Vol. 173, No. 19

JOURNAL OF BACTERIOLOGY, OCt. 1991, p. 6153-6158

0021-9193/91/196153-06$02.00/0

Detection of Elastase Production in Escherichia coli with the Elastase Structural Gene from Several Non-ElastaseProducing Strains of Pseudomonas aeruginosa EIICHI TANAKA,1 SUSUMU KAWAMOTO,1 JUN FUKUSHIMA,1 KENJI HAMAJIMA,1 HIDEKI ONISHI,1 YOHEI MIYAGI,1 SUMAKO INAMI,1 KAZUYUKI MORIHARA,2 AND KENJI OKUDA'*

Department of Bacteriology, Yokohama City University School of Medicine, 3-9 Fukuura, Kanazawa-ku, Yokohama 236,1 and Institute for Applied Life Science and Department of Enzymology, University of East Asia, Shimonoseki, Yamaguchi 751,2 Japan Received 19 July 1991/Accepted 25 July 1991

The elastase structural gene from Pseudomonas aeruginosa IFO 3455 has been cloned and sequenced. Using this gene as a probe, we cloned the DNA fragments (pEL3080R, pEL10, and pEL103R) of the elastase gene from non-elastase-producing strains (P. aeruginosa IFO 3080, N-10, and PA103 respectively). These three Pseudomonas strains showed no detectable levels of elastase antigenicity by Western blotting (immunoblotting) or by elastase activity. When elastase structural genes about 8 kb in length were cloned into pUC18, an Escherichia coli expression vector, we were able to detect both elastase antigenicity and elastolytic activity in two bacterial clones (E. coli pEL10 and E. coli pEL103R). However, neither elastolytic activity nor elastase antigenicity was detected in the E. coli pEL308OR clone, although elastase mRNA was observed. The partial restriction map determined with several restriction enzymes of these three structural genes corresponded to that of P. aeruginosa ff0 3455. We sequenced the three DNA segments of the elastase gene from non-elastase-producing strains and compared the sequences with those from the elastase-producing P. aeruginosa strains IFO 3455 and PAO1. In P. aeruginosa N-10 and PA103, the sequences were almost identical to those from elastase-producing strains, except for several nucleotide differences. These minor differences may reflect a microheterogeneity of the elastase gene. These results suggest that two of the non-elastase-producing strains have the normal elastase structural gene and that elastase production is repressed by regulation of this gene expression in P. aeruginosa. Possible reasons for the lack of expression in these two strains are offered in this paper. In P. aeruginosa IFO 3080, the sequence had a 1-base deletion in the coding region, which should have caused a frameshift variation in the amino acid sequence. At present, we have no explanation for the abnormal posttranscriptional behavior of this strain.

Pseudomonas aeruginosa is an opportunistic pathogen which can cause fatal infections in vulnerable hosts (19). Several components related to its virulence have been identified and characterized (22). Among these, elastase acts to inactivate a variety of biologically important proteins or phenomena (12, 14, 16-18, 23). In addition, there is strong evidence that elastase plays an important role in the pathogenesis of P. aeruginosa infections (11, 20). Although the regulatory mechanism of elastase production is still unknown, elastase-deficient Pseudomonas strains have been isolated (18). Furthermore, some elastase-positive Pseudomonas isolates often become elastase negative after several passages in vitro. We (6, 29) and another group (2, 25) have independently cloned and sequenced the elastase structural gene using the elastase-producing P. aeruginosa strains IFO 3455 and PA01, respectively. Several elastase-related products (8, 9, 21), the existence of "pro" protein (2, 6, 9, 29), and elastase activation molecules (9, 26) have been described. In addition, Goldberg and Ohman (8) and Schad et al. (25) first cloned the elastase-related lasA gene, which was later determined to be an elastase-modifying gene (9, 26). However, the regulatory mechanism of elastase production has not yet been investigated. In the present study, we cloned and sequenced the *

elastase gene from three elastase-deficient strains in order to observe regulation of elastase production, and we compared the sequences of the gene with those of the previously cloned and sequenced gene from elastase-producing strains. Possible mechanisms of elastase production in Escherichia coli with the elastase gene from non-elastase-producing strains of P. aeruginosa are also discussed. MATERIALS AND METHODS Bacterial strains and vectors. P. aeruginosa IFO 3455 and IFO 3080 were obtained from Institute for Fermentation, Osaka, Japan. P. aeruginosa N-10 was donated by Y. Homma (Kitasato Institute, Tokyo, Japan). P. aeruginosa PA103 was donated by P. V. Liu (University of Louisville, School of Medicine, Louisville, Ky.). Three strains (P. aeruginosa 34, 50, and 56) were isolated from patients with eye infections. The E. coli expression vector pUC18 was used for DNA cloning. P. aeruginosa IFO 3455 produced approximately 150 ,ug of elastase antigen per ml. P. aeruginosa N-10, PA103, and IFO 3080 were reported to be non-elastase producers (18). The antibody used for Western blotting (immunoblotting) was obtained from a rabbit immunized three times with elastase (Nagase Biochemical Co., Kyoto, Japan). The antibody titer was 16 by the Ouchterlony

technique. Preparation of the intracellular fraction and trypsin treatment. Cells were cultured overnight in enriched medium

Corresponding author. 6153

6154

TANAKA ET AL.

J. BACTERIOL.

kb

E pEL 2

pEL 3080R

pEL 103R

P K

P K

H

E

A

S AA

P K

H

E

A

S AA S AA

P K

H

E

A

A A

E

EZ A A

E/ A A

H

S AA

-

A

A A pEL 10

TABLE 1. Proteolytic activities of various bacteriaa

Elastase gene

E

FIG. 1. Restriction enzyme map of the elastase gene. E, EcoRI; A, AvaIl; S, SmaI; P, PstI; K, KpnI; H, HpaI.

(Luria-Bertani broth for E. coli and tryptic soy broth for P. aeruginosa), and 1 ml of this culture was sonicated in 3 ml of buffer (100 mM Tris [pH 8.0], 1 mM CaCl2) and centrifuged. In order to measure the activated precursor of elastase, the supernatant was treated with trypsin as follows. The intracellular fraction was incubated with trypsin at a protein ratio of 160:1 at 25°C for 30 min and then incubated with a fivefold excess of soybean trypsin inhibitor (15). Proteolytic assay. Total proteolytic activity was determined by a modification of the method of Wretlind and Wadstrom (28), employing a 30-min digestion of Azocasein (Sigma) suspended in 10 mM Tris buffer, pH 8.0, at 40°C with a 100-fold dilution sample of the trypsinized and untreated cell extracts. The digested Azocasein supernatant was measured by A440. Elastase activity was determined by the method of Bjorn et al. (3). Digestion of elastin Congo red (Sigma), which was suspended in 10 mM sodium phosphate buffer, was carried out for 16 to 18 h. The degree of digestion was determined by measuring the diameter of the lytic ring in the agar plate. Detection of proteins. Supernatants of culture fluids or sonicated bacterial suspensions were loaded onto sodium dodecyl sulfate (SDS)-polyacrylamide gels. Proteins were visualized by staining with amido black and Coomassie blue. To confirm the presence of elastase protein, Western blotting was performed by the method of Burnette (4). Construction and screening of the gene library. Chromosomal DNA was collected from various strains of P. aeruginosa by conventional methods and digested with EcoRI. Only DNA fragments of approximately 8 kb were ligated to pUC18, an E. coli expression vector, and a gene library was constructed. From this library several clones were selected with a probe of the BglI fragment of the elastase gene, which had been cloned and sequenced previously (6). Restriction enzyme mapping. After confirmation by various techniques, the appropriate DNA fragments were prepared with various restriction enzymes (Takara Shuzo Co., Ltd.). The cleaved samples were applied to agarose gels for electrophoresis, and a restriction enzyme map was made (Fig. 1). For DNA fragment analysis, staggered deletions of about 300 bp each were prepared by unidirectional digestion with exonuclease III by the method of Henikoff (10). Northern (RNA) blotting. RNA was extracted by the hot-phenol method described elsewhere (1) from the cells at the late log growth phase and cultured overnight at 37°C with vigorous shaking in enriched medium (Luria-Bertani broth for E. coli and tryptic soy broth for P. aeruginosa). A total of 3 jig of RNA was denatured in 50% formamide-2.2 M formaldehyde-0.5 mM EDTA-10 mM sodium phosphate buffer (pH 7.4) at 65°C for 15 min and electrophoresed on a

Species and strain

Untreatedb

Trypsinizedc

P. aeruginosa IFO 3455 N-10 IFO 3080 PA103

0.002 0.013 0.002 0.011

0.314 0.008 0.005 0.002

0.293 0.309 0.012 0.016 0.004 0.277 0.002

0.205 0.342 0.017 0.010 NTd 0.305 NT

E. coli pEL3455

pEL103R pEL103 pEL308OR pEL3080 pEL10 pUC18

A440 for activity of fraction

a The details are described in Materials and Methods. Total intracellular activity without trypsinization. c Measured to detect intracellular precursor. d NT, not tested. b

1.0% agarose gel containing 2.2 M formaldehyde and 10 mM sodium phosphate buffer (pH 7.4). RNA was transferred to a nitrocellulose filter and hybridized with the 1.8-kb EcoRISmaI fragment of the elastase gene. DNA sequencing. Various restriction fragments of the elastase structural gene from non-elastase-producing strains were subcloned into M13mpl8 (30). Sequencing reactions were carried out by dideoxy chain termination (24) with the Taq Dye Primer Cycle Sequencing kit (Promega, Madison, Wis.) as described by the manufacturer. DNA was sequenced with an automatic DNA sequencer (model 373A; Applied Biosystems, Foster City, Calif.) (27). The region of the structural gene was sequenced with universal or synthetic oligonucleotide primers. The oligonucleotides were synthesized with an automatic DNA synthesizer (model 381A; Applied Biosystems). Analysis of amino acid homology. The program of homology analysis was as described in the Genetyx manual (Software Development Co., Tokyo, Japan). RESULTS Elastase gene cloning from non-elastase-producing strains. As stated in Materials and Methods, we have cloned the elastase gene from P. aeruginosa IFO 3080, PA103,. and TABLE 2. Elastolytic activities of various bacteria Species and Ring diam strain (mm)' P. aeruginosa IF03455 .............................................. 24 IF03080 .............................................. 0 PA103 ............................................. 0 N-10............................................. 0 E. coli

pEL3455 .............................................

22

pEL308OR .............................................. pEL103R ............................................. pEL10 .............................................. pUC18 ..............................................

18 16 0

0

a Trypsinized samples of each bacteria were tested by measuring the diameter of the digested ring.

REGULATION OF PSEUDOMONAS ELASTASE PRODUCTION

VOL. 173, 1991

1

2

3 4

5

6

7

8

23s_ 1 6 s~~~~~

K Da

67-0

16s

43

6155

_".

-0

30-0

20172 3 4 5 6 7 8 9

FIG. 2. Westem blotting of intracellular elastase antigens with

various types of P. aeruginosa. Lanes: 1, IFO 3455; 2, N-10; 3, PA103; 4, IFO 3080; 5, 34; 6, 50; 7, 56; 8, purified elastase. Numbers on the left are molecular size markers.

N-10. Only clones containing about 8-kb inserts were collected. We selected several clones from each strain. Several recloning steps were performed, and we selected the E. coli pEL10 clone as the elastase gene for P. aeruginosa N-10. From P. aeruginosa IFO 3080 and PA103, we selected E. coli pEL3080 and E. coli pEL103 clones, respectively. However, the results of partial restriction enzyme mapping and Southern blot hybridization (data not shown) showed that these cloned genes were inserted into the plasmid vector in a reverse orientation to a lac promotor. Two recombinant plasmids, pEL308OR and pEL103R, which have proper orientation with respect to the promotor, were constructed. Figure 1 shows the restriction maps of the three clones. These results indicate that all of these DNA fragments have a similar DNA sequence and no detectable insertion or deletion of the elastase gene. In addition, these newly cloned genes are very similar, if not identical, to the elastase structural gene previously described (E. coli pEL3455 or pEL2 clone [6]). Elastase activity. The next series of experiments was designed to demonstrate the elastase activities of these gene products. Each bacterial clone was ultrasonicated, and the Azocasein-cleaving activity of the supernatant was assayed by measuring absorbance. Interestingly, not only the E. coli pEL3455 clone but also the E. coli pEL103R and E. coli

KDs

67. l43

3

2

3

4

5

6

7

8

9

20-0 FIG. 3. Western blotting of intracellular elastase antigen with E. coli. Lanes: 1, JM101; 2, pUC18; 3, pEL3455; 4, pEL10; 5, pEL103; 6, pEL103R; 7, pEL3080; 8, pEL308OR; 9, purified elastase. Numbers on the left are molecular size markers.

FIG. 4. Northern blotting using an elastase structural gene (1.8-kb EcoRI-Smal fragment) as a probe. Lanes: 1, P. aeruginosa IFO 3455; 2, P. aeruginosa N-10; 3, E. coli pEL3455; 4, E. ccli pEL10; 5, E. ccli pEL103R; 6, E. ccli pEL308OR; 7, P. aeruginosa IFO 3080; 8, P. aeruginosa PA103; 9, E. coli JM101. Molecular weight markers are indicated as 16S (1.5-kb) and 23S (3.1-kb) rRNAs.

pELlO clones showed Azocasein-cleaving activity (Table 1). Furthermore, we attempted to detect intracellular protease activity of P. aeruginosa which was activated by partial tryptic digestion (5). The ultrasonicated supernatant from P. aeruginosa IFO 3455 showed strong proteolytic activity when treated with trypsin (Table 1). This may be due to the production of an inactive precursor (15) in the periplasm of

Pseudomonas cells. The E. coli pEL1O3R and pELlP clones both showed slightly positive responses in this assay. In addition, the elastolytic activity of each supernatant of the ultrasonicated bacteria was assayed. As shown in Table 2, not only the E. coli pEL3455 clone but also the E. coli pEL1O3R and E. ccli pELlO clones showed strong elastolytic activities after trypsin activation. As expected, their parental strains, P. aeruginosa IFO 3080, N-10, and PA103, showed no elastolytic activities. Western blotting. To detect elastase antigens, Western blotting was carried out. As a first step, we studied seven strains of P. aeruginosa for elastase production. Each strain of Pseudomonas was solubilized by boiling with SDS and then was subjected to Western blotting with antielastase antibody. As shown in Fig. 2, P. aeruginosa IFO 3455, 50, and 56 showed a clear band at 33 kDa. Other strains showed no detectable level of elastase production. The control purified elastase showed one major band and two minor bands, which may be degradation products of the major one. Then we determined whether these newly cloned genes can produce the mature size of the elastase antigen when they are ligated to pUC18, an E. ccli expression vector. Again, the E. ccli pEL3455 clone and both E. ccli pELlO and the E. coli pEL1O3R clones showed a clear band around 33 kDa, indicating the mature size of the elastase protein (Fig. 3). Therefore, the elastase precursor protein had been processed in the E. ccli cells. However, the E. ccli pEL308OR clone showed no detectable level of antigen (Fig. 3). Northern blotting. To see whether mRNA of the elastase structural gene could be produced by non-elastase-producing bacteria, RNAs were extracted from each bacterial strain. These RNAs were studied by Northern blotting as described in Materials and Methods. As shown in Fig. 4, elastase mRNAs were observed in E. ccli pEL3455, pEL0o,

TANAKA ET AL.

6156

1 2 3 4 5

-936

J. BACTERIOL.

Padmeewsseaenooes PAOI

P.xae..eaenh.ewa F06466

1 -972 TTACAATTCGAOCTCGTACCCAATTCCGCGCCAGA -937 2--

1

Paeatesnesaeora PAIOl hinmu eaeerma N-10

4

2

s

ASOCGTCAACTOATGATCOTCCACAIOCCCCTCOCTGAGCGCCTCCCGGAGCTOOG0CAACCTAGCTGCCACCTGC -010

241 GOC 0TG GTG TIC AAA CTG TAC COO GAC TOO TIC GGC ACC AGC CCG CIG ACC CAC AAG CTO as alp Va1 Pal Ph. Lps Lu. Ipr Ar; Asp T1p Ph. Oly Thr Ser Pro Lou Thr His Lys Lea

300 100

3 4 5

Asp

-----T -1----------------A----C-A---G--AC---I----------------------------T--------G--------------------------------T--------G-----------------

1

1 2 3 4 5

-955 TTTTCTOCTAOCTATTCCAOCGAAAACATACAOATTT~CGOC0SSATCAAG60CTACCTOCCAGTTCTGGCAGOTTTGOC -760

1 2 3 4 5

-759 C0COGGTTCTTTTTOGTACACG*AAAMCACCOTCGASMACACOGMCOS0CCAGOGAGSTGCA0TTCCTTCTACCOGAAG -692

1

-691

2 3 4 5 1

2 3

301 TAC AlG AAG 010 tAC TAC 060 CCC AOC 0T10 OO SAC GCC TAC TOO GSC 9CC ACG CCC AIG 101 Tyr Met Lye Pal His Tyr Gly Ar; Scr Pal Glu Aco Ala Tyr T1p Asp alp Thr Ala Not

360 120

361 CTC TIC GGC GAC GCC GCC ACC 0T0 TIC TAT CCC CTG GTG TCG CTG GAC 010 GCG CCC CAC 420 121 Leo. Phe alp Sop alp Ala Trh Pal Ph. Tyr Pro Leo Pal Ser Leoo Asp Pal Ala Ala His 140 ---------A---

4

5

GACTGATACGOCTGTTCCGATCAGCCCACSAOOCGCGCCOTSAOcTCOOCCOAOIACTTCGGCCTGAAMAACCACCSOr SD

-603

1

2 3

2 3

4 5

421 GAG 0TC AGC CCC GGC lIT ACC GAG CMG SAC ICC 00G CTG ATC TAC CCC 000 CAM TCA GGC 141 Glu Va1 Her His Glp Ph. Thr ala GIn Asen Ser alp Leou0 IpoTy Ar; Gly Glo Oar Gly

480 160

481 GGA ATG SAC GSA GCG TIC ICC GAC ATG GCC GGC GAG GCA 0CC GAG TIC TAC ATG CGC GGC 161 alp Hot Asn Glu Ala Ph. Ocr Asp Met Ala Gly ala Ala Ala Glu Phe Tpr eat Ar; Gly

540 1St

041 MOG SAC GAC TIC CTC SIC GGC TAC GAC SIC AAG SAG GGC SOC 001 GCG CTG CGC TAC ATO 181 Lys Asn Asp Phe Lea Ile alp Tyr Asp Ile Lys Lys alp 5cr alp Ala Lea Ar; Tyr Hat

600 200

601 GCC CAG CCC SOC CGC GAC 000. CGA TCC SIC GCC SAC GCG TC0 CAG TAC TAC SAC GOat SIC 201 Asp Glo Pro Her Ar; Asop Gly Ar; SMr IIa Asp As; Ala. Mr Gln Tyr Tyr Aso Gly Il.

660 220

4

5 1

-6H2 SACTGSACASG 5CC MOG AAG 0TT ICT ACC CTT GMC CTG ICC ITTC GTT GCG ATC ATO 001 011 -541 -198 Net Lye Lye Val Mrt Thr Leou Asp Leo Leou Ph. Vol Ala Ilie Met Glp Vol -101

Siga Pepild 1

-540 ICG CCC CCC OCTI ITT GCC GCC GAC CTG SIC GAC 0T0 ICC MSA CIC CCC SOC MOG GCCI GCC -491 S.,ceLo I AeM Her Loc. Is , o Mer Lye Ala Ala -161 -190 SMr Pro Ala Ala Ph. Ala

1 2 3 4 5

Pmo 1

1 2 3 4 5

-490 CAG GGC GCG CCC GGC CCO GIC MCC TTO CMA GCC 0CG OIC GGC OCT GGC GGT GCC GAC GAA -421 -160 01; Gly Ala Pro alp Pro Pal Thr Leou Gln Ala Ala Val alp Ala Glp alp Ala Asop Glo -141

1 2 3

Mer Thr Thr Ar; Ar; SMr Thr Thr Thr Ala Scr 4

5 1

-420 CTG SMA GCG SIC CGC MGC SCG SCC CTG CCC SAC GOt AM0 CAG OTC ACt CGC TAC 050 CAM -361 -140 Leou Lys Ala Ii. Arg Mer Thr Tho Leou Pro Asn Glp Lye Glo Pal Thr Ar; Thr Glu 010 -121

1

2 3

661 GCC GTG CAC CCC ICC SOC GCC 010 TAC SAC CGI GCG TIC TAC CTG ITG GCC MAT TCG CCG 720 221 His Pro 240 Pa alp Val Tyr Asn Ar; Ala Leo Ala. Aso

Asop

Hie

Scr Scr

PhM Tpr

Thr Cpa Thr Thr Pro Ala Ala

1. -36H TIC CAC SAC GOC GTA CGG 0TG GTC GGC GOM GCC SIC ACt GSA GTC MOG GG1 CCC GGC MOG -301 -12H Phe Hie Ass Oly Pal Ar; Pal Vol Gly Glo Ala Ile Thr Ool Pal Lye alp Pro alp Lys -101

Cys

Laou

Mor

Thr Thr Pal Ar; Msr Thr Cpo lop Pro Ile Ar; Ar;

4 5

1

721 OOC TOO CCI MCC CCC AAG GCC TIC GA0 GTG TIC GTC GAC GCC MAC CCC TAC TAt 100 ACC 241 alp Trp Asp Thr Ar; Lyo Ala Ph. Glu Pal Ph., vol Asap Ala Mon Ar; Tyr Tyr lop Thr

780 260

2 3

Ala Gly Ile Pro Ala Ar; Pro Her Ar; Cys Scr Oar Tho Pro Tho Ala Thr Thr Oly Pro 1

-300 SOACCGTOCG OGC CAG CGC AOC CCC CAT TIC GIC GCC SMC SIC 0CC GCC GMC CITG CCGGC -241 -100 3Mr Vol Ala Ala Gln Ar; SMr Gly lie PMe Pal Ala Aso Ile Ala Ala Asp Laou Pro alp -ai

4 5 1

781 0CC ACC SOC SAC TAC SAC SOC 0CC GCC TCC 00G 010 ATI CGC TCG OCG CAM ACC CCC SAC 261 Ala TAr Her Asco Tyr Ass Mer Gly Sla Cyc Glp Pal I1. Ar; SMr Ala Glo Mon Ar; ASon

840 290

2 3

Pro Pro ALa Thr TAr Thr Ala Ala Pro Ala Glp 000

Ar; 1

-240 SOC AC MCC GOCG OC GTA ICC CCC 05G CMG 010 CC 0 G CCAO GCC MAG SOC CTG AAG CCC -181 -90 SMr Thr Thr Ala Ala Pal 090 Ala, Glo Gln Pal Leu Ala Glo Ala Lye Mer Leou Lye Ala -61

4 5

1

841 TMC ICG GC OCCI GAC GIC ACC CGG GCO TIC SGC ACC GIC GOC.010 ACC ICC CCG SGC GCCG 900 TyroSMr Ala Ala Asep Vol Thr Ar; Ala Phe SMr Thr Pal alp Pal Thr Cps Pro Mur Al. 300

291 1

-180 CMG 0C CCC SAC MCC GAG SIT GMC SMA 0CC GSA CTG GTC SIC CGC ClG 0CC 00GMG A MAC -121 -60 Gln Gly Ar; Lye TAr Olo Aso Msp Lye Pal Gb -Leo Val Ole Arg Leu Gly Gbu Asn Ass -41

2 3 4

5 1

301 Leou 1

-120 SIC GMC CAA CTG GTC TMC SAC GTC ICC TMC CTG AT? CCC GCC GMG GAO CTG TCG COG CCG -40 Ile Ala gin Leou Pal Tyr Asen Pal Mor ITyr Leou Ile Pro alp Glo alp Leo Bar Arq Pro

-.-G.--

4

1

-61 -21

-60 CRI TIC 01C SIC GM GCC SAG ACC -20 etc Ph. Pel Ile SAsp Ala Lys Tyr

GCC GM 010 CTC OAT CGM T0G SMA 0C CTO GM CMC e l laHc Glp G1u Pal LaSen Am -Irelen

-1 -

2 3 4 5 1 2

978 OGGGCGCTGCTTTATGTCGCTTOOOCCOTTOOC0TCCOCGSACCCGGTCTAAOGTTCAOOIOTGAGCTfTTATTCCAAO 1050 ---CO ---------------C------------------AC------

1 2

1056 ACCGACCO0GAGTCCTGCCATGAGTCTGCTGT?CA0CCTCTTAS0C*TOC0CA)AACACCTT0CCCAAC0A0TOCGTA ,1133

1

1134

TCGCCCCACGTOCACSTACICCCC0C*SOGS00CCTG0CCSSCMTGC0CA

1191

2

PM 1

1 0CC GM GCC 006 GGC CCC GCC SOC AAC CGM AAG SIC 0CC SAG TAC MCC TM CISOTAC GAC 1 Ma2AlSJ ' e1 Wfly0 =P fl Oly Aso ala Lye Il* Oly Lye Tyr Thr lyr Gly SMr Msp

FIG. 5. DNA sequence and 60 20

elastase gene. Bars,

areas

deducedl

where the

clone. The start site of the mature

----------

O

amino acid sequence of

same

base

was

found in the

product is amino acid

pro sequence of elastase. Numbers written

on

1.

"Pro,"

both sides of the lines

positions of both nucleotides and amino acids. ***, stop putative ribosome-binding site (Shine-Dalgarno [SDJ-like

indicate the

1

61 TMC CGT CCC CCG SIC OIC SMC GM CGC TCC GMG 510 GMC GMC GOC SAC OIC SIC ACt GIC 21 Tyr alp Pro Leou Ile, P91 san Asap Ar; Cys lu nost Asp Asep alp ASon Pal Ile TAr Pal

120 40

sequence) is underlined.

3.-

1

4 5

MCO cCG TIC CCC TIC 0CC MCC SAmp Nat.AMo 9cr Mor Thr Asep SAsp Mer Lye Thr TAr Pro Phe Ar; Phs Ala Cyo -T -T

.----0 -

CCC ACC Pro Thr

1

------------------S -

GMC WC

Msp

--.---

3

-

0

Ala

CAT

TIC TIC

Hbs Phc

Phe

CGC

where

no

base

was

found in the

60

S--G--

16 CcT 181 SR ACSM TMC CCCS C CAM OIC SAC 0o cc TAT Tc51 61 Asa TAr Tyr Lye Gbn Pal Msn Oly Ala Tyr Mer Pro Leou Moa

area

position.

190

alp

2

*,

clone in the corresponding

121 GMA5CAT SAC SOC SOC ACC GMC GMC SOACSMACC 41

codon. A

240

Glp s0

pEL1O3R, and pEL3O8OR clones as well as in P. aeruginosa IFO 3455. P. aeruginosa IFO 3455 showed a clear band of about 1.8 kb, while E. coli pEL3455, pEL1O3R, and pEL3O8OR clones showed an obscure -and degraded band, possibly because of the instabilities of elastase mRNAs in

pEL1O,

VOL. 173, 1991

REGULATION OF PSEUDOMONAS ELASTASE PRODUCTION

these E. coli strains. However, P. aeruginosa N-10, PA103, and IFO 3080 showed no detectable bands. DNA sequencing. The last series of experiments was performed to clarify the differences among the elastase genes of the elastase-producing and non-elastase-producing strains. We sequenced the elastase gene from non-elastase-producing P. aeruginosa strains IFO 3080, PA103, and N-10. Nucleotide sequences and deduced amino acid sequences of the gene were compared with those of elastase-producing P. aeruginosa strains IFO 3455 (6) and PAO1 (2) (Fig. 5). A comparison of the sequence of P. aeruginosa PA103 or N-10 with that of each corresponding region of the elastaseproducing strains revealed differences in several nucleotides along the entire sequence. These minor differences may reflect a microheterogeneity of the elastase gene. The nucleotide sequence of P. aeruginosa IFO 3080 is very similar to those of elastase-producing strains, except for that in the region upstream of the structural gene. However, the sequence had a 1-base deletion at nucleotide position 627 in the coding region, which should cause a frameshift variation in the amino acid sequence. DISCUSSION By studying the elastase gene of elastase-deficient bacteria, we can learn much about regulation of gene expression in P. aeruginosa and ultimately produce vaccines with strong antigenicity and without side effects. Recent studies have given us some information about the processing and activation of the elastase gene (28). An inactive precursor of elastase has been isolated from the periplasm of P. aeruginosa (5, 9, 13). This inactive precursor is activated by limited proteolysis or by dissociation from a noncovalently bound inhibitor (5, 13). In the present experiments, we also studied elastase precursor activity using the method of Kessler and Safrin (15). The result with this assay system showed that all bacteria tested, except for P. aeruginosa IFO 3455, have little, if any, elastase in the precursor form in the periplasm (Table 1). After trypsinization, strong elastase activities (Tables 1 and 2) in P. aeruginosa IFO 3455 were observed. With regard to this intracellular activation, our recent data indicate that autoactivation occurs in elastase processing (unpublished data). LasA protein has been shown to be involved in the final processing (21). However, the regulatory mechanism of elastase gene expression or elastase production is still obscure. No detailed report about the elastase structural gene from the non-elastase-producing strain has been published. In the present study, we were convinced that we were able to clone the elastase gene from these non-elastase-producing strains of P. aeruginosa for the following reasons. (i) These three clones were obtained by using the DNA fragment of the elastase structural gene as a hybridizing probe. We confirmed this by Southern blot hybridization (data not shown). (ii) The restriction mapping data were similar to those of the elastase gene of P. aeruginosa IFO 3455 (Fig. 1). (iii) We were able to detect both elastase activity and antigenicity using E. coli pEL103R and E. coli pEL10 clones (Tables 1 and 2 and Fig. 3). These findings suggest that we are studying the actual elastase gene of P. aeruginosa. It was rather surprising that even the structural gene from the non-elastase-producing strains was able to produce active elastase. E. coli pEL103R and E. coli pEL10 clones were able to produce elastase, although P. aeruginosa PA103 and N-10, their parental Pseudomonas strains, were not (Tables 1 and 2 and Fig. 3). Several explanations can be

6157

offered. One possibility is that these 8-kb fragments, which we cloned here, have no original Pseudomonas promoter for elastase on the 5' side of the structural gene. The nonelastase-producing Pseudomonas strains may have a lesion in the promoter region which has not yet been cloned. In E. coli pEL103R and pEL10, the expression vector pUC18 has a lac promoter, which can control elastase gene expression in E. coli. Another possibility is that the 8-kb fragments have the original Pseudomonas promoter. Minor base changes, which we found in the region upstream from the coding region (Fig. 5), may affect elastase gene expression in

Pseudomonas strains. A third possibility is that the 8-kb fragments have a normal promoter and some unknown factor(s) may play a role for regulating elastase gene expression in these non-elastase-producing Pseudomonas strains. Schad and coworkers (25) suggested that more than one gene is involved in elastase production in P. aeruginosa strains. To resolve these issues, it is necessary to clarify the promoter region for elastase. With regard to E. coli pEL3080R, we were unable to detect elastase activity or antigenicity (Tables 1 and 2 and Fig. 3). From our Northern blotting data we now think that the mRNA of the elastase gene has been produced in this E. coli strain (Fig. 4) and that some posttranscriptional steps are abnormal. From the sequence data of the elastase gene of this strain (Fig. 5), we excluded the possibilities that a stop codon might exist near the N-terminal region and that a putative ribosome-binding site (Shine-Dalgarno region) might be deleted. At present we have no explanation for the translational defects in this strain. Studying the elastasedeficient Pseudomonas gene would also give important information on the regulatory mechanism of bacterial gene expression. During the preparation of this paper, Gambello and Iglewski (7) reported the identification of P. aeruginosa lasR gene, a transcriptional activator of elastase expression, which can restore a positive elastase phenotype in P. aeruginosa PA103. It seems likely that the elastase-negative phenotype of PA103 is due to the absence of a functional lasR gene. ACKNOWLEDGMENTS We thank T. Takigami and Y. Shibano for their kind suggestions. This work was supported in part by grants-in-aid for scientific research from the Ministry of Education, Science, and Culture of Japan (no. 01570242) and grants from Kihara Memorial Yokohama Foundation for the Advancement of Life Sciences and from the Waksman Foundation of Japan, Inc. REFERENCES 1. Aiba, H., S. Adhya, and B. De Crombrugghe. 1981. Evidence for two functional gal promoters in intact Escherichia coli cells. J. Biol. Chem. 256:11905-11910. 2. Bever, R. A., and B. H. Iglewski. 1988. Molecular characterization and nucleotide sequence of the Pseudomonas aeruginosa elastase structural gene. J. Bacteriol. 170:4309-4314. 3. Bjorn, M. J., P. A. Sokol, and B. H. Iglewski. 1979. Influence of iron on yields of extracellular products in Pseudomonas aeruginosa cultures. J. Bacteriol. 138:193-200. 4. Burnette, W. N. 1981. "Western blotting": electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal. Biochem. 112:195-203. 5. Fecycz, I. T., and J. N. Campbell. 1985. Mechanisms of activation and secretion of a cell-associated precursor of an exocellular protease of Pseudomonas aeruginosa 34362A. Eur. J. Biochem. 146:35-42.

6158

TANAKA ET AL.

6. Fukushima, J., S. Yamamoto, K. Morihara, Y. Atsumi, H. Takeuchi, S. Kawamoto, and K. Okuda. 1989. Complete amino acid sequence and structural gene of the elastase from Pseudomonas aeruginosa IFO 3455. J. Bacteriol. 171:1698-1704. 7. Gambeilo, M. J., and B. H. Iglewski. 1991. Cloning and characterization of the Pseudomonas aeruginosa lasR gene, a transcriptional activator of elastase expression. J. Bacteriol. 173: 3000-3009. 8. Goldberg, J. B., and D. E. Ohman. 1987. Cloning and transcriptional regulation of the elastase lasA gene in mucoid and nonmucoid Pseudomonas aeruginosa. J. Bacteriol. 169:13491351. 9. Goldberg, J. B., and D. E. Ohman. 1987. Activation of an elastase precursor by the lasA gene product of Pseudomonas aeruginosa. J. Bacteriol. 169:4532-4539. 10. Henikoff, S. 1984. Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene 28:351359. 11. Holder, I. A. 1985. The pathogenesis of infections owing to Pseudomonas aeruginosa using the burned mouse model: experimental studies from the Shriners Burns Institute, Cincinnati. Can. J. Microbiol. 31:393-402. 12. Jacquot, J., J. M. Tournier, and E. Puchelle. 1985. In vitro evidence that human airway lysozyme is cleaved and inactivated by Pseudomonas aeruginosa elastase and not by human leukocyte elastase. Infect. Immun. 47:555-560. 13. Jensen, S. E., I. T. Fecycz, G. W. Stemke, and J. N. Campbell. 1980. Demonstration of a cell-associated, inactive precursor of an exocellular protease produced by Pseudomonas aeruginosa. Can. J. Microbiol. 26:87-93. 14. Johnson, D. A., B. Carter-Hamm, and W. M. Dralle. 1982. Inactivation of human bronchial mucosal proteinase inhibitor by Pseudomonas aeruginosa elastase. Am. Rev. Respir. Dis. 126: 1070-1073. 15. Kessler, E., and M. Safrin. 1988. Partial purification and characterization of an inactive precursor of Pseudomonas aeruginosa elastase. J. Bacteriol. 170:1215-1219. 16. Kharazmi, A., G. Doring, N. H0iby, and N. H. Valerius. 1984. Interaction of Pseudomonas aeruginosa alkaline protease and elastase with human polymorphonuclear leukocytes in vitro. Infect. Immun. 43:161-165. 17. Kharazmi, A., N. H0iby, G. Doring, and N. H. Valerius. 1984. Pseudomonas aeruginosa exoproteases inhibit human neutro-

J. BACTERIOL.

phil chemiluminescence. Infect. Immun. 44:587-591. 18. Morihara, K., and J. Y. Homma. 1985. Pseudomonas protease, p. 41-79. In I. A. Holder (ed.), Bacterial enzymes and virulence. CRC Press, Inc., Boca Raton, Fla. 19. Neu, H. C. 1983. The role of Pseudomonas aeruginosa in infections. J. Antimicrob. Chemother. ll(Suppl. B):1-13. 20. Nicas, T. I., and B. H. Iglewski. 1985. The contribution of exoproducts to virulence of Pseudomonas aeruginosa. Can. J. Microbiol. 31:387-392. 21. Ohman, D. E., S. J. Cryz, and B. H. Iglewski. 1980. Isolation and characterization of a Pseudomonas aeruginosa PAO mutant that produces altered elastase. J. Bacteriol. 142:836-842. 22. Pavlovskis, 0. R., and B. Wretlind. 1982. Pseudomonas aeruginosa toxin, p. 97-128. In C. S. F. Easmon and J. Jeijaszewicx (ed.), Medical microbiology, vol. 1. Academic Press, London. 23. Pedersen, B. K., and A. Kharazmi. 1987. Inhibition of human natural killer cell activity by Pseudomonas aeruginosa alkaline protease and elastase. Infect. Immun. 55:986-989. 24. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 25. Schad, P. A., R. A. Bever, T. I. Nicas, F. Leduc, L. F. Hanne, and B. H. Iglewski. 1987. Cloning and characterization of elastase genes from Pseudomonas aeruginosa. J. Bacteriol. 169:2691-2696. 26. Schad, P. A., and B. H. Iglewski. 1988. Nucleotide sequence and expression in Escherichia coli of the Pseudomonas aeruginosa lasA gene. J. Bacteriol. 170:2784-2789. 27. Smith, L. M., J. Z. Sanders, R. J. Kaiser, P. Hughes, C. Dodd, C. R. Connell, C. Heiner, S. B. H. Kent, and L. E. Hood. 1986. Fluorescence detection in automated DNA sequencer. Nature 321:674-679. 28. Wretlind, B., and T. Wadstrom. 1977. Purification and properties of a protease with elastase activity from Pseudomonas aeruginosa. J. Gen. Microbiol. 103:319-327. 29. Yamamoto, S., J. Fukushima, Y. Atsumi, H. Takeuchi, S. Kawamoto, K. Okuda, and K. Morihara. 1988. Cloning and characterization of elastase structural gene from Pseudomonas aeruginosa IFO 3455. Biochem. Biophys. Res. Commun. 152: 1117-1122. 30. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequence of the M13mpl8 and pUC19 vectors. Gene 33:103-119.