American Journal of Pathology, Vol. 139, No. 2, August 1991 Copyriht © American Association of Pathologists
Detection of Epstein-Barr Virus Sequences in Hodgkin's Disease by the Polymerase Chain Reaction Cynthia F. Wright,* Ann H. Reid,* Mark M. Tsai,* Kathleen M. Ventre,* PamelaJ. Murari,t Glauco Frizzera,t and TimothyJ. O'Leary* From the Departments of Cellular Pathology* and Hematologic and Lymph Node Pathology, t Arned Forces Institute of Pathology, Washington, DC
The authors examined paraffin-embedded lymph node biopsies from 65 cases of Hodgkin's disease for the presence of Epstein-Barr virus (EBV) DNA, using the highly sensitive polymerase chain reaction technique. Overall 40% of the cases were positiveforEBV DNA, there were no statistically significant differences in the frequency of EBV positivity among the different subtypes of Hodgkin's disease. These results are in agreement with those of previous studies that employed less sensitive detection techniques and suggest that EBV either is present in pathologic tissues only in some phases of the evolution of Hodgkin's disease or is a pathogenetic factor involved in only a portion of cases. (Am JPathol 1991, 139:393-398)
The cause of Hodgkin's disease is unknown. Serologic evidence suggests that development of Hodgkin's disease may be preceded by Epstein-Barr virus (EBV) activation in some patients, but the strength of this association is much lower than that for Burkitt's lymphoma.1 Staal and coworkers2 have recently surveyed 151 malignant and nonmalignant lymphoid tissue samples by Southern blotting for EBV DNA. Twenty-nine percent of Hodgkin's disease samples demonstrated EBV DNA, as did several samples from diffuse large cell lymphoma, whereas most other lymphomas did not.2 More recently, by using in situ hybridization, EBV has been identified in Reed-Sternberg cells in about 20% of cases of Hodgkin's disease.3 Weiss and co-workers4 have also surveyed cases of Hodgkin's disease for immunoglobulin gene rearrangements. Six of seven cases containing very numerous Reed-Sternberg cells demonstrated clonal heavy- and light-chain immunoglobulin gene rearrangements, with-
out rearrangements of the T-cell receptor gene. These results suggest a clonal B-cell origin for the ReedSternberg cells, although other evidence supports a Tcell origin for these cells.5 The idea that at least some cases of Hodgkin's disease could represent a clonal Bcell proliferation resulting from EBV infection is not unreasonable, because such a relationship between Burkitt's lymphoma and EBV infection is well established. Because most previous studies have not demonstrated the presence of EBV DNA in the majority of Hodgkin's disease cases, the relationship between EBV infection and the development of this disorder has remained uncertain. These previous studies, however, were done either by Southern blotting or by in situ hybridization techniques, which may not have been sufficiently sensitive to detect EBV in many cases where infection is present. Polymerase chain reaction (PCR) provides a method by which viral gene sequences can be identified with great sensitivity.6 If EBV plays an important ongoing role in the pathogenesis of Hodgkin's disease, one might expect a sufficient number of viral genes to be present to allow detection by this technique in every case of Hodgkin's disease. In this report we describe a rapid and accurate method for identifying EBV DNA sequences in formalin-fixed, paraffin-embedded tissue from lymph node biopsies. We then present the results of this assay applied to 65 cases of Hodgkin's disease and 13 cases of non-neoplastic disease.
Materials and Methods Sixty.five lymph node biopsy specimens consisting of both slides and formalin-fixed, paraffin-embedded tissue from patients with Hodgkin's disease and 13 specimens Supported by Intramural funds of the Armed Forces Institute of Pathology. The opinions expressed in this article are the personaJ views of the authors and are not to be construed as representing the views of the Department of the Army or the Department of Defense. Accepted for publication April 2, 1991. Address reprint requests to Cynthia F. Wright, Armed Forces Institute of Pathology, Department of Cellular Pathology, Washington, DC 203066000.
393
394
Wright et al
AJP August 1991, Vol. 139, No. 2
of non-neoplastic lymph nodes were identified in the files of the Armed Forces Institute of Pathology (AFIP). Paraffin-embedded cells from an EBV-containing Burkitt's lymphoma cell line (Raji) were used as a positive control for EBV DNA. Negative control material consisted of DNA extracted from a histiocytic lymphoma cell line (SUDHL6), which had been obtained from Dr. Alan Epstein. In addition, negative controls for reagent contamination, consisting of all PCR reagents except template DNA, were run each time a PCR assay was performed. A segment of the EBV IR3 region was selected for identification. The primers and probe for this sequence were designed by Synthetic Genetics (San Diego, CA) and have been published in their catalogue (Table 1). This primer pair gives rise to a 240-base pair amplified product. To ensure that adequate DNA was available for amplification, each case was assayed for the single-copy HER2 gene. The primers and probes for this gene were selected baced on a published partial sequence for the gene7 (Table 1) and give rise to a 241-base pair amplified product. The procedure for carrying out PCR amplification from formalin-fixed, paraffin-embedded sections was modified from that of Shibata and coworkers.8 Two 6-,u sections of routinely processed, paraffin-embedded tissue were cut from the block and placed in an Eppendorf tube. A fresh microtome blade was used for every specimen to avoid carryover of DNA from one specimen to the next. The paraffin was dissolved by vortexing the sections in 800 pI of xylene. After addition of 400 RI of ethanol, the tube was vortexed again, and centrifuged at 14,000 rpm for 5 minutes. The supernatant was decanted and the sample resuspended by vortexing in 800 RI of ethanol. After another 5-minute centrifugation, the supernatant was decanted and any remaining ethanol was removed with a microcapillary pipet. The sample was resuspended in 100 IlI of nonionic detergent buffer (50 mmol/I [millimolar] KCI, 10 mmol/I TRIS-HCI (pH 8.3), 2.5 mmol/I MgCI2, 0.45% Nonidet P-40, and 0.45% Tween 20) to which 2.4 RI of 2.5 mg/ml Proteinase K was added just before use.
The sample was incubated at 550C for 1 hour and 950C for 10 minutes to inactivate the protease. The tube was then centrifuged for 5 minutes. A 6-,u aliquot of the supernatant was removed and diluted to 15 p1l. Of this dilution, 0.5 ,ul and 2.5 p,l were added to the PCR reaction mix, representing 1/25o and 1/5o, respectively, of the DNA extracted from a 6-pu tissue slice. Generally about 80% of the cases gave a positive signal for the control HER2 gene at these dilutions; cases remaining negative were retested using the equivalent of 1/5 to 1/Ao of a 6-,p section. We were able to obtain a clear positive HER2 signal in about 90% of the cases assayed. The PCR reaction mix contained 5 p1 1 Ox Taq polymerase buffer (500 mmol/I KCI, 100 mmol/I TRIS-HCI, 15 mmol/l MgCI2, and 0.1% gelatin), 200 p,mol/I (micromolar) deoxy nucleoside triphosphates, either 1 p,mol/l EBV primers or 300 nmol/l (nanomolar) HER2 primers, and 1 unit of Taq polymerase in a final reaction volume of 50 p1l. Fifty microliters of mineral oil was layered over the reaction mix. After an initial 5-minute incubation at 95°C, the samples were subjected to 40 cycles of 1 minute at 950C, 1 minute at 55°C, and 2 minutes at 72°C. After the last cycle, the samples were held at 72°C for 7 minutes, then cooled to 40C. Eighteen microliters of the PCR product and 2 pul of loading buffer were electrophoresed through a 2% NuSieve agarose (FMC BioProducts, Rockland, ME)/ 0.5% agarose (Bethesda Research Laboratories, Bethesda, MD) gel for 1.5 to 2 hours at 100 V. The gel was blotted overnight onto an Oncor nylon membrane, prehybridized for 0.5 hour at room temperature in Oncor Membrane Blocking Solution, and hybridized for 4 hours at 450C in 10 ml Oncor Hybrisol III with 100 to 200 ng of end-labeled probe. (Oligonucleotide probes were prepared by 5'-end-labeling using y[32P] adenosine triphosphate and T4 DNA kinase.) The membrane was then washed twice for 5 minutes each at room temperature and once for 10 minutes at 55°C with 0.1 6x SSC, saline sodium citrate, 0.1% sodium dodecyl sulfate. Clear bands were generally visible after 4 to 16 hours of expo-
Table 1. Primers and Probes UsedforPCR Epstein-Barr Virus Primers and Probe Sense Primer: 5' GACGAGGGGCCAGGTACAGG 3' Antisense Primer: 5' GCAGCCAATGCTTCTTGGACGTTTTTGG 3' Probe: 5' CGTCCTCGTCCTCTTCCCCGTCCACGTCCATGGTTATCACC 3' HER2 Gene Primers and Probe Sense Primer: 5' GGGAAAACCGCGGACGCCTG 3' Antisense Primer: 5' GTCCCTGTGTACGAGCCGCAC 3' Probe: 5' GGACCTGCTGAACTGGTGTATGCAGATTGCC 3'
EBV in Hodgkin's Disease
395
AJP August 1991, Vol. 139, No. 2
sure on Kodak XAR5 film (Eastman-Kodak, Rochester, NY).
Results and Discussion We performed PCR analysis using primers specific for the IR3 region of EBV and the coding region of the HER2 gene. The primers for the HER2 gene were included as a control to monitor the amplification ability of a single-copy gene in the DNA extracted from the formalin-fixed, paraffin-embedded tissue samples. Each primer set was incubated with the template DNA in a separate reaction tube because we noticed that including more than one set of primers at a time can lead to interference of amplification by one of the primer sets (also see ref.9). After the PCR reactions, an aliquot of the amplified DNA was run on an agarose gel, transferred onto a nylon membrane, and hybridized to an oligonucleotide probe specific for EBV or HER2.
We investigated the presence of EBV DNA in 65 cases of Hodgkin's disease, including all subtypes. Of the 65 cases examined, 12 were diagnosed as lymphocyte predominance-diffuse variant, 19 as lymphocyte predominance-nodular variant, 10 as nodular sclerosis, 1 1 as mixed cellularity, and 13 as lymphocyte depleted. Figures 1 and 2 show representative Southern blots for HER2 (Figure 1) and EBV (Figure 2) for 16 cases of lymphocyte predominance-nodular variant Hodgkin's disease. Table 2 shows the results for all of the cases in our series. Excluding cases in which the HER2 control could not be amplified from a sample, the results can be summarized as follows: 55% of the lymphocyte predominance-diffuse variant subtype, 25% of the lymphocyte predominance-nodular variant subtype, 33% of the nodular sclerosis subtype, 40% of the mixed cellularity subtype, and 55% of the lymphocyte depleted subtype were positive. Thus 40% overall of the cases demonstrated EBV-related DNA sequences. The differences in the fre-
6 .... :.: -:5 .:. . ..7: A:. 3 4;... .1- ::-f:2:: ..
I
:., f
F.
-
.E v.
3.
.
...j...
Yvr Figure 1. Southern blot analvsisfor HER2 gene in lymphocyte predominance-nodular variant Hodgkin's disease. Cell Ivsates were prepared from 16 cases of lymphocyte predominance-nodular variant Hodgkin's disease. PCR reactions were performed using primers specific for the HER2 oncogene, aliquots of the products uwere run on agarose gels, blotted onto nylon, and probed with an oligonucleotide specific for the HER2 gene. Exposure time uas 4 hours at - 70°C The lane designated with the minus symbol shows a reaction performed in the absence of lysate; the lane designated with a plus symbol shows a reaction performed using a Ivsate derived from the Raji cell line. M designates the lane containing molecular weight markers (4X1 74 cleaved with Hae III; sizes (in base pairs) are indicated to the right of the markers in the top portion of the figure). All procedures were as described in Materials and Methods
8.
^.-: ,.;-', *
1'. Xi. . .> !;
396
Wright et al
AJP August 1991, Vol. 139, No. 2
..
'i'
..;. .
. \.
t5
:.6: 7
8.: 8
.- .'.mX wn.:
A.
:;::
..
'.;;
.' i .'Xi W e;' .';^
: .'
Figure 2. Southern blotanalvsisforEBVin lymphocgtepredominance-nodulartvariant Hodgkin'sdisease. All conditionsand designations are as described for Figure l with the following exceptions: the primers used uere specific for the EBV IR3 repeat, the probe was specific for EBV DNA and the exposure time of the film was 15 hours at -70°C Cases 3, 6, 7, and 13 shouw positive signals. --
-
-
..
1.
.
I
.
.
quency of EBV identification between histologic subtypes were not statistically significant. As a control, we also examined 13 lymph node biopsies from patients demonstrating nonspecific reactive hyperplasias. These cases represented a variety of disease processes, including cat scratch disease, toxoplasmosis, and reactive hyperplasias of unknown origin; however all of these patients had non-neoplastic disease and were not known to be immunosuppressed. These results, also tabulated in Table 2, show that 3 of the 12 cases
.
.
positive for HER2 were also positive for EBV. Figure 3 shows a comparison of the HER2 and EBV signals in the three EBV-positive control cases run in parallel with one of the lymphocyte predominance-diffuse variant cases typical of the majority of the Hodgkin's disease cases. As can be seen in the figure, the HER2 signals from the controls were as intense as the HER2 signal from the Hodgkin's disease case, but in only one was the EBV signal comparable to the level seen in the Hodgkin's disease cases.
Table 2. Summary of PCR Results for HER2 and EBV in Lymph Node Biopsies Number of cases examined HER-2 positive Biopsy type Hodgkin's disease Lymphocyte predominance 12 Diffuse variant 11 Lymphocyte predominance Nodular variant 19 16 10 Nodular sclerosis 9 11 Mixed cellularity 10 11 13 Lymphocyte depletion 12 13 Non-neoplastic
EBV positive
6 4 3 4 6 3
EBV in Hodgkin's Disease
397
AJP August 1991, Vol. 139, No. 2
EBV
HE.2
.
-Rs- Z-....3..
4.:-. 5
.6
8.- . 7..; A.83
.. .. . . .: ~~~~~~~~~~~~~~~~~~~~~~..-........:.-
:
.A4$&
**'.-;bS
Detection of Epstein-Barr Virus Sequences in Hodgkin's Disease by the Polymerase Chain Reaction Cynthia F. Wright,* Ann H. Reid,* Mark M. Tsai,* Kathleen M. Ventre,* PamelaJ. Murari,t Glauco Frizzera,t and TimothyJ. O'Leary* From the Departments of Cellular Pathology* and Hematologic and Lymph Node Pathology, t Arned Forces Institute of Pathology, Washington, DC
The authors examined paraffin-embedded lymph node biopsies from 65 cases of Hodgkin's disease for the presence of Epstein-Barr virus (EBV) DNA, using the highly sensitive polymerase chain reaction technique. Overall 40% of the cases were positiveforEBV DNA, there were no statistically significant differences in the frequency of EBV positivity among the different subtypes of Hodgkin's disease. These results are in agreement with those of previous studies that employed less sensitive detection techniques and suggest that EBV either is present in pathologic tissues only in some phases of the evolution of Hodgkin's disease or is a pathogenetic factor involved in only a portion of cases. (Am JPathol 1991, 139:393-398)
The cause of Hodgkin's disease is unknown. Serologic evidence suggests that development of Hodgkin's disease may be preceded by Epstein-Barr virus (EBV) activation in some patients, but the strength of this association is much lower than that for Burkitt's lymphoma.1 Staal and coworkers2 have recently surveyed 151 malignant and nonmalignant lymphoid tissue samples by Southern blotting for EBV DNA. Twenty-nine percent of Hodgkin's disease samples demonstrated EBV DNA, as did several samples from diffuse large cell lymphoma, whereas most other lymphomas did not.2 More recently, by using in situ hybridization, EBV has been identified in Reed-Sternberg cells in about 20% of cases of Hodgkin's disease.3 Weiss and co-workers4 have also surveyed cases of Hodgkin's disease for immunoglobulin gene rearrangements. Six of seven cases containing very numerous Reed-Sternberg cells demonstrated clonal heavy- and light-chain immunoglobulin gene rearrangements, with-
out rearrangements of the T-cell receptor gene. These results suggest a clonal B-cell origin for the ReedSternberg cells, although other evidence supports a Tcell origin for these cells.5 The idea that at least some cases of Hodgkin's disease could represent a clonal Bcell proliferation resulting from EBV infection is not unreasonable, because such a relationship between Burkitt's lymphoma and EBV infection is well established. Because most previous studies have not demonstrated the presence of EBV DNA in the majority of Hodgkin's disease cases, the relationship between EBV infection and the development of this disorder has remained uncertain. These previous studies, however, were done either by Southern blotting or by in situ hybridization techniques, which may not have been sufficiently sensitive to detect EBV in many cases where infection is present. Polymerase chain reaction (PCR) provides a method by which viral gene sequences can be identified with great sensitivity.6 If EBV plays an important ongoing role in the pathogenesis of Hodgkin's disease, one might expect a sufficient number of viral genes to be present to allow detection by this technique in every case of Hodgkin's disease. In this report we describe a rapid and accurate method for identifying EBV DNA sequences in formalin-fixed, paraffin-embedded tissue from lymph node biopsies. We then present the results of this assay applied to 65 cases of Hodgkin's disease and 13 cases of non-neoplastic disease.
Materials and Methods Sixty.five lymph node biopsy specimens consisting of both slides and formalin-fixed, paraffin-embedded tissue from patients with Hodgkin's disease and 13 specimens Supported by Intramural funds of the Armed Forces Institute of Pathology. The opinions expressed in this article are the personaJ views of the authors and are not to be construed as representing the views of the Department of the Army or the Department of Defense. Accepted for publication April 2, 1991. Address reprint requests to Cynthia F. Wright, Armed Forces Institute of Pathology, Department of Cellular Pathology, Washington, DC 203066000.
393
394
Wright et al
AJP August 1991, Vol. 139, No. 2
of non-neoplastic lymph nodes were identified in the files of the Armed Forces Institute of Pathology (AFIP). Paraffin-embedded cells from an EBV-containing Burkitt's lymphoma cell line (Raji) were used as a positive control for EBV DNA. Negative control material consisted of DNA extracted from a histiocytic lymphoma cell line (SUDHL6), which had been obtained from Dr. Alan Epstein. In addition, negative controls for reagent contamination, consisting of all PCR reagents except template DNA, were run each time a PCR assay was performed. A segment of the EBV IR3 region was selected for identification. The primers and probe for this sequence were designed by Synthetic Genetics (San Diego, CA) and have been published in their catalogue (Table 1). This primer pair gives rise to a 240-base pair amplified product. To ensure that adequate DNA was available for amplification, each case was assayed for the single-copy HER2 gene. The primers and probes for this gene were selected baced on a published partial sequence for the gene7 (Table 1) and give rise to a 241-base pair amplified product. The procedure for carrying out PCR amplification from formalin-fixed, paraffin-embedded sections was modified from that of Shibata and coworkers.8 Two 6-,u sections of routinely processed, paraffin-embedded tissue were cut from the block and placed in an Eppendorf tube. A fresh microtome blade was used for every specimen to avoid carryover of DNA from one specimen to the next. The paraffin was dissolved by vortexing the sections in 800 pI of xylene. After addition of 400 RI of ethanol, the tube was vortexed again, and centrifuged at 14,000 rpm for 5 minutes. The supernatant was decanted and the sample resuspended by vortexing in 800 RI of ethanol. After another 5-minute centrifugation, the supernatant was decanted and any remaining ethanol was removed with a microcapillary pipet. The sample was resuspended in 100 IlI of nonionic detergent buffer (50 mmol/I [millimolar] KCI, 10 mmol/I TRIS-HCI (pH 8.3), 2.5 mmol/I MgCI2, 0.45% Nonidet P-40, and 0.45% Tween 20) to which 2.4 RI of 2.5 mg/ml Proteinase K was added just before use.
The sample was incubated at 550C for 1 hour and 950C for 10 minutes to inactivate the protease. The tube was then centrifuged for 5 minutes. A 6-,u aliquot of the supernatant was removed and diluted to 15 p1l. Of this dilution, 0.5 ,ul and 2.5 p,l were added to the PCR reaction mix, representing 1/25o and 1/5o, respectively, of the DNA extracted from a 6-pu tissue slice. Generally about 80% of the cases gave a positive signal for the control HER2 gene at these dilutions; cases remaining negative were retested using the equivalent of 1/5 to 1/Ao of a 6-,p section. We were able to obtain a clear positive HER2 signal in about 90% of the cases assayed. The PCR reaction mix contained 5 p1 1 Ox Taq polymerase buffer (500 mmol/I KCI, 100 mmol/I TRIS-HCI, 15 mmol/l MgCI2, and 0.1% gelatin), 200 p,mol/I (micromolar) deoxy nucleoside triphosphates, either 1 p,mol/l EBV primers or 300 nmol/l (nanomolar) HER2 primers, and 1 unit of Taq polymerase in a final reaction volume of 50 p1l. Fifty microliters of mineral oil was layered over the reaction mix. After an initial 5-minute incubation at 95°C, the samples were subjected to 40 cycles of 1 minute at 950C, 1 minute at 55°C, and 2 minutes at 72°C. After the last cycle, the samples were held at 72°C for 7 minutes, then cooled to 40C. Eighteen microliters of the PCR product and 2 pul of loading buffer were electrophoresed through a 2% NuSieve agarose (FMC BioProducts, Rockland, ME)/ 0.5% agarose (Bethesda Research Laboratories, Bethesda, MD) gel for 1.5 to 2 hours at 100 V. The gel was blotted overnight onto an Oncor nylon membrane, prehybridized for 0.5 hour at room temperature in Oncor Membrane Blocking Solution, and hybridized for 4 hours at 450C in 10 ml Oncor Hybrisol III with 100 to 200 ng of end-labeled probe. (Oligonucleotide probes were prepared by 5'-end-labeling using y[32P] adenosine triphosphate and T4 DNA kinase.) The membrane was then washed twice for 5 minutes each at room temperature and once for 10 minutes at 55°C with 0.1 6x SSC, saline sodium citrate, 0.1% sodium dodecyl sulfate. Clear bands were generally visible after 4 to 16 hours of expo-
Table 1. Primers and Probes UsedforPCR Epstein-Barr Virus Primers and Probe Sense Primer: 5' GACGAGGGGCCAGGTACAGG 3' Antisense Primer: 5' GCAGCCAATGCTTCTTGGACGTTTTTGG 3' Probe: 5' CGTCCTCGTCCTCTTCCCCGTCCACGTCCATGGTTATCACC 3' HER2 Gene Primers and Probe Sense Primer: 5' GGGAAAACCGCGGACGCCTG 3' Antisense Primer: 5' GTCCCTGTGTACGAGCCGCAC 3' Probe: 5' GGACCTGCTGAACTGGTGTATGCAGATTGCC 3'
EBV in Hodgkin's Disease
395
AJP August 1991, Vol. 139, No. 2
sure on Kodak XAR5 film (Eastman-Kodak, Rochester, NY).
Results and Discussion We performed PCR analysis using primers specific for the IR3 region of EBV and the coding region of the HER2 gene. The primers for the HER2 gene were included as a control to monitor the amplification ability of a single-copy gene in the DNA extracted from the formalin-fixed, paraffin-embedded tissue samples. Each primer set was incubated with the template DNA in a separate reaction tube because we noticed that including more than one set of primers at a time can lead to interference of amplification by one of the primer sets (also see ref.9). After the PCR reactions, an aliquot of the amplified DNA was run on an agarose gel, transferred onto a nylon membrane, and hybridized to an oligonucleotide probe specific for EBV or HER2.
We investigated the presence of EBV DNA in 65 cases of Hodgkin's disease, including all subtypes. Of the 65 cases examined, 12 were diagnosed as lymphocyte predominance-diffuse variant, 19 as lymphocyte predominance-nodular variant, 10 as nodular sclerosis, 1 1 as mixed cellularity, and 13 as lymphocyte depleted. Figures 1 and 2 show representative Southern blots for HER2 (Figure 1) and EBV (Figure 2) for 16 cases of lymphocyte predominance-nodular variant Hodgkin's disease. Table 2 shows the results for all of the cases in our series. Excluding cases in which the HER2 control could not be amplified from a sample, the results can be summarized as follows: 55% of the lymphocyte predominance-diffuse variant subtype, 25% of the lymphocyte predominance-nodular variant subtype, 33% of the nodular sclerosis subtype, 40% of the mixed cellularity subtype, and 55% of the lymphocyte depleted subtype were positive. Thus 40% overall of the cases demonstrated EBV-related DNA sequences. The differences in the fre-
6 .... :.: -:5 .:. . ..7: A:. 3 4;... .1- ::-f:2:: ..
I
:., f
F.
-
.E v.
3.
.
...j...
Yvr Figure 1. Southern blot analvsisfor HER2 gene in lymphocyte predominance-nodular variant Hodgkin's disease. Cell Ivsates were prepared from 16 cases of lymphocyte predominance-nodular variant Hodgkin's disease. PCR reactions were performed using primers specific for the HER2 oncogene, aliquots of the products uwere run on agarose gels, blotted onto nylon, and probed with an oligonucleotide specific for the HER2 gene. Exposure time uas 4 hours at - 70°C The lane designated with the minus symbol shows a reaction performed in the absence of lysate; the lane designated with a plus symbol shows a reaction performed using a Ivsate derived from the Raji cell line. M designates the lane containing molecular weight markers (4X1 74 cleaved with Hae III; sizes (in base pairs) are indicated to the right of the markers in the top portion of the figure). All procedures were as described in Materials and Methods
8.
^.-: ,.;-', *
1'. Xi. . .> !;
396
Wright et al
AJP August 1991, Vol. 139, No. 2
..
'i'
..;. .
. \.
t5
:.6: 7
8.: 8
.- .'.mX wn.:
A.
:;::
..
'.;;
.' i .'Xi W e;' .';^
: .'
Figure 2. Southern blotanalvsisforEBVin lymphocgtepredominance-nodulartvariant Hodgkin'sdisease. All conditionsand designations are as described for Figure l with the following exceptions: the primers used uere specific for the EBV IR3 repeat, the probe was specific for EBV DNA and the exposure time of the film was 15 hours at -70°C Cases 3, 6, 7, and 13 shouw positive signals. --
-
-
..
1.
.
I
.
.
quency of EBV identification between histologic subtypes were not statistically significant. As a control, we also examined 13 lymph node biopsies from patients demonstrating nonspecific reactive hyperplasias. These cases represented a variety of disease processes, including cat scratch disease, toxoplasmosis, and reactive hyperplasias of unknown origin; however all of these patients had non-neoplastic disease and were not known to be immunosuppressed. These results, also tabulated in Table 2, show that 3 of the 12 cases
.
.
positive for HER2 were also positive for EBV. Figure 3 shows a comparison of the HER2 and EBV signals in the three EBV-positive control cases run in parallel with one of the lymphocyte predominance-diffuse variant cases typical of the majority of the Hodgkin's disease cases. As can be seen in the figure, the HER2 signals from the controls were as intense as the HER2 signal from the Hodgkin's disease case, but in only one was the EBV signal comparable to the level seen in the Hodgkin's disease cases.
Table 2. Summary of PCR Results for HER2 and EBV in Lymph Node Biopsies Number of cases examined HER-2 positive Biopsy type Hodgkin's disease Lymphocyte predominance 12 Diffuse variant 11 Lymphocyte predominance Nodular variant 19 16 10 Nodular sclerosis 9 11 Mixed cellularity 10 11 13 Lymphocyte depletion 12 13 Non-neoplastic
EBV positive
6 4 3 4 6 3
EBV in Hodgkin's Disease
397
AJP August 1991, Vol. 139, No. 2
EBV
HE.2
.
-Rs- Z-....3..
4.:-. 5
.6
8.- . 7..; A.83
.. .. . . .: ~~~~~~~~~~~~~~~~~~~~~~..-........:.-
:
.A4$&
**'.-;bS
