Principles and Applications for DNA Amplification (ed. Erlich, H. A.), pp. 31-38. New York: Stockton Press. IRVIN, A. D., DOBBELAERE, D. A. E., MWAMACHI, D. M., MINAMI, M., SPOONER, P . R. & OCAMA, J. G. R. ( 1 9 8 3 ) .

Immunisation against East Coast fever: Correlation between monoclonal antibody profiles of Theileria parva stocks and cross immunity in vivo. Research in Veterinary Science 35, 341-6. KANEKO, S., MILLER, R. H., FEINSTONE, S. M., UNOURA, M., KOBAYASHI, K., HATTORI, N. & PURCELL, N. ( 1 9 8 9 ) .

Detection of serum hepatitis B virus DNA in patients with chronic hepatitis using the polymerase chain reaction assay. Proceedings of the National Academy of Sciences, USA 86, 312-16. KAWASAKI, E. s. (1990). Sample preparation from blood, cells, and other fluids. In PCR Protocols : a Guide to Methods and Applications (ed. Innis, M. A., Gelfand,

Carrier state of Theileria parva detected by PCR D. H., Sninksy, J. J. & White, T. J.), pp. 146-52. New York: Academic Press. KEMP, D. J., SMITH, D. B., FOOTE, S. J., SAMARAS, N. &

PETERSON, G. M. (1989). Colorimetric detection of specific DNA segments amplified by polymerase chain reactions. Proceedings of the National Academy of Sciences, USA 86, 2423-7. KREITMAN, M. & LANDWEBER, L. F. (1989). A strategy for

producing single-stranded DNA in the polymerase chain reaction. Gene Analysis Techniques 6, 84-8. MANIATIS, T., FRITSCH, E. G. & SAMBROOK, J. ( 1 9 8 2 ) .

Molecular Cloning: a Laboratory Manual. Cold Spring Harbour, New York: Cold Spring Harbour Laboratory. MANIATIS, T., FRITSCH, E. G. & SAMBROOK, J. ( 1 9 8 9 ) .

Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbour, New York: Cold Spring Harbour Laboratory. MARITIM, A. C , YOUNG, A. S., LESAN, A. C , NDUNGU, S. G.,

MUTUGI, j . j . & STAGG, D. A. (1989). Theilerial parasites isolated from carrier cattle after immunization with Theilera parva by the infection and treatment method. Parasitology 99, 139-47. MCLAUGHLIN, G. L., RUTH, J. L., JABLONSKI, E., STEKETEE,

R. & CAMBELL, G. H. (1987). Use of enzyme-linked synthetic DNA in diagnosis of falciparum malaria. Lancet i, 714-16. MARITIM, A. C , KARIUKI, D. P . , YOUNG, A. S. & MUTUGI,

J. J. (1990). The importance of the carrier state of Theileria parva in the epidemiology of theileriosis and its control by immunization. In Theileriosis in Eastern Central and Southern Africa (ed. Dolan, T. T.), pp. 121-28. Nairobi: ILRAD. MINAMI, T., SPOONER, P. R., IRVIN, A. D., OCAMA, J. G. R.,

231 MUTUGI, J.J., YOUNG, A. S., MARITIM, A. C , NDUNGU, S. K. MINING, S. K., LINYONYI, A., NGUMI, P. N . , LEITCH, B. L., MORZARIA, S. P. & DOLAN, T. T. ( 1 9 8 9 ) .

Immunization of cattle in Coast Province Kenya: laboratory evaluation of a Theileria parva parva stabilate for use in infection and treatment immunization in the field. Research in Veterinary Science 47, 170-7. NENE, V., IAMS, K. P . , GOBRIGHT, E. & MUSOKE, A. J.

(1991). Characterisation of the gene encoding a candidate vaccine antigen of Theileria parva sporozoites. Molecular and Biochemical Parasitology (in the Press). OU, C. Y., KWOK, S., MITCHELL, S. W., MACK, D. H., SNINSKY, J. J., KREBS, J. W., FEORINO, P . , WARFIELD, D. &

SCHOCHETMAN, G. (1988). DNA amplification for direct detection of HIV-1 in DNA of peripheral blood mononuclear cells. Science 238, 295-7. RADLEY, D. E., BROWN, C. G. D., BURRIDGE, M. J., CUNNINGHAM, M. P . , KIRIMI, I. M., PURNELL, R. E. &

YOUNG, A. s. (1975). East Coast fever, 1. Chemoprophylactic immunization of cattle against Theileria parva (Muguga) and five theilerial strains. Veterinary Parasitology 1, 35-41. SAIKI, R. K., BUGAWAN, T. L., HORN, G. T., MULLIS, K. B. &

ERLICH, H. A. (1986). Analysis of enzymatically amplified /J-globin and HLA-DQa DNA with allele specific oligonucleotide probes. Nature, London 324, 163-6. SAIKI, R. K., GELFAND, D. H., STOFFEL, S., SCHARF, S. J., HIGUCHI, R., HORN, G. T., MULLIS, K. B. & ERLICH, H. A.

(1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239,487-91.

DOBBELAERE, D. A. E. & FUJINAGA, T. ( 1 9 8 3 ) .

SANGER, F., NICKLEN, S. & COULSON, A. R. (1977). D N A

Characterisation of stocks of Theileria parva by monoclonal antibody profiles. Research in Veterinary Science 35, 334-40.

sequencing with chain terminating inhibitors. Proceedings of the National Academy of Sciences, USA 74, 5463-7. SOUTHERN, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. Journal of Molecular Biology 98, 503-17.

MORZARIA, S. P . , IRVIN, A. D., TARACHA, E., SPOONER, P. R., VOIGT, W. P . , FUJINAGA, T. & KATENDE, J. ( 1 9 8 7 ) .

Immunization against East Coast fever: The use of selected stocks of Theileria parva for immunization of cattle exposed to field challenge. Veterinary Parasitology 23, 22-41. MORZARIA, S. P . , SPOONER, S. P . , BISHOP, R. P . , MUSOKE,

A. j . & YOUNG, j . R. (1990). Sfil and Notl polymorphisms in Theileria stocks detected by pulsed field gel electrophoresis. Molecular and Biochemical Parasitology 40, 203-12. MULLIS, K. B. & FALOONA, F. (1987). Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods in Enzymology 155, 335-50. MUTUGI, j . j . (1986). Transmission studies of a pathogenic strain of Theileria mutans. In ACIAR Proceedings Number 17 (ed. Sutherst, R. W.), pp. 95-6. Canberra: Australian Centre For International Agricultural Research. MUTUGI, J. J., LAMPARD, D., YOUNG, A. S., NDUNGU, S. G., LINYONYI, A., MARITIM, A. C , MINING, S. K., NGUMI, P. N . , KARIUKI, D. P . , WILLIAMSON, S. M., AWICH, J. R. &

LESAN, A. c. (1990). Recent immunization trials against Theileria parva parva infections in Kenya. In Progress Towards the control of East Coast Fever (Theileriosis) in Kenya (ed. Young, A. S., Mutugi, J. J. & Maritim, A. C ) , pp. 72-79. Nairobi: KARL

STAGG, D. A., YOUNG, A. S., LEITCH, B. L., GROOTENHUIS,

j . G. & DOLAN, T. T. (1983). Infection of mammalian cells with Theileria species. Parasitology 86, 243-54. STURM, N . R., DEGRAVE, W., MOREL, C. & SIMPSON, L.

(1989). Sensitive detection and schizodeme classification of Trypanosoma cruzi cells by amplification of kinetoplast minicircle DNA sequences: use in diagnosis of Chagas' disease. Molecular and Biochemical Parasitology 33, 205-14. UILENBERG, G. (1981). Theilerial species of domestic livestock. In Advances in the Control of Theileriosis (ed. Irvin, A. D., Cunningham, M. P. & Young, A. S.), pp. 4-37. The Hague: Martinus Nijhoff. YOUNG, A. s. & LEITCH, B. L. (1982). Epidemiology of

East Coast fever: some effects of temperature on the development of Theileria parva in the tick vector, Rhipicephalus appendiculatus. Parasitology 83, 199-211. YOUNG, A. S., LEITCH, B. L., NEWSON, R. L. &

CUNNINGHAM, P. M. (1986). Maintenance of Theileria parva parva infections in an endemic area of Kenya. Parasitology 86, 519-28. YOUNG, A. S., MUTUGI, J. J., KARIUKI, D. P . , MARITIM, A. C , 17-2

R. Bishop and others LINYONYI, A., MINING, S. K., KWENA, A., NGUMI, P. N., NDUNGU, S. G., LESAN, A. C , LAMPARD, D., AWICH, J. R., STAGG, D. A., LEITCH, B. L., WILLIAMSON, S. M. &

GROOTENHUIS, j . G. (1990). The epidemiology of theileriosis and other tick borne diseases in relationship to immunization against East Coast fever. In Progress Towards the Control of East Coast Fever (Theileriosis) in Kenya (ed. Young, A. S., Mutugi, J. J. & Maritim, A. C), pp. 49-65. Nairobi: KARL

232 YOUNG, R. A., MEHRA, V., SWEETSER, D., BUCHANAN, T., CLARK-CURTIS, J., DAVIS, R. W. & BLOOM, B. R. ( 1 9 8 5 ) .

Genes for the major protein antigens of the leprosy parasite Mycobacterium leprae. Nature, London 316, 450-2. ZOLG, J. W., ANDRADE, E. L. & SCOTT, E. D. ( 1 9 8 7 ) .

Detection of Plasmodium falciparum DNA using repetitive DNA clones as species specific probes. Molecular and Biochemical Parasitology 22, 145-51.