JOURNAL OF CLINICAL MICROBIOLOGY, Nov. 1992, p. 2847-2851

Vol. 30, No. 11

0095-1137/92/112847-05$02.00/0

Copyright © 1992, American Society for Microbiology

Detection of Chlamydia trachomatis in Endocervical Specimens by Polymerase Chain Reaction M. J. LOEFFELHOLZ,* C. A. LEWINSKI, S. R. SILVER, A. P. PUROHIT, S. A. HERMAN, D. A. BUONAGURIO, AND E. A. DRAGON Roche Molecular Systems, 1080 U.S. Highway 202, Branchburg, New Jersey 08876-1760 Received 12 June 1992/Accepted 27 August 1992

A rapid and sensitive polymerase chain reaction (PCR)-based assay for detection of Chlamydia trachomatis in cervical specimens is described. This assay consists of (i) sample preparation which avoids the use of heat, centrifugation, or organic extractions; (ii) rapid, two-temperature PCR amplification of C. trachomatis cryptic plasmid sequences; and (iii) capture and colorimetric detection of amplified DNA in microwell plates. PCR was compared with culture by using 503 cervical specimens. After resolution of discrepant specimens with a confirmatory PCR assay directed against the chlamydial major outer membrane protein gene, PCR had a sensitivity of 97% and a specificity of 99.7% while culture had a sensitivity of 85.7% and a specificity of 100%v. In a separate study, PCR was compared with a direct specimen enzyme immunoassay (Chlamydiazyme; Abbott Diagnostics) by using 375 cervical specimens. After resolution of discrepant specimens, PCR had a sensitivity and specificity of 100o, while the enzyme immunoassay had a sensitivity of 58.8% and a specificity of 100%v.

Chlamydia trachomatis, an obligate intracellular bacterium, is the most common sexually transmitted diseasecausing organism in the United States (3). C. trachomatis causes a variety of clinical syndromes in males (including urethritis and epididymitis), females (including cervicitis), and newborns (including conjunctivitis and pneumonia). Untreated or undiagnosed cervical infections in females can ascend into the upper genital tract, causing pelvic inflammatory disease and ectopic pregnancy (3). Infertility in males and females can result from untreated or undiagnosed chlamydial infections (3). Cell culture is considered the "gold standard" for detection of C. trachomatis but is generally considered to be only 70 to 80% sensitive (9), is labor intensive, and requires 2 to 3 days for results. A DNA probe assay and a number of antigen detection assays utilizing direct fluorescent antibody and enzyme immunoassay (EIA) are available for rapid detection of C. trachomatis from clinical specimens. The sensitivity and specificity of these assays are generally regarded to be less than those of culture and vary considerably, as reported in the literature (1, 7). Polymerase chain reaction (PCR) is a method for specific amplification of small quantities of DNA to detectable levels. Repeated temperature cycling of reaction mixtures containing thermostable DNA polymerase and oligonucleotide primers flanking the target sequence is performed, theoretically doubling the amount of the target DNA sequence after each cycle. Roche Molecular Systems (RMS, Branchburg, N.J.) has developed a rapid and sensitive PCR-based method for identifying C. trachomatis from cervical specimens (Amplicor C. trachomatis Test). This method involves (i) a simple, PCR-compatible s'ample processing method which avoids the use of centrifugation, heating, and organic extractions; (ii) rapid (1 h, 40 min) DNA amplification of the common C. trachomatis plasmid (5); and (iii) a familiar microwell plate format for specific hybridization and colorimetric detection of PCR products. In this report, we describe the application of this sample preparation and PCR *

system for detection of C. trachomatis from cervical specimens.

MATERIALS AND METHODS

Specimens. Endocervical swabs were collected at two sites. At site A, specimens were collected from initial-visit, adolescent obstetric patients. The C. trachomatis positivity rate in this population was ca. 17% by culture during the study period. Three swabs were collected from each patient. The first swab was for Neisseria gonorrhoeae culture, and the second and third swabs were for either C. trachomatis culture or PCR. The collection order of the second and third swabs was randomized. At site B, specimens were collected from a low-prevalence (ca. 5%) population attending an obstetric clinic. Two swabs were collected in random order from each patient. One swab was for the Chlamydiazyme EIA (Abbott Diagnostics, North Chicago, Ill.), and the other swab was for C. trachomatis PCR. All specimens to be analyzed by PCR were placed into 1 ml of a sodium dodecyl sulfate-based specimen transport medium (Amplicor; RMS), sent overnight on ice to RMS, and stored at 4°C prior to processing and amplification. Culture. Inoculated chlamydial transport medium (Bartels Immunodiagnostics, Bellevue, Wash.) was transported daily to the laboratory at room temperature or on ice and then stored at 4°C prior to culture processing. Specimens were processed within 48 h after receipt by the laboratory. C. trachomatis was isolated by using cycloheximide-treated McCoy cells in 1-dram (1 fluidram = 3.697 ml) vials on 12-mm-diameter coverslips (Bartels). A single vial was inoculated per specimen, with a single passage. After 48 h of incubation at 35°C, monolayers were stained with fluorescein-labeled monoclonal antibodies prepared against chlamydial lipopolysaccharide (Bartels). EIA. C. trachomatis was detected directly from specimens by using the Chlamydiazyme EIA in accordance with the manufacturer's instructions. EIA-positive specimens were confirmed by using the manufacturer's blocking antibody assay. PCR. Most of the specimens collected in RMS specimen

Corresponding author. 2847

2848

LOEFFELHOLZ ET AL.

transport medium were analyzed by PCR within 1 month of collection; some were analyzed within 2 months of collection. Chlamydial DNA has been shown to be stable in transport medium (i.e., amplified by PCR) after 6 months of storage at 4°C. Prior to PCR analysis, specimens were allowed to warm to room temperature. After thorough mixing with a vortex mixer, a 25-,ul specimen was removed and added to a PCR reaction tube (MicroAmp; Perkin Elmer, Norwalk, Conn.). An equal volume of specimen diluent containing Tween 20 and magnesium (Amplicor; RMS) was added to the PCR reaction tube and mixed with the specimen by using the pipet tip. Diluted specimens were allowed to sit for approximately 15 min at room temperature prior to addition of 50 ,u of 2x PCR buffer (Amplicor C. trachomatis Master Mix; RMS). Amplification with Amplicor was carried out in accordance with the manufacturer's (RMS) instructions. C. trachomatis Master Mix contained a single set of biotinylated oligonucleotide primers directed against the cryptic plasmid of C. trachomatis, i.e., CP24 (5'-biotinyl-GGGATTCCTG TAACAACAAGTCAGG) and CP27 (5'-biotinyl-CCTCTT CCCCAGAACAATAAGAACAC), plus deoxynucleotide triphosphates, Tris buffer, KCl, glycerol, and Taq polymerase (Perkin Elmer). The amplified sequence was a 207-bp fragment of the cryptic plasmid located 195 bp downstream from the unique BamHI restriction site (8). Two-temperature amplification of samples was conducted in a TC9600 thermal cycler (Perkin Elmer). Samples were subjected to an initial cycle of 5 min at 95°C and 60 s at 60°C, followed by 29 cycles of 30 s at 95°C and 60 s at 60°C. Following temperature cycling, samples were held at 72°C prior to addition of denaturation solution (Amplicor; RMS). Each amplification run contained several negative controls (diluted transport medium) and positive controls (C. trachomatis cryptic plasmid DNA in diluted transport medium). Detection of PCR products. Detection of PCR-amplified DNA (amplicons) was carried out in accordance with the manufacturer's instructions (Amplicor; RMS). Biotinylated amplicons were denatured by addition of 100 ,u of sodium hydroxide-based denaturation solution. A 25-pA aliquot of of hybridization the base-denatured amplicon and 100 buffer were combined in a well of a 96-microwell plate (Corning Glass Works, Corning, N.Y.) that also contained an immobilized oligonucleotide capture probe consisting of sequences complementary to the amplified portion of the cryptic plasmid. The capture probe, CP35 (5'-bovine serum albumin [BSA]-CATAGCACTATAGAACTCTGCAAGCC), was bound to the bottom of microwells via a BSA molecule conjugated to the 5' end of the oligonucleotide (16). Hybridization was carried out for 1 h at 37°C, after which microwells were washed with wash buffer to remove unhybridized material, and then avidin-horseradish peroxidase conjugate was added. Following 15 min of incubation at 37°C, unbound conjugate was washed away with wash buffer, and horseradish peroxidase substrate containing hydrogen peroxide and tetramethylbenzidine was added to the microwells. Reactions were stopped after 10 min of color development by addition of acid stop solution. The optical density of wells was read in an Emax MTP reader (Molecular Devices Corporation, Menlo Park, Calif.) at 450 nm, and results were scored on the basis of a clinically established cutoff value. An optical density (OD) of 0.250 was selected as the assay cutoff on the basis of analysis of culture-negative specimens, excluding those that were clearly PCR positive and resolved as truly positive by confirmatory PCR. The cutoff represents the highest OD generated by the PCR assay (0.192) plus 3

J. CLIN. MICROBIOL.

standard deviations (SD) (0.021). A PCR run was rejected if controls yielded ODs outside of established ranges. Discrepant-result analysis. If a specimen produced a PCR result discrepant with the comparison test, PCR was repeated. If the second amplification produced a result in agreement with the comparison test, the result from the initial amplification was considered incorrect. Specimens that were repeatedly discrepant were analyzed in accordance with the following algorithms. Specimens that were either culture or Chlamydiazyme positive and PCR negative were extracted with phenol-chloroform, ethanol-precipitated (11), and reamplified. A positive PCR result after extraction indicated the presence of a PCR inhibitor(s). A negative PCR result after extraction (not encountered during this study) indicated either infection with a plasmidless strain of C. trachomatis, sampling error, or a culture or Chlamydiazyme false-positive result. Specimens that were PCR positive and culture or Chlamydiazyme negative were reamplified by using PCR primers directed against the C. trachomatis major outer membrane protein (MOMP) gene to rule out PCR false-positive results due to carryover contamination by cryptic plasmid PCR-derived amplicons. The MOMP PCR assay utilized primers CT1 (5'-biotinyl-GCCGC'FFlGAGT TCTGC1TCCTC) and CT2 (5'-biotinyl-CCAAGTGGTG CAAGGATCGCA), described by Dutilh et al. (6), and the RMS microwell plate format for capture and colorimetric detection of amplicons. Amplification of the MOMP gene was carried out under conditions essentially identical to those used for amplification of the cryptic plasmid, except for the use of MOMP gene-derived primers and 10 additional temperature cycles of 95°C for 30 s and 60°C for 1 min. For microwell detection, capture probe CT4S (5'-BSA-CCA AGCCTF'ATGATCGACGGAATTC) was immobilized to plate wells. A positive MOMP PCR result confirmed the positive plasmid PCR result and indicated a culture or Chlamydiazyme false-negative result. A negative MOMP PCR result indicated that the initial PCR result obtained with the plasmid target was a false-positive result. Inclusivity and exclusivity testing. Purified elementary body DNAs from C. trachomatis serovars, C. pneumoniae, and C. psittaci were obtained from the Washington Research Foundation (Seattle, Wash.) and the Centers for Disease Control (Atlanta, Ga.). For exclusivity testing, a panel including Candida spp. and bacterial commensals and pathogens isolated from urogenital tracts were obtained from the American Type Culture Collection (Rockville, Md.) and cultured under conditions recommended by the supplier. DNA was extracted from organisms by exposure of cells to a lytic enzyme (lysozyme, lysotaphin, lyticase, or mutanolysin [Sigma Chemical Co., St. Louis, Mo.]), sodium dodecyl sulfate, and proteinase K in accordance with standard procedures (11). RNase-treated lysates were purified by phenolchloroform extraction, precipitated in ethanol, and suspended in sterile H20 (11). DNA concentration was estimated by measuring A260. Purified viral DNAs for exclusivity testing (cytomegalovirus, herpes simplex virus types 1 and 2, and human papillomavirus) and Treponema pallidum DNA were obtained from Cetus Corporation. Trichomonas vaginalis DNA was a generous gift from C. C. and A. Wang (University of California, San Francisco). Prior to testing of exclusivity panel DNAs in the C. trachomatis PCR assay, the DNAs were determined to be amplifiable. Bacterial DNA was amplified with universal bacterial primers directed against a conserved region of the 16S rRNA gene (9a). Yeast DNA was analyzed in 0.8% agarose gels and stained with

VOL. 30, 1992

DETECTION OF C. TRACHOMATIS BY PCR

ethidium bromide to confirm the presence of DNA and then spiked with chlamydial DNA and amplified by C. trachomatis PCR to rule out the presence of PCR inhibitors. Viral DNAs, T. pallidum DNA, and T. vaginalis DNA were previously determined to be amplifiable and/or were spiked with chlamydial DNA and amplified to rule out PCR inhibition. To determine the inclusivity and exclusivity of the RMS Amplicor C. trachomatis Test, approximately 105 to 107 copies of extracted genomic or C. trachomatis plasmid DNA were amplified. Amplicons were detected by electrophoresis in 4% agarose gels stained with ethidium bromide and by the RMS microwell plate assay described in this report.

&3.5 0

3.0

0S

0

E

Statistical methods. Statistical comparisons of sensitivity performed by using x2 analysis.

2.0

were

----3 B---

F

di RESULTS Inclusivity and exclusivity testing. All 15 C. trachomatis serovars were detected by the RMS Amplicor C. trachomatis Test (A450, >2.0), while C. pneumoniae and C. psitaci were negative 0450,

Detection of Chlamydia trachomatis in endocervical specimens by polymerase chain reaction.

A rapid and sensitive polymerase chain reaction (PCR)-based assay for detection of Chlamydia trachomatis in cervical specimens is described. This assa...
955KB Sizes 0 Downloads 0 Views