Journal of Virological Methods, 36 (1992) 239-248 0 1992 Elsevier Science Publishers B.V. / All rights reserved / 0164-0934~92~$05.00
239
VIRMET 01290
Detection of feline immunodeficiency virus by a nested ~o~ymcrase chain reaction Espen Rimstad’
and Kjetil Ueland”
’ ~e~~rttnent qf ~~crob~o~og~ and r~rn~~o~(~g~, Nor~eg~on College of’ Veterinary Medicine, Oslo, Nor~~la~atld ~Nat~onal Vrferinary Institute, Oslo, Norwuy (accepted 4 October 1991)
Summary A specitic and sensitive polymerase chain reaction (PCR) procedure for the detection of feline immunode~ciency virus (FIV) in peripheral blood mononuclear cells (PBMC) was developed. PBMC from both blood samples and cultures were digested by proteinase K in a lysis buffer, and after heat inactivation of the proteinase, the resultant material was used in a two step ampli~cation protocol using nested sets of primers. Two independent amplifications, from the gug and pal genes respectively, were performed in each tube. The PCR was positive for six of 14 samples from FIV seropositive adult cats, while all 36 samples from seronegative cats were negative. In comparison with an antigen-capturing ELISA procedure, the PCR detected FIV infection in PBMC cultures on average two days earlier. Feline irnrnunode~~i~n~y virus; Polymerase chain reaction; Viral diagnosis
introduction Feline immunodeticiency virus (FIV) is a retrovirus within the subfamily Lentivirinae which may cause an immune deficiency syndrome in cats (Pedersen et al., 1987). The detection of FIV infection has mostly been carried out by use of an antibody-capturing enzyme-linked immunosorbent assay (ELISA) (O’Connor et al., 1989). After FIV infection, virus will persist in the cat, and therefore the presence of antibodies also implies that the animal is a virus -Currespmdence to: Norway.
Kjetil Ueiand. National Veterinary institute. P.O. Box 8156. Dep., N-0033 Oslo,
240
carrier (Yamamoto et al., 1989). However, FIV has also been isolated from seronegative cats (Harbour et al.. 1988; Hopper et al., 1989; Ueland and Nesse, 1991). Virus can be isolated by cultivation of feline peripheral blood mononuclear cells (PBMC), because the virus preferentially replicates in T-lymphoblastoid cells (Pedersen, 1990). FIV infection in the cultures has been detected either by testing for reverse transcriptase activity (Pedersen et al., 1987), or by screening for viral core antigen ~24. with an antigen-capturing ELISA (FIV Ag-ELISA) (Tilton et al., 1990). The detection of specific nucleic acids by polymerase chain reaction (PCR) is a method that can be used to identify integrated lentiviral DNA (Stoeckl et al., 1989; Albert and Fenyii, 1990). The PCR technique is known to be extremely sensitive, and the method theoretically allows the detection of a single DNA molecule in a background of IO5 cells (Saiki et al., 1988). If the amplification is first performed using an outer pair of primers followed by second amplification using a pair of inner nested primers, the specificity and the sensitivity of the test are both increased (Kemp et al., 1989). PCR has been used in the detection of FIV DNA by Torton et al. (1990). This test was performed as a single PCR followed by hybridization with a radioactively labelled probe to verify the sequence of amplified DNA. In the present study a nested PCR procedure for the detection of integrated FIV was developed. By using nested sets of primers, the amplified products could easily be-visualized by electrophoresis.
Materials and Methods Animals Sera and PBMC were obtained from cats that belonged to a breeding colony consisting of 25 adult cats. Six cats were shown to be infected with FIV both by antibody-capturing ELISA and virus isolation (Ueland and Nesse, 1991). In addition, blood samples from one FIV seropositive cat with no connection to the cattery were included. All cats were clinically healthy at the time of sampling. Cultivation of PBMC Heparinized blood was collected by jugular phlebectomy from the cats. Three ml of blood were diluted 1: 1 with phosphate buffered saline solution (PBS, pH 7.2) and carefully laid over 3 ml of Lymphoprep@ (Nycomed, Norway). The lymphocyte rich fraction was carefully collected from the interface after centrifugation at 800 x g for 15 min. The cells were washed three times in PBS. A portion of the cells was taken out for PCR preparation, while 5 x lo5 cells were resuspended in culture medium and cultivated as
241
previously described (Yamamoto et al., 1988), except that the source of interleukin 2 (IL2) was supernatant of the myeloma cell line X63Ag8-653 transfected with the mouse IL2 gene (Karasuyama and Melchers, 1988) in a dilution of 1: 100. The PBMC cultures were tested for production of FIV core antigen p24 using a commercial available feline immunodeliciency virus antigen test kit (FIV Ag-ELISA, IDEXX, Maine). Preparation
of’ samples for PCR
Feline PBMC collected from the gradient ~entrifugation of blood, and samples from the cultivated cells were both washed three times in PBS and counted. The cells were diluted in a lysis buffer (10 mM Tris hydrochloride (pH 8.3), 1 mM EDTA, 0.5% Triton-X-100,0.001% sodium dodecyl sulfate, 300 ,ug proteinase K per ml) to a concentration of 2 x lo5 per 10 ~1. The proteinase was inactivated by heating at 95°C for 15 min, the samples then being stored at -20°C until they were analyzed. Fourteen blood samples from FIV seropositive and 36 from FIV seronegative cats were tested by the described PCR. Furthermore, 27 samples from cultures of PBMC which had been maintained for 21 days were tested, of which 13 samples originated from FIV seropositive and 14 from FIV seronegative cats. Primers used in PCR
Eight 22-24-mer DNA oligonucleotide primers (Table 1) were used in a nested fashion. Primers 1 + 4 (Pl, P4) and 5 + 8 (P5, P8) were used as outer pairs, whereas primers 2 + 3 (P2, P3) and 6 + 7 (P6, P7), respectively, were used as inner pairs. The amplifications with pairs 2 + 3 and 6 + 7 gave DNA segments of 203 basepairs (bp) and 183 bp from the gag and pol genes, respectively. The nucleotide sequence and genomic organization of FIV have been described by several authors (Olmsted et al., 1989; Talbott et al., 1989).
TABLE 1 Sequencesand location of the primers Primer
Sequence(S-3’)”
Gene and location”
PI P2 P3 P4
ATATGACGGTGTCTACTCCTGCTG AAGGCAAGAGAAGGACTAGGAG TAGGGTAATGGTCTGGGAGCAT CTCTACACTGCATCCTAGCTGGTG
gag (916-939) gag (I 108--l129) gag (1310-1289) gag (1398.-1375)
P5 P6
GATACAGGAAAGTGGCGAGTGATG ATGATGGAGGGAATCTGGCAAG CATATCCTGCATCTTCTGACCTT CCAATCCTTTACTCCCTATCGAGC
pol(3716---3739) pal (3869-3890) poi (40524030) pal (41874164)
p’s’
‘Based on Talbott et al. (1989).
242
The PCR procedure was carried out in two steps. First, a lOO-~1 reaction consisting of 10 mM Tris-HCI, pH 8.3; 50 mM KCl; 7.0 mM MgC12; 0.01% gelatine (w/v) with 70 PM of each dNTP; 0.1 PM of the four outer primers, and 1.25 U of thermostable DNA polymerase (Amplitaq, Perkin-Elmer Cetus, CT), were used with 10 ~1 of the cell lysate, corresponding to 2 x lo5 cells, as template. Five ~1 from the first PCR were used as template in the second PCR, now in a 50 ~1 reaction using 1.5 mM MgC!z, and the four inner primers. All reaction samples were overlaid with mineral oil. The amplifications were performed in a DNA Thermal Cycler (Perkin-Elmer Cetus) by first heating to 94°C for 3 min for denaturation of DNA, and then 25 cycles of 95°C for 45 set, at 50°C for 1 min, and at 72°C for 2 min. The second PCR was cycled 25 times at 94°C for 1 min, at 55°C for 1 min, and at 72°C for 1.5 min. Primers for both thegag and pal genes were run in the same tube in both the first and the second PCR. Electrophoresis Ten 1.11 of the PCR products were analyzed by electrophoresis in a horizontal, submarine 2% agarose gel in TBE buffer (0.089 M Tris-borate, 0.089 M boric acid, 0.002 M EDTA, pH 8.0), applying 7.1 V/cm for 1 hour, and thereafter stained with ethidium bromide (Maniatis et al., 1989).
The specificity of the amplified segments after the second PCR was initially controlled by digestion with the restriction endonuclease HindHI, which has a cleaving site between P2 and P3, and a site between P6 and P7 (Olmsted et al., 1989; Talbott et al., 1989). Analysis of PCR sensitivity In two cultures of PBMC shown to be positive by the FIV Ag-ELISA, the cells were counted and diluted in ten-fold steps in PCR lysis buffer. The sensitivity of the PCR was evaluated by estimating the number of cells needed to detect proviral DNA. The viability of these cells were estimated by staining with 2% Trypan blue. Comparison between FIV Ag-ELBA
and PCR
PBMC from six FIV seropositive cats were cultivated and tested for the production of FIV core antigen ~24, three times a week with FIV Ag-ELISA. Parallel samples from the cell cultures were analyzed by PCR. Furthermore PBMC from 27 blood samples were cultivated for three weeks and subsequently analyzed both by PCR and FIV Ag-ELISA.
243
Results PCR No interferences were observed between the different primer pairs. Electrophoresis after the first PCR gave some visible bands on the gel. The interpretation of the results at this stage was, however, difficult. After the second PCR of cell lysates from PBMC cultures from seropositive cats, two distinct bands could be observed on agarose gels. These bands corresponded to
Fig. 1. Electrophoresis of PCR products using two different nested sets of primers in the same test tube. PCR with nested primer pairs Pl through P4 and P5 through PS (25 cycles plus 25 cycles). Expected size of products being 183 bp and 203 bp. Electrophoresis in a horizontal submarine 2% agarose gel applying 7,l V/cm for 1 h, stained with ethidium bromide. Lanes l-3: Samples from cultivated feline PBMC. Lanes 1 and 3 are positive. Lane 2 is negative. Lane 4: DNA marker, numbers on lower right denote number of basepairs.
244
the amplified segments generated by the primer pairs P2 + P3 and P6 + P7, respectively (Fig. 1). The specificity of the amplification was confirmed by cleaving the products with HindIII. This created DNA segments of the expected lengths (approximately 139 bp and 64 bp for the gag segment, and 111 bp and 72 bp for the pol segment) (data not shown). A sample was regarded as positive when one of the two possible bands could be detected visually (Fig. 2). Our results indicated that the use of lower concentrations of primers (0.1 ,uM) and nucleotides (70 PM each) than those recommended by the manufacturers (1 .O ,uM and 200 PM, respectively) gave more specific results, and did not impose any significant decrease in the amplified DNA segments. It has been reported that the optimal range for MgCl* concentration is broader when nucleotide concentrations are low (Albert and Fenyii, 1990) the problem of finding the most suitable MgC& concentration thus being diminished. A relatively high MgC12 concentration (7.0 mM) was found to be optimal in the first PCR, probably because EDTA was a part of the lysis buffer. The PCR detected proviral FIV in 42.9% of blood samples from seropositive cats, while all samples from seronegative cats were negative. In PBMC cultures from seropositive cats, 92.3% were positive for FIV infection by PCR (Table 2). One culture from a seropositive cat was found to be negative by PCR.
Fig. 2. Differences in the PCR results. PCR and electrophoresis as described in Fig. I. Lanes l-6: Samples from PBMC cultures originating from seropositive cats. Lane 7: Negative control. Lanes 8 and 9: Positive controls of both the first and the second round of PCR (500 basepair segment of lambda DNA). Lane IO: DNA marker. Lane 2 and 6: Only one of the bands are visible. this being regarded as a positive result.
245 TABLE 2 Detection of FIV by PCR in feline PBMC from blood and culture samples No. (SC) of positive
Type of sample
No. tested
Blood samples from FIV seropositive cat?
14
6
(42.9)
Blood from FIV seronegative cats
36
0
(0)
PBMC culturesh from FIV seropositive cats
13
12’
PBMC culturesb from FIV seronegative cats
14
0
(92.3)
(0)
‘Originated from seven seropositive cats, blood was collected twice four weeks apart bThe PBMC cultures had been maintained for three weeks. ‘One culture was negative also in FIV Ag-ELISA test.
However, this culture was also found to be negative by FIV Ag-ELISA. The sensitivity of the PCR, was found to be between one and ten cells from an Ag-ELISA positive culture. The viability of the cells in the two cultures from which these dilutions originated from was estimated to be 7 and 44%, respectively. Comparison between PCR and FIV Ag-ELBA Full agreement was found between the results from Ag-ELISA and PCR for 27 cultivated PBMC samples, 12 were positive and 15 were negative. In cultures of PBMC from seropositive cats, FIV infection was detected four days earlier by the PCR procedure than by FIV Ag-ELISA in two cell cultures, two days earlier in two cultures, and in the fifth cell culture the infection was detected on the same day (Table 3). TABLE 3 Detection of FIV in PBMC cultures from seropositive Cat no.
Days of cultivation
cats by PCR and FIV Ag-ELISA
of PBMC
3
6
8
IO
13
15
9
-/-
-/-
-/-
+I-
f
18 29 53 59 75
-/-l-
-l-/-
-/ti-
+ + -t +
-t -
-
17
20
22
24
45
+I-
nd/ + -_/nd/+
-I-*
t- 1 + +/+
+/+
+I+
-/_::I -/-i-
-/-
+1-l+/-
_/_ +I-
in each case the PCR result is given in front of the slash, and the FIV antigen ELISA result after the slash. - = negative, + = positive, nd = not done. *FIV had been isolated from cat no. 59 in an earlier attempt.
246
Discussion In the present work, a specific and sensitive PCR assay to detect FIV in feline PBMC, from both blood samples and cultures, is described. The use of nested sets of primers in the PCR procedure in order to increase the specificity has been described by several authors (Kemp et al., 1989; Albert and Fenyii, 1990; Rimstad et al., 1990). The inner pairs of primers will anneal to the template if the outer pairs have amplified the correct sequence. The use, in the present study, of several primer pairs increased the specificity of the test. The use of nested primers made the interpretation considerably easier, as the bands were distinct, this in turn making the test as such more specific. The identity of the bands produced in the PCR was further documented by the Hind111 cleaving the ampli~ed segments in the predicted positions. Hybridization with a radioactively labelled internal probe to verify the results was therefore unnecessary. All positive and negative PCR results from PBMC cultures were in accordance with results from FIV Ag-ELISA, adding further evidence in support of high specificity. The fact that both PCR and Ag-ELISA detected FTV in PBMC cultures after lo-24 days, probably reflects the time needed for the virus to start propagating in the cell cultures. Two independent PCRs were performed per tube. Theoretically, this procedure will increase the possibilities for interaction between the different primers, and raises the likelihood of primer-dimer artifacts. In our material, no such artifacts or any other negative effects of two PCRs per tube were observed, and the diagnostic value w-as increased by amplifying DNA from two genes. Dilution of FIV infected cell cultures and the subsequent PCR, showed that proviral FIV could be detected when the cells present numbered less than ten, but more than one. The proportion of infected cells was, however, not determined, nor was the number of proviral FIV copies per cell known. The sensitivity of the PCR should be further documented. In HIV infection in man, it has been documented that most, if not all, infected circulating mononuclear cells contain only one viral copy (Simmonds et al., 1990). However, the number of FIV provirus copies may be higher than one in cultivated mononuclear cells. Moreover, the viability of the cells in the present experiment was low, possibly indicating viral induced cytopathic effects, and hence the possible presence of more viral DNA intermediates. A positive PCR result for less than ten cells may therefore not necessarily reflect the actual number of cells infected. It has been demonstrated, however, that double PCRs are sufficiently sensitive to detect a single copy of integrated HIV provirus (Albert and Fenyo, 1990; Simmonds et al., 1990). From HIV infection in man, it is known that asymptomatic carriers may have an infection rate of one cell per lo4 to lo5 PBMC, or even less than one cell per lo6 PBMC (Harper et al., 1986; Ulrich et al., 1988). None of the cats used in our tests showed any clinical signs of disease when blood samples were taken. The fact that the PCR did not detect FIV DNA in all samples from seropositive cats. may indicate that the rate of infected PBMCs in the cats was very low.
241
The antibody-capturing ELISA test that is regularly used to diagnose FIV infection, may have a low rate of false positive results (Hosie and Jarrett, 1990). This may be especially true in thoroughly vaccinated animals possessing antibodies against common cat cell antigens which can interfere in this test. Western blot may be an alternative in such cases, but is, however, not as sensitive as ELISA (Pedersen, 1990). Cross reactions against non-viral proteins in the same weight range as the specific viral proteins may confound interpretation. The fact that FTV has been isolated from seronegative cats (Harbour et al., 1988; Yamamoto et al., 1988; Hopper et al., 1989; Ueland and Nesse, 1991) further emphasizes the need to cultivate PBMC or to perform PCR to demonstrate FIV in certain cases. Our results showed that the PCR procedure enabled FIV in cell cultures of PBMCs from cats to be detected on average two days earlier than with FIV AgELISA, which is again eight times more sensitive than the assay for viral reverse transcriptase activity (Tilton et al., 1990). We conclude that PCR could be a useful additional method to detect FIV in PBMC cultures.
Acknowledgements The authors are grateful to Dr. B. Bogen and Dr. G. Lauritzen, Institute of General and Rheumatological Immunology, Oslo, Norway, for providing recombinant mouse IL2 from the transfected myeloma cell line X63Ag8-653. References Albert, J. and Fenyo. E.M. (1990) Simple, sensitive and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J. Clin. Microbial. 28, 1560&1564. Harbour, D.A., Williams, P.D., Gruffuydd-Jones, T.J., Burbridge, J. and Pearson, G.R. (1988) Isolation of a T-lymphotropic lentivirus from a persistently leucopenic domestic cat. Vet. Rec. 122, 8486. Harper, M.E., Marselle, L.M., Gallo, R.C. and Wong-Staal, F. (1986) Detection of lymphocytes expressing human T-lymphotropic virus type III in lymph nodes and peripheral blood from infected individuals by in situ hybridization. Proc. Natl. Acad. Sci. USA 83, 7722776. Hopper, C., Sparkes, A., Gruffuydd-Jones, T.J., Crispin, S.M., Harbour, D.A. and Stokes. C.R. (1989) Clinical and laboratory findings in cats infected with feline immunodeficiency virus. Vet. Rec. 125, 341-346. Hosie, M.J. and Jarrett, 0. (1990) Serological responses of cats to feline immunodeficiency virus. AIDS 4, 215-220. Karasuyama, H. and Melchers, F. (1988) Establishment of mouse cell lines which constitutively secrete large quantities of interleukin 2,3,4 or 5, using modified cDNA expression vectors. Eur. J. Immunol. 18, 97-104. Kemp, D.J., Smith, D.B., Foote, S.J., Samaras, N. and Peterson, M.G. (1989) Calorimetric detection of specific DNA segments amplified by polymerase chain reactions. Proc. Natl. Acad. Sci. USA 86, 2423-2427. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1989) Molecular cloning. A laboratory manual. Cold Spring Harbour Laboratory, New York.
248 O’Connor, T.P.. Jr., Tanguay. S., Steinman, R., Smith, R., Barr, M.C., Yamamoto, J.K., Pedersen. N.C., Andersen, P.R. and Tonelli, Q.J. (1989) Development and evaluation of immunoassay for detection of antibodies to the feline T-lymphotropic lentivirus (Feline immunodeliciency virus). J. Clin. Microbial. 27. 474479. Olmsted. R.A., Hirsch. V.M., Purcell, R.H. and Johnson, P.R. (1989) Nucleotide sequence analysis of feline immunodeliciency virus: genome organization and relationship to other lentiviruses. Proc. Natl. Acad. Sci. USA 86, 8088-8092. Pedersen, N.C., Ho, E.W., Brown, M.L. and Yamamoto, J.K. (1987) Isolation of a T-lymphotropic virus from domestic cats with an immunodeficiency-like syndrome. Science 235, 790 -793. Pedersen. N.C. (1990) Feline immunodeliciency virus. In: H. Schellekens and M.C. Horzinek (Eds). Animal Models in AIDS. Elsevier, Amsterdam, pp. 1655183. Rimstad E., Homes, E., Olsvik, 0. and Hyllseth, B. (1990) Identification of a double stranded RNA virus by using polymerase chain reaction and magnetic separation of the synthesized DNA segments. J. Clin. Microbial. 28. 2275-2278. Saiki. R.K.. Gelfand, D.H., Stoffel, S.. Scharf, S.J., Higuchi, R., Horn. T.B.. Mullis, K.B. and Erlich, H.A. (1988) Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487491. Simmonds, P., Balfe. P.. Peutherer, J.F., Ludlam, CA., Bishop, J.O. and Leigh Brown, A.J. (1990) Human immunodeficiency virus-infected individuals contain provirus in small numbers of peripheral mononuclear cells and at low copy numbers. J. Virol. 64. 864872. Stoeckl. E., Barrett, N., Heinz. F.X., Banekovich, M.. Stingl, G.. Guggenberger. K.. Dorner. F. and Kunz. C. (1989) Efficiency of the polymerase chain reaction for the detection of human immunodeficiency virus type I (HIV-I) DNA in the lymphocytes of infected persons. J. Med. Viral. 29. 2499255. Talbott. R.T., Sparger, E.E.. Lovelace. K.M.. Fitch. W.M.. Pedersen, N.C.. Luciw. P.A. and Elder, J.H. (1989) Nucleotide sequence and genomic organization of feline immunodeliciency virus. Proc. Natl. Acad. Sci. USA 86. 574335747. Tilton. G.K.. O’Connor, T.P., Jr., Seymour, CL.. Lawrence, K.L.. Cohen, N.D., Andersen, P.R. and Tonelli. Q.J. (1990) Immunoassay for detection of feline immunodeficiency virus core antigen. J. Clin. Microbial. 28. 898904. Torton. M.. Rideout, B.A., Luciw. P.A.. Sparger, E.E. and Pedersen, N.C. (1990) Co-infection of cats with feline immunodeticiency virus (FIV) and feline leukemia virus (FeLV) enhances the severity of FIV infection and affects distribution of FIV DNA in various tissues. In: H. Schellekens and M.C. Horzinek (Eds), Animal Models in AIDS. Elsevier, Amsterdam, pp. 2099 219. Ueland, K. and Nesse, L.L. (1991) No evidence of vertical transmission of naturally acquired feline immunodeficiency virus infection. Vet. Immunol. Immunopathol. in press. Ulrich, P.P., Busch, M.P.. El-Beik. T., Shiota, J., Vennari. J.. Shriver, K. and Vyas. G.N. (1988) Assessment of human immunodeliciency virus expression in co-cultures of peripheral blood mononuclear cells from healthy seropositive subjects. J. Med. Viral. 25, I-IO. Yamamoto, J.K.. Sparger E., Ho, E.W.. Andersen, P.R., O’Connor. P.. Mandell, C.P.. Lowenstine, L., Munn, R. and Pedersen, N.C. (1988) The pathogenesis of experimentally induced feline immunodeficiency virus (FIV) infections in cats. Am. J. Vet. Res. 49, 12461248. Yamamoto, J.K., Hansen, H.. Ho, E.W.. Morishita. T.Y., Okuda. T.. Sawa, T.R., Nakamura. R.M.. Kau. W.P. and Pedersen. N.C. (1989) Epidemiological and clinical aspects of feline immunodeficiency virus infection in cats from the continental United States and Canada. and possible mode of transmission. J. Am. Vet. Med. Ass. 194, 213-220.
239
VIRMET 01290
Detection of feline immunodeficiency virus by a nested ~o~ymcrase chain reaction Espen Rimstad’
and Kjetil Ueland”
’ ~e~~rttnent qf ~~crob~o~og~ and r~rn~~o~(~g~, Nor~eg~on College of’ Veterinary Medicine, Oslo, Nor~~la~atld ~Nat~onal Vrferinary Institute, Oslo, Norwuy (accepted 4 October 1991)
Summary A specitic and sensitive polymerase chain reaction (PCR) procedure for the detection of feline immunode~ciency virus (FIV) in peripheral blood mononuclear cells (PBMC) was developed. PBMC from both blood samples and cultures were digested by proteinase K in a lysis buffer, and after heat inactivation of the proteinase, the resultant material was used in a two step ampli~cation protocol using nested sets of primers. Two independent amplifications, from the gug and pal genes respectively, were performed in each tube. The PCR was positive for six of 14 samples from FIV seropositive adult cats, while all 36 samples from seronegative cats were negative. In comparison with an antigen-capturing ELISA procedure, the PCR detected FIV infection in PBMC cultures on average two days earlier. Feline irnrnunode~~i~n~y virus; Polymerase chain reaction; Viral diagnosis
introduction Feline immunodeticiency virus (FIV) is a retrovirus within the subfamily Lentivirinae which may cause an immune deficiency syndrome in cats (Pedersen et al., 1987). The detection of FIV infection has mostly been carried out by use of an antibody-capturing enzyme-linked immunosorbent assay (ELISA) (O’Connor et al., 1989). After FIV infection, virus will persist in the cat, and therefore the presence of antibodies also implies that the animal is a virus -Currespmdence to: Norway.
Kjetil Ueiand. National Veterinary institute. P.O. Box 8156. Dep., N-0033 Oslo,
240
carrier (Yamamoto et al., 1989). However, FIV has also been isolated from seronegative cats (Harbour et al.. 1988; Hopper et al., 1989; Ueland and Nesse, 1991). Virus can be isolated by cultivation of feline peripheral blood mononuclear cells (PBMC), because the virus preferentially replicates in T-lymphoblastoid cells (Pedersen, 1990). FIV infection in the cultures has been detected either by testing for reverse transcriptase activity (Pedersen et al., 1987), or by screening for viral core antigen ~24. with an antigen-capturing ELISA (FIV Ag-ELISA) (Tilton et al., 1990). The detection of specific nucleic acids by polymerase chain reaction (PCR) is a method that can be used to identify integrated lentiviral DNA (Stoeckl et al., 1989; Albert and Fenyii, 1990). The PCR technique is known to be extremely sensitive, and the method theoretically allows the detection of a single DNA molecule in a background of IO5 cells (Saiki et al., 1988). If the amplification is first performed using an outer pair of primers followed by second amplification using a pair of inner nested primers, the specificity and the sensitivity of the test are both increased (Kemp et al., 1989). PCR has been used in the detection of FIV DNA by Torton et al. (1990). This test was performed as a single PCR followed by hybridization with a radioactively labelled probe to verify the sequence of amplified DNA. In the present study a nested PCR procedure for the detection of integrated FIV was developed. By using nested sets of primers, the amplified products could easily be-visualized by electrophoresis.
Materials and Methods Animals Sera and PBMC were obtained from cats that belonged to a breeding colony consisting of 25 adult cats. Six cats were shown to be infected with FIV both by antibody-capturing ELISA and virus isolation (Ueland and Nesse, 1991). In addition, blood samples from one FIV seropositive cat with no connection to the cattery were included. All cats were clinically healthy at the time of sampling. Cultivation of PBMC Heparinized blood was collected by jugular phlebectomy from the cats. Three ml of blood were diluted 1: 1 with phosphate buffered saline solution (PBS, pH 7.2) and carefully laid over 3 ml of Lymphoprep@ (Nycomed, Norway). The lymphocyte rich fraction was carefully collected from the interface after centrifugation at 800 x g for 15 min. The cells were washed three times in PBS. A portion of the cells was taken out for PCR preparation, while 5 x lo5 cells were resuspended in culture medium and cultivated as
241
previously described (Yamamoto et al., 1988), except that the source of interleukin 2 (IL2) was supernatant of the myeloma cell line X63Ag8-653 transfected with the mouse IL2 gene (Karasuyama and Melchers, 1988) in a dilution of 1: 100. The PBMC cultures were tested for production of FIV core antigen p24 using a commercial available feline immunodeliciency virus antigen test kit (FIV Ag-ELISA, IDEXX, Maine). Preparation
of’ samples for PCR
Feline PBMC collected from the gradient ~entrifugation of blood, and samples from the cultivated cells were both washed three times in PBS and counted. The cells were diluted in a lysis buffer (10 mM Tris hydrochloride (pH 8.3), 1 mM EDTA, 0.5% Triton-X-100,0.001% sodium dodecyl sulfate, 300 ,ug proteinase K per ml) to a concentration of 2 x lo5 per 10 ~1. The proteinase was inactivated by heating at 95°C for 15 min, the samples then being stored at -20°C until they were analyzed. Fourteen blood samples from FIV seropositive and 36 from FIV seronegative cats were tested by the described PCR. Furthermore, 27 samples from cultures of PBMC which had been maintained for 21 days were tested, of which 13 samples originated from FIV seropositive and 14 from FIV seronegative cats. Primers used in PCR
Eight 22-24-mer DNA oligonucleotide primers (Table 1) were used in a nested fashion. Primers 1 + 4 (Pl, P4) and 5 + 8 (P5, P8) were used as outer pairs, whereas primers 2 + 3 (P2, P3) and 6 + 7 (P6, P7), respectively, were used as inner pairs. The amplifications with pairs 2 + 3 and 6 + 7 gave DNA segments of 203 basepairs (bp) and 183 bp from the gag and pol genes, respectively. The nucleotide sequence and genomic organization of FIV have been described by several authors (Olmsted et al., 1989; Talbott et al., 1989).
TABLE 1 Sequencesand location of the primers Primer
Sequence(S-3’)”
Gene and location”
PI P2 P3 P4
ATATGACGGTGTCTACTCCTGCTG AAGGCAAGAGAAGGACTAGGAG TAGGGTAATGGTCTGGGAGCAT CTCTACACTGCATCCTAGCTGGTG
gag (916-939) gag (I 108--l129) gag (1310-1289) gag (1398.-1375)
P5 P6
GATACAGGAAAGTGGCGAGTGATG ATGATGGAGGGAATCTGGCAAG CATATCCTGCATCTTCTGACCTT CCAATCCTTTACTCCCTATCGAGC
pol(3716---3739) pal (3869-3890) poi (40524030) pal (41874164)
p’s’
‘Based on Talbott et al. (1989).
242
The PCR procedure was carried out in two steps. First, a lOO-~1 reaction consisting of 10 mM Tris-HCI, pH 8.3; 50 mM KCl; 7.0 mM MgC12; 0.01% gelatine (w/v) with 70 PM of each dNTP; 0.1 PM of the four outer primers, and 1.25 U of thermostable DNA polymerase (Amplitaq, Perkin-Elmer Cetus, CT), were used with 10 ~1 of the cell lysate, corresponding to 2 x lo5 cells, as template. Five ~1 from the first PCR were used as template in the second PCR, now in a 50 ~1 reaction using 1.5 mM MgC!z, and the four inner primers. All reaction samples were overlaid with mineral oil. The amplifications were performed in a DNA Thermal Cycler (Perkin-Elmer Cetus) by first heating to 94°C for 3 min for denaturation of DNA, and then 25 cycles of 95°C for 45 set, at 50°C for 1 min, and at 72°C for 2 min. The second PCR was cycled 25 times at 94°C for 1 min, at 55°C for 1 min, and at 72°C for 1.5 min. Primers for both thegag and pal genes were run in the same tube in both the first and the second PCR. Electrophoresis Ten 1.11 of the PCR products were analyzed by electrophoresis in a horizontal, submarine 2% agarose gel in TBE buffer (0.089 M Tris-borate, 0.089 M boric acid, 0.002 M EDTA, pH 8.0), applying 7.1 V/cm for 1 hour, and thereafter stained with ethidium bromide (Maniatis et al., 1989).
The specificity of the amplified segments after the second PCR was initially controlled by digestion with the restriction endonuclease HindHI, which has a cleaving site between P2 and P3, and a site between P6 and P7 (Olmsted et al., 1989; Talbott et al., 1989). Analysis of PCR sensitivity In two cultures of PBMC shown to be positive by the FIV Ag-ELISA, the cells were counted and diluted in ten-fold steps in PCR lysis buffer. The sensitivity of the PCR was evaluated by estimating the number of cells needed to detect proviral DNA. The viability of these cells were estimated by staining with 2% Trypan blue. Comparison between FIV Ag-ELBA
and PCR
PBMC from six FIV seropositive cats were cultivated and tested for the production of FIV core antigen ~24, three times a week with FIV Ag-ELISA. Parallel samples from the cell cultures were analyzed by PCR. Furthermore PBMC from 27 blood samples were cultivated for three weeks and subsequently analyzed both by PCR and FIV Ag-ELISA.
243
Results PCR No interferences were observed between the different primer pairs. Electrophoresis after the first PCR gave some visible bands on the gel. The interpretation of the results at this stage was, however, difficult. After the second PCR of cell lysates from PBMC cultures from seropositive cats, two distinct bands could be observed on agarose gels. These bands corresponded to
Fig. 1. Electrophoresis of PCR products using two different nested sets of primers in the same test tube. PCR with nested primer pairs Pl through P4 and P5 through PS (25 cycles plus 25 cycles). Expected size of products being 183 bp and 203 bp. Electrophoresis in a horizontal submarine 2% agarose gel applying 7,l V/cm for 1 h, stained with ethidium bromide. Lanes l-3: Samples from cultivated feline PBMC. Lanes 1 and 3 are positive. Lane 2 is negative. Lane 4: DNA marker, numbers on lower right denote number of basepairs.
244
the amplified segments generated by the primer pairs P2 + P3 and P6 + P7, respectively (Fig. 1). The specificity of the amplification was confirmed by cleaving the products with HindIII. This created DNA segments of the expected lengths (approximately 139 bp and 64 bp for the gag segment, and 111 bp and 72 bp for the pol segment) (data not shown). A sample was regarded as positive when one of the two possible bands could be detected visually (Fig. 2). Our results indicated that the use of lower concentrations of primers (0.1 ,uM) and nucleotides (70 PM each) than those recommended by the manufacturers (1 .O ,uM and 200 PM, respectively) gave more specific results, and did not impose any significant decrease in the amplified DNA segments. It has been reported that the optimal range for MgCl* concentration is broader when nucleotide concentrations are low (Albert and Fenyii, 1990) the problem of finding the most suitable MgC& concentration thus being diminished. A relatively high MgC12 concentration (7.0 mM) was found to be optimal in the first PCR, probably because EDTA was a part of the lysis buffer. The PCR detected proviral FIV in 42.9% of blood samples from seropositive cats, while all samples from seronegative cats were negative. In PBMC cultures from seropositive cats, 92.3% were positive for FIV infection by PCR (Table 2). One culture from a seropositive cat was found to be negative by PCR.
Fig. 2. Differences in the PCR results. PCR and electrophoresis as described in Fig. I. Lanes l-6: Samples from PBMC cultures originating from seropositive cats. Lane 7: Negative control. Lanes 8 and 9: Positive controls of both the first and the second round of PCR (500 basepair segment of lambda DNA). Lane IO: DNA marker. Lane 2 and 6: Only one of the bands are visible. this being regarded as a positive result.
245 TABLE 2 Detection of FIV by PCR in feline PBMC from blood and culture samples No. (SC) of positive
Type of sample
No. tested
Blood samples from FIV seropositive cat?
14
6
(42.9)
Blood from FIV seronegative cats
36
0
(0)
PBMC culturesh from FIV seropositive cats
13
12’
PBMC culturesb from FIV seronegative cats
14
0
(92.3)
(0)
‘Originated from seven seropositive cats, blood was collected twice four weeks apart bThe PBMC cultures had been maintained for three weeks. ‘One culture was negative also in FIV Ag-ELISA test.
However, this culture was also found to be negative by FIV Ag-ELISA. The sensitivity of the PCR, was found to be between one and ten cells from an Ag-ELISA positive culture. The viability of the cells in the two cultures from which these dilutions originated from was estimated to be 7 and 44%, respectively. Comparison between PCR and FIV Ag-ELBA Full agreement was found between the results from Ag-ELISA and PCR for 27 cultivated PBMC samples, 12 were positive and 15 were negative. In cultures of PBMC from seropositive cats, FIV infection was detected four days earlier by the PCR procedure than by FIV Ag-ELISA in two cell cultures, two days earlier in two cultures, and in the fifth cell culture the infection was detected on the same day (Table 3). TABLE 3 Detection of FIV in PBMC cultures from seropositive Cat no.
Days of cultivation
cats by PCR and FIV Ag-ELISA
of PBMC
3
6
8
IO
13
15
9
-/-
-/-
-/-
+I-
f
18 29 53 59 75
-/-l-
-l-/-
-/ti-
+ + -t +
-t -
-
17
20
22
24
45
+I-
nd/ + -_/nd/+
-I-*
t- 1 + +/+
+/+
+I+
-/_::I -/-i-
-/-
+1-l+/-
_/_ +I-
in each case the PCR result is given in front of the slash, and the FIV antigen ELISA result after the slash. - = negative, + = positive, nd = not done. *FIV had been isolated from cat no. 59 in an earlier attempt.
246
Discussion In the present work, a specific and sensitive PCR assay to detect FIV in feline PBMC, from both blood samples and cultures, is described. The use of nested sets of primers in the PCR procedure in order to increase the specificity has been described by several authors (Kemp et al., 1989; Albert and Fenyii, 1990; Rimstad et al., 1990). The inner pairs of primers will anneal to the template if the outer pairs have amplified the correct sequence. The use, in the present study, of several primer pairs increased the specificity of the test. The use of nested primers made the interpretation considerably easier, as the bands were distinct, this in turn making the test as such more specific. The identity of the bands produced in the PCR was further documented by the Hind111 cleaving the ampli~ed segments in the predicted positions. Hybridization with a radioactively labelled internal probe to verify the results was therefore unnecessary. All positive and negative PCR results from PBMC cultures were in accordance with results from FIV Ag-ELISA, adding further evidence in support of high specificity. The fact that both PCR and Ag-ELISA detected FTV in PBMC cultures after lo-24 days, probably reflects the time needed for the virus to start propagating in the cell cultures. Two independent PCRs were performed per tube. Theoretically, this procedure will increase the possibilities for interaction between the different primers, and raises the likelihood of primer-dimer artifacts. In our material, no such artifacts or any other negative effects of two PCRs per tube were observed, and the diagnostic value w-as increased by amplifying DNA from two genes. Dilution of FIV infected cell cultures and the subsequent PCR, showed that proviral FIV could be detected when the cells present numbered less than ten, but more than one. The proportion of infected cells was, however, not determined, nor was the number of proviral FIV copies per cell known. The sensitivity of the PCR should be further documented. In HIV infection in man, it has been documented that most, if not all, infected circulating mononuclear cells contain only one viral copy (Simmonds et al., 1990). However, the number of FIV provirus copies may be higher than one in cultivated mononuclear cells. Moreover, the viability of the cells in the present experiment was low, possibly indicating viral induced cytopathic effects, and hence the possible presence of more viral DNA intermediates. A positive PCR result for less than ten cells may therefore not necessarily reflect the actual number of cells infected. It has been demonstrated, however, that double PCRs are sufficiently sensitive to detect a single copy of integrated HIV provirus (Albert and Fenyo, 1990; Simmonds et al., 1990). From HIV infection in man, it is known that asymptomatic carriers may have an infection rate of one cell per lo4 to lo5 PBMC, or even less than one cell per lo6 PBMC (Harper et al., 1986; Ulrich et al., 1988). None of the cats used in our tests showed any clinical signs of disease when blood samples were taken. The fact that the PCR did not detect FIV DNA in all samples from seropositive cats. may indicate that the rate of infected PBMCs in the cats was very low.
241
The antibody-capturing ELISA test that is regularly used to diagnose FIV infection, may have a low rate of false positive results (Hosie and Jarrett, 1990). This may be especially true in thoroughly vaccinated animals possessing antibodies against common cat cell antigens which can interfere in this test. Western blot may be an alternative in such cases, but is, however, not as sensitive as ELISA (Pedersen, 1990). Cross reactions against non-viral proteins in the same weight range as the specific viral proteins may confound interpretation. The fact that FTV has been isolated from seronegative cats (Harbour et al., 1988; Yamamoto et al., 1988; Hopper et al., 1989; Ueland and Nesse, 1991) further emphasizes the need to cultivate PBMC or to perform PCR to demonstrate FIV in certain cases. Our results showed that the PCR procedure enabled FIV in cell cultures of PBMCs from cats to be detected on average two days earlier than with FIV AgELISA, which is again eight times more sensitive than the assay for viral reverse transcriptase activity (Tilton et al., 1990). We conclude that PCR could be a useful additional method to detect FIV in PBMC cultures.
Acknowledgements The authors are grateful to Dr. B. Bogen and Dr. G. Lauritzen, Institute of General and Rheumatological Immunology, Oslo, Norway, for providing recombinant mouse IL2 from the transfected myeloma cell line X63Ag8-653. References Albert, J. and Fenyo. E.M. (1990) Simple, sensitive and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J. Clin. Microbial. 28, 1560&1564. Harbour, D.A., Williams, P.D., Gruffuydd-Jones, T.J., Burbridge, J. and Pearson, G.R. (1988) Isolation of a T-lymphotropic lentivirus from a persistently leucopenic domestic cat. Vet. Rec. 122, 8486. Harper, M.E., Marselle, L.M., Gallo, R.C. and Wong-Staal, F. (1986) Detection of lymphocytes expressing human T-lymphotropic virus type III in lymph nodes and peripheral blood from infected individuals by in situ hybridization. Proc. Natl. Acad. Sci. USA 83, 7722776. Hopper, C., Sparkes, A., Gruffuydd-Jones, T.J., Crispin, S.M., Harbour, D.A. and Stokes. C.R. (1989) Clinical and laboratory findings in cats infected with feline immunodeficiency virus. Vet. Rec. 125, 341-346. Hosie, M.J. and Jarrett, 0. (1990) Serological responses of cats to feline immunodeficiency virus. AIDS 4, 215-220. Karasuyama, H. and Melchers, F. (1988) Establishment of mouse cell lines which constitutively secrete large quantities of interleukin 2,3,4 or 5, using modified cDNA expression vectors. Eur. J. Immunol. 18, 97-104. Kemp, D.J., Smith, D.B., Foote, S.J., Samaras, N. and Peterson, M.G. (1989) Calorimetric detection of specific DNA segments amplified by polymerase chain reactions. Proc. Natl. Acad. Sci. USA 86, 2423-2427. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1989) Molecular cloning. A laboratory manual. Cold Spring Harbour Laboratory, New York.
248 O’Connor, T.P.. Jr., Tanguay. S., Steinman, R., Smith, R., Barr, M.C., Yamamoto, J.K., Pedersen. N.C., Andersen, P.R. and Tonelli, Q.J. (1989) Development and evaluation of immunoassay for detection of antibodies to the feline T-lymphotropic lentivirus (Feline immunodeliciency virus). J. Clin. Microbial. 27. 474479. Olmsted. R.A., Hirsch. V.M., Purcell, R.H. and Johnson, P.R. (1989) Nucleotide sequence analysis of feline immunodeliciency virus: genome organization and relationship to other lentiviruses. Proc. Natl. Acad. Sci. USA 86, 8088-8092. Pedersen, N.C., Ho, E.W., Brown, M.L. and Yamamoto, J.K. (1987) Isolation of a T-lymphotropic virus from domestic cats with an immunodeficiency-like syndrome. Science 235, 790 -793. Pedersen. N.C. (1990) Feline immunodeliciency virus. In: H. Schellekens and M.C. Horzinek (Eds). Animal Models in AIDS. Elsevier, Amsterdam, pp. 1655183. Rimstad E., Homes, E., Olsvik, 0. and Hyllseth, B. (1990) Identification of a double stranded RNA virus by using polymerase chain reaction and magnetic separation of the synthesized DNA segments. J. Clin. Microbial. 28. 2275-2278. Saiki. R.K.. Gelfand, D.H., Stoffel, S.. Scharf, S.J., Higuchi, R., Horn. T.B.. Mullis, K.B. and Erlich, H.A. (1988) Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487491. Simmonds, P., Balfe. P.. Peutherer, J.F., Ludlam, CA., Bishop, J.O. and Leigh Brown, A.J. (1990) Human immunodeficiency virus-infected individuals contain provirus in small numbers of peripheral mononuclear cells and at low copy numbers. J. Virol. 64. 864872. Stoeckl. E., Barrett, N., Heinz. F.X., Banekovich, M.. Stingl, G.. Guggenberger. K.. Dorner. F. and Kunz. C. (1989) Efficiency of the polymerase chain reaction for the detection of human immunodeficiency virus type I (HIV-I) DNA in the lymphocytes of infected persons. J. Med. Viral. 29. 2499255. Talbott. R.T., Sparger, E.E.. Lovelace. K.M.. Fitch. W.M.. Pedersen, N.C.. Luciw. P.A. and Elder, J.H. (1989) Nucleotide sequence and genomic organization of feline immunodeliciency virus. Proc. Natl. Acad. Sci. USA 86. 574335747. Tilton. G.K.. O’Connor, T.P., Jr., Seymour, CL.. Lawrence, K.L.. Cohen, N.D., Andersen, P.R. and Tonelli. Q.J. (1990) Immunoassay for detection of feline immunodeficiency virus core antigen. J. Clin. Microbial. 28. 898904. Torton. M.. Rideout, B.A., Luciw. P.A.. Sparger, E.E. and Pedersen, N.C. (1990) Co-infection of cats with feline immunodeticiency virus (FIV) and feline leukemia virus (FeLV) enhances the severity of FIV infection and affects distribution of FIV DNA in various tissues. In: H. Schellekens and M.C. Horzinek (Eds), Animal Models in AIDS. Elsevier, Amsterdam, pp. 2099 219. Ueland, K. and Nesse, L.L. (1991) No evidence of vertical transmission of naturally acquired feline immunodeficiency virus infection. Vet. Immunol. Immunopathol. in press. Ulrich, P.P., Busch, M.P.. El-Beik. T., Shiota, J., Vennari. J.. Shriver, K. and Vyas. G.N. (1988) Assessment of human immunodeliciency virus expression in co-cultures of peripheral blood mononuclear cells from healthy seropositive subjects. J. Med. Viral. 25, I-IO. Yamamoto, J.K.. Sparger E., Ho, E.W.. Andersen, P.R., O’Connor. P.. Mandell, C.P.. Lowenstine, L., Munn, R. and Pedersen, N.C. (1988) The pathogenesis of experimentally induced feline immunodeficiency virus (FIV) infections in cats. Am. J. Vet. Res. 49, 12461248. Yamamoto, J.K., Hansen, H.. Ho, E.W.. Morishita. T.Y., Okuda. T.. Sawa, T.R., Nakamura. R.M.. Kau. W.P. and Pedersen. N.C. (1989) Epidemiological and clinical aspects of feline immunodeficiency virus infection in cats from the continental United States and Canada. and possible mode of transmission. J. Am. Vet. Med. Ass. 194, 213-220.
