APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Apr. 1991,
p.
1013-1017
Vol. 57, No. 4
0099-2240/91/041013-05$02.00/0 Copyright © 1991, American Society for Microbiology
Detection of Escherichia coli and Shigella spp. in Water by Using the Polymerase Chain Reaction and Gene Probes for uid ASIM K. BEJ,l* JOSEPH L. DICESARE,2 LAWRENCE HAFF,2 AND RONALD M. ATLAS1
Department of Biology, University of Louisville, Louisville, Kentucky 40292,1 and Perkin-Elmer Corporation, Norwalk, Connecticut 068592 Received 19 October 1990/Accepted 28 January 1991
A method was developed for the detection of the fecal coliform bacterium Escherichia coli, using the polymerase chain reaction and gene probes, based on amplifying regions of the uid gene that code for 1,-glucuronidase, expression of which forms the basis for fecal coliform detection by the commercially available Colilert method. Amplification and gene probe detection of four different regions of uid specifically detected E. coli and Shigella species, including B-glucuronidase-negative strains of E. coli; no amplification was observed for other coliform and nonenteric bacteria.
min. The DNA pellets were washed once with cold 70% alcohol and dried under vacuum. Using this procedure, we were able to recover 100 to 250 p.g of purified genomic DNA from each bacterial culture. One hundred American Type Culture Collection strains were tested to determine the specificity of detection (2). These included strains from all genera of the family Enterobacteriaceae as well as numerous other organisms found in water and associated with humans. Also, 4 clinical MUGnegative E. coli isolates (7), 20 environmental MUG-positive E. coli isolates, and 10 environmental MUG-negative E. coli isolates were tested. A mixture of purified genomic DNAs (1 ,ug each) from human placenta (Sigma) and Pseudomonas cepacia, Salmonella typhimurium, Klebsiella oxytoca, Citrobacter freundii, Enterobacter aerogenes bacterial strains also were tested alone or mixed with 50 ng of E. coli genomic DNA to examine whether nonspecific target DNAs would interfere with this method of E. coli detection. PCR amplification. A 0.147-kb coding region of the E. coli uidA gene, based on the sequence reported by Jefferson et al. (13), was amplified by PCR, using the 20- and 21-mer primers UAL-754 (5'-AAAACGGCAAGAAAAAGCAG-3') and UAR-900 (5'-ACGCGTGGTTACAGTCTTGCG-3'). Primer UAL-754 was located between bp 754 and 773 and primer UAR-900 was located between bp 880 and 900 in the amino-terminal coding region of the uidA gene of E. coli. Another set of 20-mer primers, UAL-1939 (5'-TATGGAA TTTCGCCGATTTT-3') and UAR-2105 (5'-TGTTTGCCTC CCTGCTGCGG-3'), was used to amplify a 0.166-kb region of the uidA gene. Primer UAL-1939 was located between bp 1939 and 1958 and primer UAR 2105 was located between bp 2085 and 2104 closer to the carboxyl region of the uidA gene of E. coli. A 0.153 kb portion of the regulatory region of uid, designated uidR, which is located upstream of the uidA structural gene based on the sequence reported by Blanco et al. (6), was amplified with the 22-mer primers URL-301 (5'-TGTT ACGTCCTGTAGAAAGCCC-3') and URR-432 (5'-AAAAC TGCCTGGCACAGCAATT-3'). Primer URL-301 was located between bp 301 and 322 and primer URR-432 was located between bp 432 and 453 of the uidR sequence of E. coli. All primer sequences were compared with the GenBank nucleotide sequence data bank, using the Fasta program, for possible homologies with other nontarget sequences. PCR amplification was performed with a DNA thermal
The Colilert test, which has been proposed as an alternate to conventional plating procedures for water quality monitoring, is based on detecting ,-galactosidase activity, using a colorimetric reaction and the substrate o-nitrophenyl-p-galactopyranoside for total coliforms, and 3-D-glucuronidase activity, using enzymatic transformation of the fluorogenic substrate 4-methylumbelliferyl-,-glucuronidide (MUG) to indicate the presence of the fecal bacterium Escherichia coli (8-10). The U.S. Environmental Protection Agency has accepted the Colilert test for total coliform detection but has deferred acceptance of Colilert for E. coli-specific detection (11). A MUG-based confirmation test for E. coli has been accepted by the U.S. Environmental Protection Agency (11). We have reported previously that polymerase chain reaction (PCR)-gene probe methods can be used to detect total coliform bacteria based on the lacZ gene and to detect E. coli, Salmonella spp., and Shigella spp. based on amplification of regions of the lamB gene, which codes for 3-galactosidase (5). In this study we examined the ability of the uid gene, which codes for the 3-glucuronidase enzyme, to serve as a target for PCR-gene probe detection of E. coli. Our aim was to develop a PCR amplification-gene probe detection method that permits specific detection of target fecal coliform bacteria, using the equivalent target gene, the expression of which forms the basis for the second stage of the Colilert test. Thus, PCR-gene probe detection of lacZ and uid would parallel the targets of the Colilert test for total and fecal coliforms, respectively. MATERIALS AND METHODS Bacterial strains, recovery of DNA, and specificity of PCR detection. To determine the specificity of uid for E. coli detection, DNA was extracted from exponential cultures by alkaline lysis with 0.5% sodium dodecyl sulfate treatment, using the procedure of Ausubel et al. (3). Following alkaline lysis, 0.7 M NaCl-1% hexadecyltrimethyl ammonium bromide was used to complex with polysaccharides. Proteins and other impurities were removed by using chloroformisoamyl alcohol (24:1), and DNA was further purified by phenol-chloroform-isoamyl alcohol (24:24:2) extractions. DNA was then precipitated by 2.5 volumes of isopropyl alcohol and pelleted by centrifugation at 12,000 x g for 15 *
Corresponding author. 1013
1014
BEJ ET AL.
cycler (Perkin-Elmer Cetus Corp., Norwalk, Conn.). The PCR solution contained 1 x PCR reaction buffer (10x PCR reaction buffer contains 500 mM KCl, 500 mM Tris chloride [pH 8.9], and 25 mM MgCl2), 200 ,uM each of the deoxynucleoside triphosphate (Perkin-Elmer Cetus), 0.2 to 0.5 ,uM
each of the primers, and 2.5 U of Taq DNA polymerase (Perkin-Elmer Cetus). The total volume for PCR reaction was 100 1.l. Typically, 1 ,ug (as determined by a Lambda III spectrophotometer [Perkin-Elmer Corp.]) of template DNA from each bacterial strain was initially denatured at 95°C for 3 min. Then a total of 25 PCR cycles were run, using a two-temperature PCR cycle with denaturation at 94°C for 1 min and primer annealing and extension at 50°C for primers UAL-754 and UAR-900, 50°C for primers UAL-1939 and 2105, and at 59°C for primers URL-301 and URR-432 for 1 min. The annealing temperatures for each of the three sets of uid primers were 5°C lower than the melting temperature, as determined by using a computer-aided program, called Oligo (14). Oligonucleotide primers were synthesized with a PCRMATE DNA synthesizer (Applied Biosystems, Foster City, Calif.) and purified by using either Poly-Pak cartridges (Glen Research, Herndon, Va.) or reverse-phase high-performance liquid chromatography with a C8 3-,um reverse-phase column (Perkin-Elmer). Detection of amplified DNAs. PCR-amplified DNAs were detected by using gel electrophoresis and radiolabeled gene probes. An aliquot (1/10 volume) of the PCR-amplified samples was separated by 10% vertical polyacrylamide gel electrophoresis, using TBE buffer (0.089 M Tris-borate, 0.089 M boric acid, and 0.002 M Na2EDTA [pH 8.0]), or by 4% NuSieve (1:3; 1 part of NuSieve and 3 parts of SeaKem LE) agarose gel (catalog no. 50092, FMC), using TAE buffer (0.04 M Tris-acetate and 0.001 M Na2EDTA [pH 8.0]) (3), at 5.7 to 9.0 V/cm for 2 to 3 h. The gels were stained in 2 x 10-'% ethidium bromide solution for 5 to 10 min and visualized with a Photo/Prepl UV transilluminator (Fotodyne, Inc., New Berlin, Wis.). For Southern blot detection, the PCR-amplified DNAs, which were separated by either agarose gel or polyacrylamide gel electrophoresis described above) were denatured by 0.4 M NaOH treatment for 20 to 30 mmn and transferred to a Zetaprobe nylon membrane (Bio-Rad Laboratories, Richmond, Calif.) by electroblotting, using a Trans-Blot apparatus (Bio-Rad) as described by the manufacterer. The following gene probes were used for the detection of various PCR-amplified DNAs: for the 0.147-kb uidA amplified DNAs, a 50-mer oligonucleotide probe, UAP-1 (5'TGCCGGGATCCATCGCAGCGTAATGCTCTACACCAC GCCGAACACCTGGG-3'); for the 0.166-kb uidA amplified DNA, a 50-mer oligonucleotide probe, UAP-2 (5'AAAG GGATCTTCACTCGCGACCGCAAACCGAAGTCGGCG GCTTTTCTGCT-3'); and for the 0.153-kb uidR amplified DNA, a 40-mer URP-1 (5'CAACCCGTGAAATCAAAAAA CTCGACGGCCTGTGGGCATT-3') oligonucleotide probe. The oligonucleotide gene probes were radiolabeled at their 5' ends by a modified version of the forward reaction described by Ausubel et al. (3). The 30-1l reaction solution used in this procedure contained 50 mM Tris hydrochloride (pH 7.5), 10 mM MgCl2, 5 mM dithiothreitol (Sigma), 1 mM KCl, 5 pmol of oligonucleotide probe, 120 pmol of [y-32p] ATP (specific activity, >3,000 Ci/mmol; New England Nuclear Corp., Boston, Mass.), 1 mM spermidine (disodium salt), and 20 U of T4 polynucleotide kinase (US Biochemical Corp., Cleveland, Ohio). The reaction mixture was incubated at 37°C for 1 h, and radiolabeled probes were concen-
APPL. ENVIRON. MICROBIOL.
trated and purified by using an IsoGene DNA purification kit
(Perkin-Elmer Cetus, Emeryville, Calif.). Sensitivity of PCR detection. To determine the sensitivity of PCR-gene probe detection, genomic DNA from E. coli was serially diluted to establish a concentration range of 1 to 100 ng and PCR amplification was performed with UAL-1939
and UAR-2104 primers for the uidA gene and URL-301 and URR-453 primers for the uidR gene of E. coli. Following a total of 45 cycles of PCR amplification, 0.1 volume of each of the PCR-amplified samples was analyzed as follows. The amplified DNA was denatured by adding 0.1 volume of 3 M NaOH-0.1 M Na2EDTA, incubated at room temperature for 5 min, and neutralized with 1 volume of NH4OAc; the samples were then spotted on a Zetaprobe nylon membrane (Bio-rad) by using a Bio-Rad slot blot manifold at a vacuum pressure of 4 to 5 lb/in2. The hybridization was performed with radiolabeled UAP-1 and URP-1 oligonucleotide probes, respectively, as described previously. Similarly, 1 to 10 E. coli cells from 100-ml dechlorinated potable water samples were recovered by filtering through an ethanol-presoaked 13-mm Fluoropore membrane (FHLP; 0.5-pm pore size; Millipore Corp.), using a Swinnex filter holder and a filter manifold (Millipore). The filter was rolled and sterily transferred with forceps to a 0.6-ml GeneAmp reaction tube with cell-coated side facing inwards. One hundred microliters of 0.1% diethylpyrocarbonate (Sigma)treated autoclaved water was added to the tube, which was vortexed vigorously for 5 to 10 s to release the cells from the filter surface to the liquid phase. Five freeze-thaw cycles were performed, using an ethanol-dry ice bath and warm water (45 to 50°C), respectively. At every thaw cycle the sample was vortexed for 5 s to ensure the release of cells or DNA or both from the surface of the filter. The PCR reaction mix was added to the tube to a final volume of 150 Rl, and DNA was amplified without further purification. PCR amplifications were performed with primers for the uidR gene, URL-301 and URR-453. The amplified DNAs were detected by radiolabeled URP-1 oligonucleotide probe as described above. RESULTS AND DISCUSSION Specificity of E. coli PCR detection with uid. PCR amplification with primers UAL-754 and UAR-900 to amplify the amino coding region of uidA produced amplified DNA bands of 0.147 kb for all E. coli strains and all four strains of Shigella spp. (Fig. 1A). This primer set also produced positive amplified DNA bands of identical molecular weight for all four MUG-negative isolates of E. coli (Fig. 1B). Southern blot DNA-DNA hybridization with a 50-mer radiolabeled UAP-1 oligonucleotide probe showed strong hybridization signals. No amplification was observed for other bacterial strains tested in this study, suggesting that the target amino-terminal end of the uidA gene is unique and conserved in E. coli and Shigella spp. The set of primers, UAL-1939 and UAR-2104, located at the carboxyl coding region of the uidA gene produced amplified DNA bands of 0.166 kb for E. coli and all four strains of Shigella spp. (Fig. 2A). The MUG-negative isolates of E. coli also showed amplification of DNA of the same molecular weight (Fig. 2B). No amplification was observed when DNAs from other bacterial strains were used as targets for PCR. Southern blot DNA-DNA hybridizations with a 50-mer radiolabeled UAP-2 oligonucleotide probe showed strong hybridization signals of all amplified DNAs from E. coli strains, including MUG-negative strains, and
DETECTION OF E. COLI AND SHIGELLA SPP. IN WATER
VOL. 57, 1991
2
1
4
3
6
5
8
7
9
10
11
1015
12 1314
kb
-0.147-
A 5
4
4
3
2
kb
5
w__WW
0.147
B FIG. 1. Ethidium bromide stained 4% NuSieve-SeaKem (1:3) agarose gel (left) and Southern blot hybridization (right) analyses of the PCR-amplified DNA (A) from the uidA gene of E. coli, using UAL-754 and UAR-900 primers and radiolabeled UAP-1 oligonucleotide probe, and (B) of MUG-negative E. coli strains, using iuidA primers and probe. Lanes: 1, E. coli; 2, Shigella sonnei; 3, S. flexneri; 4, S. boydii; 5, S. dysenteriae; 6, 123-bp DNA ladder as size standard; 7, Salmonella typhimurium; 8, C. freundii; 9, Enterobacter aerogenes; 10, Enterobacter cloaceae; 11, Aeronomas hydrophila; 12, Klebsiella pneumoniae; 13, Streptococcus lactis; and 14, Pseudomonas alcaligenes. (B) Lanes: 1, E. coli 217; 2, E. coli 220; 3, E. coli 232; 4, E. coli 245; and 5, 123-bp DNA ladder as size standard.
Also, none of the three sets of uid primers showed amplification with nonspecific target DNA from human and several bacterial strains, unless DNA from E. coli was added to the mixture. Thus, nontarget DNA did not interfere with PCR amplification of different regions of uid even when a total of 120 times more nontarget than target DNA from human and various bacteria was present. Sensitivity of PCR detection, using uidA and uidR genes. For monitoring purposes, PCR-gene probe-based detection of indicator and pathogenic organisms requires not only specificity, but also sufficient sensitivity to ensure the safety of the potable water. U.S. federal regulations require the detection level to be one bacterial cell per 100 ml of drinking water (1, 12). PCR-amplified DNA from as little as 10 fg of genomic DNA of E. coli was consistently detected when primers and
Shigella spp. This result suggests that the carboxyl end of the uidA gene is also unique and conserved in E. coli and Shigella spp. In addition to the iuidA gene, the regulatory region of i,id, located upstream of the uidA gene, designated WidR, was also used as a target DNA for PCR amplification. Primers URL-301 and URR-453 were used for the amplification of DNA from E. coli strains, including MUG-negative isolates, and Shigella spp. In all cases, a 0.152-kb amplified DNA band was observed in an ethidium bromide-stained polyacrylamide gel (Fig. 3A and B). Southern blot DNA-DNA hybridization with a 40-mer radiolabeled URP-1 oligonucleotide probe showed strong hybridization signals for all amplified DNAs, suggesting that the target uidR gene is present in E. coli and Shigella spp. used in this study. No amplification was observed for other bacterial strains.
2
1
kb
3
4
7
6
8
9
10
41 Q
QQ
0.166
5
A 1
2
3
4 5
kb
1
2
3
4
5
0.166_-4
B FIG. 2. Ethidium bromide-stained 4% NuSieve-SeaKem (1:3) agarose gel (left) and Southern blot hybridization (right) analyses of the PCR-amplified DNA (A) from the uidA gene of E. coli, using UAL-1939 and UAR-2105 primers and radiolabeled UAP-2 oligonucleotide probe, and (B) of MUG-negative E. coli strains, uidA primers and probe. (A) Lanes: 1, E. coli; 2, Shigella sonnei; 3, S. flexneri; 4, 123-bp DNA ladder as size standard; 5, S. boydii; 6, S. dysenteriae; 7, Salmonella typhimurium; 8, C. freundii; 9, Enterobacter aerogenes; and 10, Aeronomas hydrophila. (B) Lanes: 1, E. coli 217; 2, E. coli 220; 3, E. coli 232; 4, E. coli 245; and 5, 123-bp DNA ladder as size standard.
1016
BEJ ET AL.
ti;f-laMg0 1
APPL. ENVIRON. MICROBIOL.
2
3
4
5
1
2
3
4
5
B
FIG. 3. Ethidium bromide-stained 10% polyacrylamide gel (left) and Southern blot hybridization (right) analyses of the PCR-amplified DNA (A) from the uidR gene of E. coli, using URL-301 and URR-453 primers and radiolabeled URP-1 oligonucleotide probe, and (B) of MUG-negative E. coli strains, using uidA primers and probe. (A) Lanes: 1, E. coli; 2, Shigella sonnei; 3, S. flexneri; 4, S. boydii; 5, S. dysenteriae; 6, Salmonella typhimurium; 7, C. freundii; 8, Enterobacter aerogenes; 9, E. cloaceae; 10, Aeronomas hydrophila; 11, K. pneumoniae; 12, Streptococcus lactis; 14, Pseudomonas alcaligenes; and 15, 123-bp DNA ladder as size standard. Lanes: 1, E. coli 217; 2, E. coli 220; 3, E. coli 232; 4, E. coli 245; and 5, 123-bp DNA ladder as size standard.
probe for the uidR gene were used (Fig. 4). This level of detection is equivalent to the detection of one to two bacterial cells (4, 5). Approximately 18% of the time we were able to detect 1-fg level of genomic DNA, which closely corresponds to the expected Poisson distribution of the target gene (5). This detection level is as sensitive as reported previously for PCR-gene probe detection (5). When URL-301 and URR-453 primers and radiolabeled URP-1 probe were used for the amplification and detection
_
W~f9
%-i
;.
4o DNA
FIG. 4. Slot blot analysis after PCR amplification of various amounts of genomic E. coli DNA, using primers URL-301 and URR-453 for uidR amplification. No added target DNA was used as a negative control. For hybridization, radiolabeled URP-1 oligonucleotide probe was used.
of the uidR gene of E. coli, we were able to detect one to two viable cells of E. coli (as determined from the plate counts) consistently with this set of primer and probe. No PCR amplification signal was observed when the sample was diluted below the level of detectable viable cells as determined by a plating procedure. In conclusion, bacteria associated with human fecal contamination of potable water can be detected by PCR amplification and gene probe detection of uidA and uidR genes.
Moreover, PCR showed positive amplifications of both uidA and uidR targets for MUG-negative E. coli isolated from both clinical and environmental samples, which failed to show positive reactions with a 3-glucuronidase enzymefluorogenic substrate-based commercially available Colilert test. Thus, the gene probe detection may overcome the potential problem of the Colilert system, i.e., the failure to detect MUG-negative stains, which Chang et al. (7) have reported may constitute 30% of the fecal coliform bacteria in some water sources. Multiplex PCR amplification of lacZ for total coliforms (5) and uidA or uidR for fecal coliforms and the development of a nonisotopic gene probe detection technique, such as immobilized capture probes (4), can permit a rapid and reliable means of assessing the bacteriological safety of water and should provide an effective alternative methodology to the conventional viable culture methods. ACKNOWLEDGMENTS This study was funded by Perkin-Elmer Cetus Corp. We thank W. Chang for MUG-negative E. coli strains, M. Boyce for technical assistance, and K. Zinn for preparation of the manu-
script. REFERENCES 1. American Public Health Association. 1985. Standard methods for the examination of water and wastewater, 16th ed. American Public Health Association, Washington, D.C.
VOL. 57, 1991
DETECTION OF E. COLI AND SHIGELLA SPP. IN WATER
2. Atlas, R. M., A. K. Bej, S. McCarty, J. DiCesare, and L. Haff. 1991. In J. R. Hall and G. D. Glysson (ed.), Monitoring water in the 1990's: meeting new challenges. ASTM STP 1102. In press. 3. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. A. Smith, J. G. Sideman, and K. Struhl (ed.). 1987. Current protocols in molecular biology. John Wiley & Sons, Inc., New York. 4. Bej, A. K., M. H. Mahbubani, R. Miller, J. L. DiCesare, L. Haff, and R. M. Atlas. 1990. Multiplex PCR amplification and immobilized capture probes for detection of bacterial pathogens and indicators in water. Mol. Cell. Probes 4:353-365. 5. Bej, A. K., R. J. Steffan, J. DiCesare, L. Haff, and R. M. Atlas. 1990. Detection of coliform bacteria in water by polymerase chain reaction and gene probes. Appl. Environ. Microbiol. 56:307-314. 6. Blanco, C., P. Ritzenthaler, and M. Mata-Gilsinger. 1985. Nucleotide sequence of a regulatory region of the uidA gene in Escherichia coli K12. Mol. Gen. Genet. 199:101-105. 7. Chang, G. W., J. Brill, and R. Lum. 1989. Proportion of 3-glucuronidase-negative Escherichia coli in human fecal samples. Appl. Environ. Microbiol. 55:335-339. 8. Edberg, S. C., M. J. Allen, D. B. Smith, and the National Collaborative Study. 1989. National field evaluation of a defined substrate method for the simultaneous detection of total coli-
9. 10.
11. 12.
13. 14.
1017
forms and Escherichia coli from drinking water: comparison with presence-absence techniques. Appl. Environ. Microbiol. 55:1003-1008. Edberg, S. C., and M. M. Edberg. 1988. A defined substrate technology for the enumeration of microbial indicators of environmental pollution. Yale J. Biol. Med. 61:389-399. Edberg, S. C., and C. M. Kontnick. 1986. Comparison of beta-glucuronidase-based substrate systems for identification of Escherichia coli. J. Clin. Microbiol. 24:368-371. Federal Register. 1990. Drinking water: national primary drinking water regulations; analytical techniques coliform bacteria proposed rule. 55:22752-22756. Geldreich, E. E. 1983. Bacterial populations and indicator concepts in feces, sewage, stormwater and solid wastes, p. 51-97. In G. Berg (ed.), Indicators of viruses in water and food. Ann Arbor Science Publishers, Inc., Orlando, Fla. Jefferson, R. A., S. M. Burgess, and D. Hirsh. 1986. ,-Glucuronidase from Escherichia coli as a gene fusion marker. Proc. Natl. Acad. Sci. USA 83:8447-8451. Rychlik, W., and R. E. Rhods. 1989. A computer program for choosing optimal oligonucleotides for filter hybridization, sequencing and in vitro amplification of DNA. Nucleic Acids Res. 17:8543-8551.
p.
1013-1017
Vol. 57, No. 4
0099-2240/91/041013-05$02.00/0 Copyright © 1991, American Society for Microbiology
Detection of Escherichia coli and Shigella spp. in Water by Using the Polymerase Chain Reaction and Gene Probes for uid ASIM K. BEJ,l* JOSEPH L. DICESARE,2 LAWRENCE HAFF,2 AND RONALD M. ATLAS1
Department of Biology, University of Louisville, Louisville, Kentucky 40292,1 and Perkin-Elmer Corporation, Norwalk, Connecticut 068592 Received 19 October 1990/Accepted 28 January 1991
A method was developed for the detection of the fecal coliform bacterium Escherichia coli, using the polymerase chain reaction and gene probes, based on amplifying regions of the uid gene that code for 1,-glucuronidase, expression of which forms the basis for fecal coliform detection by the commercially available Colilert method. Amplification and gene probe detection of four different regions of uid specifically detected E. coli and Shigella species, including B-glucuronidase-negative strains of E. coli; no amplification was observed for other coliform and nonenteric bacteria.
min. The DNA pellets were washed once with cold 70% alcohol and dried under vacuum. Using this procedure, we were able to recover 100 to 250 p.g of purified genomic DNA from each bacterial culture. One hundred American Type Culture Collection strains were tested to determine the specificity of detection (2). These included strains from all genera of the family Enterobacteriaceae as well as numerous other organisms found in water and associated with humans. Also, 4 clinical MUGnegative E. coli isolates (7), 20 environmental MUG-positive E. coli isolates, and 10 environmental MUG-negative E. coli isolates were tested. A mixture of purified genomic DNAs (1 ,ug each) from human placenta (Sigma) and Pseudomonas cepacia, Salmonella typhimurium, Klebsiella oxytoca, Citrobacter freundii, Enterobacter aerogenes bacterial strains also were tested alone or mixed with 50 ng of E. coli genomic DNA to examine whether nonspecific target DNAs would interfere with this method of E. coli detection. PCR amplification. A 0.147-kb coding region of the E. coli uidA gene, based on the sequence reported by Jefferson et al. (13), was amplified by PCR, using the 20- and 21-mer primers UAL-754 (5'-AAAACGGCAAGAAAAAGCAG-3') and UAR-900 (5'-ACGCGTGGTTACAGTCTTGCG-3'). Primer UAL-754 was located between bp 754 and 773 and primer UAR-900 was located between bp 880 and 900 in the amino-terminal coding region of the uidA gene of E. coli. Another set of 20-mer primers, UAL-1939 (5'-TATGGAA TTTCGCCGATTTT-3') and UAR-2105 (5'-TGTTTGCCTC CCTGCTGCGG-3'), was used to amplify a 0.166-kb region of the uidA gene. Primer UAL-1939 was located between bp 1939 and 1958 and primer UAR 2105 was located between bp 2085 and 2104 closer to the carboxyl region of the uidA gene of E. coli. A 0.153 kb portion of the regulatory region of uid, designated uidR, which is located upstream of the uidA structural gene based on the sequence reported by Blanco et al. (6), was amplified with the 22-mer primers URL-301 (5'-TGTT ACGTCCTGTAGAAAGCCC-3') and URR-432 (5'-AAAAC TGCCTGGCACAGCAATT-3'). Primer URL-301 was located between bp 301 and 322 and primer URR-432 was located between bp 432 and 453 of the uidR sequence of E. coli. All primer sequences were compared with the GenBank nucleotide sequence data bank, using the Fasta program, for possible homologies with other nontarget sequences. PCR amplification was performed with a DNA thermal
The Colilert test, which has been proposed as an alternate to conventional plating procedures for water quality monitoring, is based on detecting ,-galactosidase activity, using a colorimetric reaction and the substrate o-nitrophenyl-p-galactopyranoside for total coliforms, and 3-D-glucuronidase activity, using enzymatic transformation of the fluorogenic substrate 4-methylumbelliferyl-,-glucuronidide (MUG) to indicate the presence of the fecal bacterium Escherichia coli (8-10). The U.S. Environmental Protection Agency has accepted the Colilert test for total coliform detection but has deferred acceptance of Colilert for E. coli-specific detection (11). A MUG-based confirmation test for E. coli has been accepted by the U.S. Environmental Protection Agency (11). We have reported previously that polymerase chain reaction (PCR)-gene probe methods can be used to detect total coliform bacteria based on the lacZ gene and to detect E. coli, Salmonella spp., and Shigella spp. based on amplification of regions of the lamB gene, which codes for 3-galactosidase (5). In this study we examined the ability of the uid gene, which codes for the 3-glucuronidase enzyme, to serve as a target for PCR-gene probe detection of E. coli. Our aim was to develop a PCR amplification-gene probe detection method that permits specific detection of target fecal coliform bacteria, using the equivalent target gene, the expression of which forms the basis for the second stage of the Colilert test. Thus, PCR-gene probe detection of lacZ and uid would parallel the targets of the Colilert test for total and fecal coliforms, respectively. MATERIALS AND METHODS Bacterial strains, recovery of DNA, and specificity of PCR detection. To determine the specificity of uid for E. coli detection, DNA was extracted from exponential cultures by alkaline lysis with 0.5% sodium dodecyl sulfate treatment, using the procedure of Ausubel et al. (3). Following alkaline lysis, 0.7 M NaCl-1% hexadecyltrimethyl ammonium bromide was used to complex with polysaccharides. Proteins and other impurities were removed by using chloroformisoamyl alcohol (24:1), and DNA was further purified by phenol-chloroform-isoamyl alcohol (24:24:2) extractions. DNA was then precipitated by 2.5 volumes of isopropyl alcohol and pelleted by centrifugation at 12,000 x g for 15 *
Corresponding author. 1013
1014
BEJ ET AL.
cycler (Perkin-Elmer Cetus Corp., Norwalk, Conn.). The PCR solution contained 1 x PCR reaction buffer (10x PCR reaction buffer contains 500 mM KCl, 500 mM Tris chloride [pH 8.9], and 25 mM MgCl2), 200 ,uM each of the deoxynucleoside triphosphate (Perkin-Elmer Cetus), 0.2 to 0.5 ,uM
each of the primers, and 2.5 U of Taq DNA polymerase (Perkin-Elmer Cetus). The total volume for PCR reaction was 100 1.l. Typically, 1 ,ug (as determined by a Lambda III spectrophotometer [Perkin-Elmer Corp.]) of template DNA from each bacterial strain was initially denatured at 95°C for 3 min. Then a total of 25 PCR cycles were run, using a two-temperature PCR cycle with denaturation at 94°C for 1 min and primer annealing and extension at 50°C for primers UAL-754 and UAR-900, 50°C for primers UAL-1939 and 2105, and at 59°C for primers URL-301 and URR-432 for 1 min. The annealing temperatures for each of the three sets of uid primers were 5°C lower than the melting temperature, as determined by using a computer-aided program, called Oligo (14). Oligonucleotide primers were synthesized with a PCRMATE DNA synthesizer (Applied Biosystems, Foster City, Calif.) and purified by using either Poly-Pak cartridges (Glen Research, Herndon, Va.) or reverse-phase high-performance liquid chromatography with a C8 3-,um reverse-phase column (Perkin-Elmer). Detection of amplified DNAs. PCR-amplified DNAs were detected by using gel electrophoresis and radiolabeled gene probes. An aliquot (1/10 volume) of the PCR-amplified samples was separated by 10% vertical polyacrylamide gel electrophoresis, using TBE buffer (0.089 M Tris-borate, 0.089 M boric acid, and 0.002 M Na2EDTA [pH 8.0]), or by 4% NuSieve (1:3; 1 part of NuSieve and 3 parts of SeaKem LE) agarose gel (catalog no. 50092, FMC), using TAE buffer (0.04 M Tris-acetate and 0.001 M Na2EDTA [pH 8.0]) (3), at 5.7 to 9.0 V/cm for 2 to 3 h. The gels were stained in 2 x 10-'% ethidium bromide solution for 5 to 10 min and visualized with a Photo/Prepl UV transilluminator (Fotodyne, Inc., New Berlin, Wis.). For Southern blot detection, the PCR-amplified DNAs, which were separated by either agarose gel or polyacrylamide gel electrophoresis described above) were denatured by 0.4 M NaOH treatment for 20 to 30 mmn and transferred to a Zetaprobe nylon membrane (Bio-Rad Laboratories, Richmond, Calif.) by electroblotting, using a Trans-Blot apparatus (Bio-Rad) as described by the manufacterer. The following gene probes were used for the detection of various PCR-amplified DNAs: for the 0.147-kb uidA amplified DNAs, a 50-mer oligonucleotide probe, UAP-1 (5'TGCCGGGATCCATCGCAGCGTAATGCTCTACACCAC GCCGAACACCTGGG-3'); for the 0.166-kb uidA amplified DNA, a 50-mer oligonucleotide probe, UAP-2 (5'AAAG GGATCTTCACTCGCGACCGCAAACCGAAGTCGGCG GCTTTTCTGCT-3'); and for the 0.153-kb uidR amplified DNA, a 40-mer URP-1 (5'CAACCCGTGAAATCAAAAAA CTCGACGGCCTGTGGGCATT-3') oligonucleotide probe. The oligonucleotide gene probes were radiolabeled at their 5' ends by a modified version of the forward reaction described by Ausubel et al. (3). The 30-1l reaction solution used in this procedure contained 50 mM Tris hydrochloride (pH 7.5), 10 mM MgCl2, 5 mM dithiothreitol (Sigma), 1 mM KCl, 5 pmol of oligonucleotide probe, 120 pmol of [y-32p] ATP (specific activity, >3,000 Ci/mmol; New England Nuclear Corp., Boston, Mass.), 1 mM spermidine (disodium salt), and 20 U of T4 polynucleotide kinase (US Biochemical Corp., Cleveland, Ohio). The reaction mixture was incubated at 37°C for 1 h, and radiolabeled probes were concen-
APPL. ENVIRON. MICROBIOL.
trated and purified by using an IsoGene DNA purification kit
(Perkin-Elmer Cetus, Emeryville, Calif.). Sensitivity of PCR detection. To determine the sensitivity of PCR-gene probe detection, genomic DNA from E. coli was serially diluted to establish a concentration range of 1 to 100 ng and PCR amplification was performed with UAL-1939
and UAR-2104 primers for the uidA gene and URL-301 and URR-453 primers for the uidR gene of E. coli. Following a total of 45 cycles of PCR amplification, 0.1 volume of each of the PCR-amplified samples was analyzed as follows. The amplified DNA was denatured by adding 0.1 volume of 3 M NaOH-0.1 M Na2EDTA, incubated at room temperature for 5 min, and neutralized with 1 volume of NH4OAc; the samples were then spotted on a Zetaprobe nylon membrane (Bio-rad) by using a Bio-Rad slot blot manifold at a vacuum pressure of 4 to 5 lb/in2. The hybridization was performed with radiolabeled UAP-1 and URP-1 oligonucleotide probes, respectively, as described previously. Similarly, 1 to 10 E. coli cells from 100-ml dechlorinated potable water samples were recovered by filtering through an ethanol-presoaked 13-mm Fluoropore membrane (FHLP; 0.5-pm pore size; Millipore Corp.), using a Swinnex filter holder and a filter manifold (Millipore). The filter was rolled and sterily transferred with forceps to a 0.6-ml GeneAmp reaction tube with cell-coated side facing inwards. One hundred microliters of 0.1% diethylpyrocarbonate (Sigma)treated autoclaved water was added to the tube, which was vortexed vigorously for 5 to 10 s to release the cells from the filter surface to the liquid phase. Five freeze-thaw cycles were performed, using an ethanol-dry ice bath and warm water (45 to 50°C), respectively. At every thaw cycle the sample was vortexed for 5 s to ensure the release of cells or DNA or both from the surface of the filter. The PCR reaction mix was added to the tube to a final volume of 150 Rl, and DNA was amplified without further purification. PCR amplifications were performed with primers for the uidR gene, URL-301 and URR-453. The amplified DNAs were detected by radiolabeled URP-1 oligonucleotide probe as described above. RESULTS AND DISCUSSION Specificity of E. coli PCR detection with uid. PCR amplification with primers UAL-754 and UAR-900 to amplify the amino coding region of uidA produced amplified DNA bands of 0.147 kb for all E. coli strains and all four strains of Shigella spp. (Fig. 1A). This primer set also produced positive amplified DNA bands of identical molecular weight for all four MUG-negative isolates of E. coli (Fig. 1B). Southern blot DNA-DNA hybridization with a 50-mer radiolabeled UAP-1 oligonucleotide probe showed strong hybridization signals. No amplification was observed for other bacterial strains tested in this study, suggesting that the target amino-terminal end of the uidA gene is unique and conserved in E. coli and Shigella spp. The set of primers, UAL-1939 and UAR-2104, located at the carboxyl coding region of the uidA gene produced amplified DNA bands of 0.166 kb for E. coli and all four strains of Shigella spp. (Fig. 2A). The MUG-negative isolates of E. coli also showed amplification of DNA of the same molecular weight (Fig. 2B). No amplification was observed when DNAs from other bacterial strains were used as targets for PCR. Southern blot DNA-DNA hybridizations with a 50-mer radiolabeled UAP-2 oligonucleotide probe showed strong hybridization signals of all amplified DNAs from E. coli strains, including MUG-negative strains, and
DETECTION OF E. COLI AND SHIGELLA SPP. IN WATER
VOL. 57, 1991
2
1
4
3
6
5
8
7
9
10
11
1015
12 1314
kb
-0.147-
A 5
4
4
3
2
kb
5
w__WW
0.147
B FIG. 1. Ethidium bromide stained 4% NuSieve-SeaKem (1:3) agarose gel (left) and Southern blot hybridization (right) analyses of the PCR-amplified DNA (A) from the uidA gene of E. coli, using UAL-754 and UAR-900 primers and radiolabeled UAP-1 oligonucleotide probe, and (B) of MUG-negative E. coli strains, using iuidA primers and probe. Lanes: 1, E. coli; 2, Shigella sonnei; 3, S. flexneri; 4, S. boydii; 5, S. dysenteriae; 6, 123-bp DNA ladder as size standard; 7, Salmonella typhimurium; 8, C. freundii; 9, Enterobacter aerogenes; 10, Enterobacter cloaceae; 11, Aeronomas hydrophila; 12, Klebsiella pneumoniae; 13, Streptococcus lactis; and 14, Pseudomonas alcaligenes. (B) Lanes: 1, E. coli 217; 2, E. coli 220; 3, E. coli 232; 4, E. coli 245; and 5, 123-bp DNA ladder as size standard.
Also, none of the three sets of uid primers showed amplification with nonspecific target DNA from human and several bacterial strains, unless DNA from E. coli was added to the mixture. Thus, nontarget DNA did not interfere with PCR amplification of different regions of uid even when a total of 120 times more nontarget than target DNA from human and various bacteria was present. Sensitivity of PCR detection, using uidA and uidR genes. For monitoring purposes, PCR-gene probe-based detection of indicator and pathogenic organisms requires not only specificity, but also sufficient sensitivity to ensure the safety of the potable water. U.S. federal regulations require the detection level to be one bacterial cell per 100 ml of drinking water (1, 12). PCR-amplified DNA from as little as 10 fg of genomic DNA of E. coli was consistently detected when primers and
Shigella spp. This result suggests that the carboxyl end of the uidA gene is also unique and conserved in E. coli and Shigella spp. In addition to the iuidA gene, the regulatory region of i,id, located upstream of the uidA gene, designated WidR, was also used as a target DNA for PCR amplification. Primers URL-301 and URR-453 were used for the amplification of DNA from E. coli strains, including MUG-negative isolates, and Shigella spp. In all cases, a 0.152-kb amplified DNA band was observed in an ethidium bromide-stained polyacrylamide gel (Fig. 3A and B). Southern blot DNA-DNA hybridization with a 40-mer radiolabeled URP-1 oligonucleotide probe showed strong hybridization signals for all amplified DNAs, suggesting that the target uidR gene is present in E. coli and Shigella spp. used in this study. No amplification was observed for other bacterial strains.
2
1
kb
3
4
7
6
8
9
10
41 Q
0.166
5
A 1
2
3
4 5
kb
1
2
3
4
5
0.166_-4
B FIG. 2. Ethidium bromide-stained 4% NuSieve-SeaKem (1:3) agarose gel (left) and Southern blot hybridization (right) analyses of the PCR-amplified DNA (A) from the uidA gene of E. coli, using UAL-1939 and UAR-2105 primers and radiolabeled UAP-2 oligonucleotide probe, and (B) of MUG-negative E. coli strains, uidA primers and probe. (A) Lanes: 1, E. coli; 2, Shigella sonnei; 3, S. flexneri; 4, 123-bp DNA ladder as size standard; 5, S. boydii; 6, S. dysenteriae; 7, Salmonella typhimurium; 8, C. freundii; 9, Enterobacter aerogenes; and 10, Aeronomas hydrophila. (B) Lanes: 1, E. coli 217; 2, E. coli 220; 3, E. coli 232; 4, E. coli 245; and 5, 123-bp DNA ladder as size standard.
1016
BEJ ET AL.
ti;f-laMg0 1
APPL. ENVIRON. MICROBIOL.
2
3
4
5
1
2
3
4
5
B
FIG. 3. Ethidium bromide-stained 10% polyacrylamide gel (left) and Southern blot hybridization (right) analyses of the PCR-amplified DNA (A) from the uidR gene of E. coli, using URL-301 and URR-453 primers and radiolabeled URP-1 oligonucleotide probe, and (B) of MUG-negative E. coli strains, using uidA primers and probe. (A) Lanes: 1, E. coli; 2, Shigella sonnei; 3, S. flexneri; 4, S. boydii; 5, S. dysenteriae; 6, Salmonella typhimurium; 7, C. freundii; 8, Enterobacter aerogenes; 9, E. cloaceae; 10, Aeronomas hydrophila; 11, K. pneumoniae; 12, Streptococcus lactis; 14, Pseudomonas alcaligenes; and 15, 123-bp DNA ladder as size standard. Lanes: 1, E. coli 217; 2, E. coli 220; 3, E. coli 232; 4, E. coli 245; and 5, 123-bp DNA ladder as size standard.
probe for the uidR gene were used (Fig. 4). This level of detection is equivalent to the detection of one to two bacterial cells (4, 5). Approximately 18% of the time we were able to detect 1-fg level of genomic DNA, which closely corresponds to the expected Poisson distribution of the target gene (5). This detection level is as sensitive as reported previously for PCR-gene probe detection (5). When URL-301 and URR-453 primers and radiolabeled URP-1 probe were used for the amplification and detection
_
W~f9
%-i
;.
4o DNA
FIG. 4. Slot blot analysis after PCR amplification of various amounts of genomic E. coli DNA, using primers URL-301 and URR-453 for uidR amplification. No added target DNA was used as a negative control. For hybridization, radiolabeled URP-1 oligonucleotide probe was used.
of the uidR gene of E. coli, we were able to detect one to two viable cells of E. coli (as determined from the plate counts) consistently with this set of primer and probe. No PCR amplification signal was observed when the sample was diluted below the level of detectable viable cells as determined by a plating procedure. In conclusion, bacteria associated with human fecal contamination of potable water can be detected by PCR amplification and gene probe detection of uidA and uidR genes.
Moreover, PCR showed positive amplifications of both uidA and uidR targets for MUG-negative E. coli isolated from both clinical and environmental samples, which failed to show positive reactions with a 3-glucuronidase enzymefluorogenic substrate-based commercially available Colilert test. Thus, the gene probe detection may overcome the potential problem of the Colilert system, i.e., the failure to detect MUG-negative stains, which Chang et al. (7) have reported may constitute 30% of the fecal coliform bacteria in some water sources. Multiplex PCR amplification of lacZ for total coliforms (5) and uidA or uidR for fecal coliforms and the development of a nonisotopic gene probe detection technique, such as immobilized capture probes (4), can permit a rapid and reliable means of assessing the bacteriological safety of water and should provide an effective alternative methodology to the conventional viable culture methods. ACKNOWLEDGMENTS This study was funded by Perkin-Elmer Cetus Corp. We thank W. Chang for MUG-negative E. coli strains, M. Boyce for technical assistance, and K. Zinn for preparation of the manu-
script. REFERENCES 1. American Public Health Association. 1985. Standard methods for the examination of water and wastewater, 16th ed. American Public Health Association, Washington, D.C.
VOL. 57, 1991
DETECTION OF E. COLI AND SHIGELLA SPP. IN WATER
2. Atlas, R. M., A. K. Bej, S. McCarty, J. DiCesare, and L. Haff. 1991. In J. R. Hall and G. D. Glysson (ed.), Monitoring water in the 1990's: meeting new challenges. ASTM STP 1102. In press. 3. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. A. Smith, J. G. Sideman, and K. Struhl (ed.). 1987. Current protocols in molecular biology. John Wiley & Sons, Inc., New York. 4. Bej, A. K., M. H. Mahbubani, R. Miller, J. L. DiCesare, L. Haff, and R. M. Atlas. 1990. Multiplex PCR amplification and immobilized capture probes for detection of bacterial pathogens and indicators in water. Mol. Cell. Probes 4:353-365. 5. Bej, A. K., R. J. Steffan, J. DiCesare, L. Haff, and R. M. Atlas. 1990. Detection of coliform bacteria in water by polymerase chain reaction and gene probes. Appl. Environ. Microbiol. 56:307-314. 6. Blanco, C., P. Ritzenthaler, and M. Mata-Gilsinger. 1985. Nucleotide sequence of a regulatory region of the uidA gene in Escherichia coli K12. Mol. Gen. Genet. 199:101-105. 7. Chang, G. W., J. Brill, and R. Lum. 1989. Proportion of 3-glucuronidase-negative Escherichia coli in human fecal samples. Appl. Environ. Microbiol. 55:335-339. 8. Edberg, S. C., M. J. Allen, D. B. Smith, and the National Collaborative Study. 1989. National field evaluation of a defined substrate method for the simultaneous detection of total coli-
9. 10.
11. 12.
13. 14.
1017
forms and Escherichia coli from drinking water: comparison with presence-absence techniques. Appl. Environ. Microbiol. 55:1003-1008. Edberg, S. C., and M. M. Edberg. 1988. A defined substrate technology for the enumeration of microbial indicators of environmental pollution. Yale J. Biol. Med. 61:389-399. Edberg, S. C., and C. M. Kontnick. 1986. Comparison of beta-glucuronidase-based substrate systems for identification of Escherichia coli. J. Clin. Microbiol. 24:368-371. Federal Register. 1990. Drinking water: national primary drinking water regulations; analytical techniques coliform bacteria proposed rule. 55:22752-22756. Geldreich, E. E. 1983. Bacterial populations and indicator concepts in feces, sewage, stormwater and solid wastes, p. 51-97. In G. Berg (ed.), Indicators of viruses in water and food. Ann Arbor Science Publishers, Inc., Orlando, Fla. Jefferson, R. A., S. M. Burgess, and D. Hirsh. 1986. ,-Glucuronidase from Escherichia coli as a gene fusion marker. Proc. Natl. Acad. Sci. USA 83:8447-8451. Rychlik, W., and R. E. Rhods. 1989. A computer program for choosing optimal oligonucleotides for filter hybridization, sequencing and in vitro amplification of DNA. Nucleic Acids Res. 17:8543-8551.
