Microbial Pathogenesis 1992 ; 12 : 79-86
Detection of genes coding for listeriolysin and Listeria monocytogenes antigen A (ImaA) in Listeria spp . by the polymerase chain reaction W . M . Johnson, S . D . Tyler, E . P . Ewan, F . E . Ashton, G . Wang and K . R . Rozee National Laboratory for Bacteriology, Bureau of Microbiology, Laboratory Centre for Disease Control, Health and Welfare Canada, Tunney s Pasture, Ottawa, Ontario, K1A OL2, Canada (Received June 24,1991 ; accepted in revised form September 23, 1991)
Johnson, W . M . (National Laboratory for Bacteriology, Bureau of Microbiology, Laboratory Centre for Disease Control, Health and Welfare Canada, Tunney's Pasture, Ottawa, Ontario K1 A OL2, Canada), S . D . Tyler, E . P . Ewan, F . E . Ashton, G . Wang and K . R . Rozee . Detection of genes coding for listeriolysin and Listeria monocytogenes antigen A (ImaA) in Listeria s pp . by the polymerase chain reaction . Microbial Pathogenesis 1992; 12 : 79-86 . Two pairs of synthetic oligonucleotide primers were used in a polymerase chain reaction (PCR) protocol to detect targeted sequences in genes coding for listeriolysin 0 and Listeria monocytogenes antigen A (ImaA) . Strains of Listeria spp . used in this study were isolated from clinical specimens, contaminated foods, and environmental sources . Primers were targeted to internal regions of the genes coding for listeriolysin (h/yA) and Listeria antigen (ImaA) and amplification fragments were detected after the PCR by agarose gel electrophoresis . PCR was performed using nucleic acids extracted from a collection of 74 strains of Listeria spp . including 18 reference strains, 41 L . monocytogenes, nine L . innocua, five L . seeligeri and one L . ivanovii, encompassing representative sources, serovars, and enzyme electrophoretic types . Although the listeriolysin gene was found exclusively in L . monocytogenes, some strains of serovar 4c were negative . Simultaneous presence of both genes was restricted to L . monocytogenes strains of serovars 1 /2, 3, and 4 . The ImaA gene was identified in five of 10 L . innocua strains and one L . ivanovii isolated from pork . Strains of L . seeligeri, L . we/shimeri, and L . grayi were negative for both genes . The detection limits in the PCR were found to be 10 pg of nucleic acids for the hlyA gene and 1 pg for the ImaA gene . Key words : Listeria ; listeriolysin ; L . monocytogenes antigen A (ImaA) ; polymerase chain reaction ; molecular epidemiology .
Introduction Listeria monocytogenes and L . ivanovii are recognized as sources of infection in humans and animals, respectively, while other members of the genus Listeria are generally considered non-pathogenic . Human infections often occur in immunocompromised hosts, are potentially very serious, and frequently fatal, with sequelae of meningitis and sepsis . Following an outbreak of listeriosis in the Maritime provinces of Canada in 1981,' which was traced to contaminated coleslaw, it became clear that food-borne transmission is important in this disease . Epidemiological links between animals and humans have been suggested and laboratory efforts have focused on a variety of epidemiological markers in L . monocytogenes, including serovar, phage type, and enzyme electrophoretic type . 0882-4010/92/010079+08 $03 .00/0
© 1992 Academic Press Limited
80
W. M . Johnson et al.
Pathogenicity in Listeria spp . was initially thought to reside totally in the ability of virulent strains to multiply within professional phagocytic cells, including macrophages and monocytes; L . monocytogenes has long been considered a model intracellular parasite for the study of T-cell-mediated immunity . More recent studies suggest that the pathogenicity of L . monocytogenes is multifactorial . Potential and putative virulence factors have included /3-hemolysins, a protein associated with the ability to invade tissue cells, components responsible for immunomodulation in the host, and a 21 kDa polypeptide antigen termed L . monocytogenes antigen A (ImaA) which is capable of eliciting a specific delayed-type hypersensitivity response in Listeriaimmune mice . Listeriolysin 0, the L . monocytogenes hemolysin, is a sulfhydryldependent protein toxin of 58 kDa essential for intracellular growth, as demonstrated in the mouse infection model assay . 2 It is theorized that hemolysin-mediated lysis of the phagocytic vacuole and subsequent interaction with host cell microfilaments may allow tissue colonization and thereby represent a major virulence factor .` A recent study of over 200 isolates of L . monocytogenes indicated that hemolytic activity was related to pathogenicity in immunocompromised mice whereas initial source and serovar of the isolate were not related to virulence . 2 Serodiagnostically, antibodies to listeriolysin 0 which persisted for several months were identified soon after clinical onset of illness in 27 of 28 patients with listeriosis, 5 further implicating listeriolysin as a virulence factor and serving as a good marker of clinical infection . Target-specific genetic probes have been developed and applied to Listeria s pp . t o 6-9 detect genes coding for /3-hemolysin, listeriolysin 0, major secreted polypeptide, 10 and delayed type hypersensitivity factor .' 1,12 Genus-specific probes targeting 16S ribosomal RNA (rRNA) have also been described ." The current study was performed to detect the putative virulence genes, h/yA and ImaA, in a collection of Listeria strains using PCR protocols designed to target specific sequences internal to the genes coding for listeriolysin and ImaA . Strains were isolated from cases of human disease, contaminated foods and environmental sources, and PCR protocols were performed using template nucleic acids extracted from a collection of 74 strains of Listeria, including 18 reference strains and different species . The results obtained in our study suggest a somewhat different distribution of these two genes in Listeria spp . than was previously reported ."' 1,12
Results Specificity and sensitivity of the oligonucleotide primers targeting hlyA and ImaA genes in Listeria spp . Two pairs of synthetic toxin-specific oligonucleotide primers directed at specific nucleotide sequences internal to the coding region for the target genes (Table 1) were used in the PCR protocol . The primers were selected by computerized analysis using published sequences for the h/yA 8 and ImaA genes ." Figure 1 shows the presence and occurrence of the amplified products after agarose gel electrophoresis when nucleic acids extracted from representative Listeria strains were used as template in the PCR . The observed sizes of the amplicons were identical with those predicted from the design of the primers (Table 1), 234 by for h/yA and 257 by for ImaA . Figure 1 illustrates representative genotypes and includes a strain of L . monocytogenes 4b isolated from the cerebrospinal fluid of a patient in the coleslaw-associated outbreak (lanes b and c) and L . monocytogenes 1/2b (lanes d and e) . Lanes f and g of Fig . 1 demonstrate h/yA-negative and /maA-positive results in a strain of L . innocua 6a isolated from cheese . The sensitivity limit of this PCR application in detecting h/yA and ImaA genes in Listeria nucleic acids was 10 pg for h/yA and 1 pg for /maA .
81
PCR detection of hlyA and /maA genes in Listeria
Table 1 Base sequences and predicted sizes of amplified products for the listeriolysin and ImaA primers Gene'
Primer'
hlyA
hlyA-a
hlyA-b lmaA
lmaA-a /maA-b
Oligonucleotide sequence (5'-3') attgcgaaatttggtacagc acttgagatatatgcaggag aacaaggtctaactgtaaac actatagtcagctacaattg
Size of amplified product (bp)
234 257
'Sequences derived from the published nucleotide sequences for h/yA 8 and lmaA ." 'Primers h/yA-b and /maA-b are complementary sequences to the specified gene locations .
As a strategy to confirm and validate amplicon integrity, specific restriction endonuclease sites were identified in the targeted amplicons and restriction fragment length polymorphism (RFLP) patterns were predicted . Digestions were performed with Hinf I on aliquots of the ImaA amplicon generated in the PCR, using nucleic acids from the L . monocytogenes 4b strain isolated from spinal fluid in the coleslaw-associated outbreak (Fig . 1, lane i), as well as L . ivanovii and L . innocua (data not shown) . Identical RFLP patterns were observed for all three species and included 138 and 119 by fragments . Similarly, Mbo II digestion of the h/yA amplicon from the same strain of L . monocytogenes 4b (Fig . 1, lane h) yielded fragments of 97 and 137 by sizes . The RFLP patterns obtained experimentally were identical to those predicted from the published nucleotide sequences for the targeted areas of the h/yA and /maA genes . Primer specificity was determined in the PCR using nucleic acids extracted from 26
Fig . 1 . Agarose gel electrophoresis patterns showing typical amplification fragments in the PCR for the h/yA and /maA genes. Lanes a and j, 123-bp ladder (Bethesda Research Laboratories, Gaithersburg, Maryland) ; lanes b and c, L . monocytogenes 4b, hlyA- and /maA-positive ; lanes d and e, L . monocytogenes 1/2b, h/yA-positive and /maA-negative ; lanes f and g, L . innocua 6a, h/yA-negative and /maA-positive ; lane h, L . monocytogenes 4b h/yA amplicon digested with Mbo II ; lane i, L . monocytogenes 4b /maA amplicon digested with Hinf I .
82
W . M . Johnson et al .
strains of common human pathogens, including reference strains listed in the Materials and methods, and defined in terms of their toxigenicity . None of the recognized toxigenic pathogens tested in this study and previously described in some detail 14--16 contained template capable of producing specific amplicons in the PCR using the primers targeting sequences in the hlyA or ImaA genes . Nucleic acid templates from some hemolytic species of other genera were also tested in the PCR and found not to generate amplicons similar in size to the h/yA or ImaA gene fragments . Distribution of targeted gene sequences in Listeria spp . The results obtained in the PCR targeting h/yA and ImaA gene sequences in Listeria spp . are summarized in Table 2 for reference strains and Table 3 for the clinical and non-human strains . The only strains from either group found to possess the gene coding for hlyA were L . monocytogenes . None of the other representative species tested within the Listeria genus possessed the gene and seven of 53 L . monocytogenes strains tested in this study were negative . Listeria monocytogenes type strain ATCC 15313 and all the h/yA-negative L . monocytogenes of serovar 4c were found to be non-hemolytic when tested on Columbia agar supplemented with five per cent sheep erythrocytes . Although representatives of the nine most common electrophoretic types of L . monocytogenes serovar 4b isolated in Canada were tested in this study, there was no correlation between electrophoretic type and hlyA or ImaA carriage, since all serovar 4b strains were found to possess both genes . The ImaA gene was more widely dispersed and occurred in 36 of 53 L . monocytogenes tested, five of 10 L . innocua, and one of two L . ivanovii. Listeria monocytogenes strains lacking the /maA gene were restricted to serovars 4a (one strain), 4c (15 strains), and a single strain of
Table 2 Listeria reference strains tested in PCR protocols targeting fragments of genes coding for listeriolysin (hlyA) and Listeria monocytogenes antigen A (ImaA) Genes by PCR Strain
ATCC No .
Listeria monocytogenes 'Murray' NCTC 7973 NCTC 5348 NCTC 5105 D-V1916 NCTC 5214 NCTC 10527
15313 19111 19112 19113
19114 19116
NCTC 4883 19117 D-V21 D-V1627 L . ivanovii 19119 L . innocua D-V93/96 L . seeligeri
Serovar
Source'
1/2 1/2a 1/2c 3a 3c 4a 4b 4c 4c 4d 4d
NH NH H H
5
Rabbit Guinea pig Spinal fluid
NH
Sheep brain
NH NH NH
Chicken Fowl myocardium Sheep
NH
Sheep
NH
Soil (avirulent) Spinal fluid
6a 35967
D-V1 383 L . grayi
6 19120
Feces
L . welshimeri 35897
6b
' NH, non-human source; H, human source .
NH
Decayed plant
hlyA
/maA
+ + +
+ + +
+
+
+ + + + + + + +
+ +
+ + +
83
PCR detection of hlyA and ImaA genes in Listeria
Table 3 Listeria strains isolated from clinical cases of listeriosis, food, and environmental sources tested in PCR protocols targeting fragments of genes coding for listeriolysin (hlyA) and Listeria monocytogenes antigen A (ImaA) Genes by PCR No . of strains
Sources
L . monocytogenes 1 H 3 NH 1 NH 2 H 3 NH 1 NH 1 H 1 NH 11 H 2 NH 2 N H 6 N H 7 N H L . innocua 2 N H 3 N H 4 N H L . seeligeri 5 NH L . ivanovii 1 NH
Food Env Food Food Food
Food Env Food Env Food
Serovar
1/2 1/2 1 /2 1/2b 1/2b 1/2bb 3 3 4b` d 4b 4c 4c 4c
hlyA
/maA
+ + + + +
+ + + + +
+
-
+ + +
+ + +
+
+
+ + -
+ -
6a 6a 6a
-
+ + -
1/2b
-
-
5
-
+
aH, human source ; NH Food, non-human food source ; NH Env, nonhuman environmental source . b Strain exhibited atypical electrophoretic mobilities for esterase . `Includes one spinal fluid isolate from a patient involved in the Canadian outbreak . 'Includes a food-borne isolate from coleslaw associated with the Canadian outbreak .
serovar 1 /2b with atypical electrophoretic mobilities for esterase . Only two of 17 L . monocytogenes serovar 4c strains tested contained the ImaA gene . Discussion The distribution of target sequences for hlyA and ImaA genes in representative Listeria species differed somewhat from previous reports using either hybridization- or PCRbased techniques . HlyA targets were confined to L . monocytogenes and ImaA to L . monocytogenes, L . innocua, and L . ivanovii. There were exceptions, with hlyAnegative L . monocytogenes occurring in seven of 17 strains of serovar 4c . In the case of the ImaA gene, some strains of L . monocytogenes 1/2b, 4a, and 4c were negative in this species with the majority being of serovar 4c . Listeria innocua strains also harboured the ImaA gene in five of 10 isolates tested as did a single strain of L . ivanovii isolated from pork . Most L . monocytogenes of serovars 1 /2a-c and all strains of serovars 3 and 4b, contained both hlyA and ImaA targets . Earlier reports describing the incidence of h/yA and ImaA genes in Listeria spp . were based on DNA hybridization studies . Low stringency hybridization suggested that sequences homologous to the h/yA gene and its 5' adjacent regions existed in L . monocytogenes, L . ivanovii, and L . seeligeri" and that L . monocytogenes-specific
84
W . M . Johnson et al .
regions were located downstream from the hlyA coding region . In a study limited to L . monocytogenes, Conner et al.' used hybridization probes directed at the /fhemolysin gene to demonstrate that most pathogenic strains of L . monocytogenes were positive and some strains were negative . In another study using probes encoding the hlyA gene and surrounding sequences, hybridization signals were detected in L . monocytogenes, L . ivanovii, and L . seeligeri' and immunoblotting experiments permitted detection of the protein in supernatants of all three species . Leimeister-Wachter and Chakraborty' found that reference strains of L . ivanovii (ATCC 19119) and L . see/igeri (SLCC 3954) contained a gene homologous to h/yA and produced a product recognized immunologically . Our PCR-based results differ for the ATCC 19119 strain and all L . see/igeri strains tested were h/yA-negative . Listeria monocytogenes type strain ATCC 15313 has been shown not to be typical of the species, demonstrating atypical antigenic structure, no /3-hemolysis on sheep blood agar and non-pathogenicity in mice ." Our PCR-based results indicate that the target gene fragment is present in ATCC 15313, although no hemolysis of sheep red blood cells could be demonstrated . Gohmann et al . used hybridization probes to study pathogenic Listeria" and reported that the ImaA gene was unique to the L . monocytogenes and L . ivanovii species . The exceptions were strains of L . monocytogenes 4a which did not possess the /maA gene and were previously shown to have attenuated virulence in a mouse model ." Using a 1 .1 kb hybridization probe directed at the ImaA gene," the target was detected in all L . monocytogenes tested with the exception of 10 strains of serovar 4a and one strain of serovar 4b isolated from cheese . The gene was not detected in other species tested, including L . seeligeri, L . grayi, L . murrayi, L . innocua, and L . welshimeri. A single reference strain of L . monocytogenes serovar 4c (ATCC 19116) was tested using the hybridization probes of Notermans et al." and found to be /maA-positive . In our study using the PCR, ATCC 19116 was found to be /maA-negative and h/yA-positive . Gene distribution within the L . monocytogenes 4c serovar was found to be variable and many strains were negative for one or both of the /maA or h!yA genes . Four PCR applications have been reported for Listeria spp ., three targeting the h/yA gene s ' 9• 1 3 and the other a genus-specific fragment of 16S rRNA . 13 Bessesen et al. ° detected the hlyA gene in 100% of 95 L . monocytogenes strains from assorted sources, serovars and electrophoretic types and reported negative results for other Listeria spp . and genera tested . Genus- and species-specific PCR protocols described by Border et al." were tested for sensitivity and specificity using eight reference strains of Listeria spp . and another 18 strains from several genera and species . Whereas the genusspecific PCR product was found in DNA from all seven Listeria species tested, the h/yA target was detected only in the two strains of this species tested and not in any of the other six Listeria spp . investigated . The PCR protocols described here could be of potential value in the rapid detection of Listeria genes in foods and other pathological samples 20 and could be used in conjunction with the genus-specific PCR described by Border et al ." Since the PCR allows detection of targeted sequences independent of expression, a positive result in the PCR is only indicative of the presence of the targets and does not necessarily indicate viability or pathogenic potential .
Materials and methods
Bacterial strains and culture media . Clinical isolates, isolates from foods and reference strains were stored on suitable maintenance media and collected by the National Laboratory for Bacteriology, L .C .D .C . Reference strains included in this study appear in Table 2 and all other strains in Table 3 . Electrophoretic types were determined for clinical isolates using methodology previously described .21 .22 Serotyping was based on the antigenic scheme of Seeliger and
PCR detection of hlyA and ImaA genes in Listeria
85
Hohne 23 and reported using the Donker-Voet designation . Bacterial cultures of Listeria were grown in 10 ml of trypticase soy broth overnight at 37°C prior to extraction of nucleic acids using sodium dodecyl sulfate-lysozyme as previously described ." Strains from other genera tested using either set of primers in the Listeria PCR included recognized pathogens such as toxigenic Escherichia coli, Shigella dysenteriae 1, Salmonella spp ., Campylobacter spp ., Streptococcus pyogenes, S . pneumoniae, Staphylococcus aureus, Vibrio cholerae, and Aeromonas spp ., most of which have been previously described in recent publications describing PCR protocols ."-" Hemolytic strains of E. coil, Aeromonas, and Streptococcus were included in the screening to ascertain any possible genetic homology with listeriolysin . PCR . Table 1 describes the listeriolysin- and ImaA-specific oligonucleotide primers designed by computerized sequence analysis 24 and obtained from the Oligonucleotide Synthesis Laboratory, Queen's University, Kingston, Ontario, Canada . Targeted gene sequences corresponded to nucleotide positions 703-936 of the published coding sequence for hlyA 6 and positions 512-768 for the lmaA 11 gene . Nucleic acids were isolated as above from all strains listed in Tables 2 and 3 . PCR was performed as previously described 15 using 10 ng nucleic acid in a 50µl reaction mixture under the following amplification cycles : denaturation for 2 min at 94°C, annealing of primers for 2 min at 55°C, and primer extension for 1 min at 72°C with autoextension . Polymerase chain reaction mixtures were subjected to 30 cycles of amplification in a DNA Thermal Cycler (Perkin Elmer Cetus) after initial denaturation for 5 min at 94°C . Ten microliters of the reaction mixture was then analysed by standard submarine gel electrophoresis (2% agarose ; 5 V/cm), and the reaction products were visualized by staining with ethidium bromide (0 .5 icg/ml in the running buffer) . All PCR protocols were performed using only one primer pair per tube and procedures recommended by Kwok and Higuchi 25 were adopted in order to avoid possible amplicon carryover . To test the sensitivity of the PCR procedure in detecting the hlyA and /maA genes, nucleic acids from reference strains of L . monocytogenes known to carry the target genes were adjusted to a concentration of 200 pg/ml and serial ten-fold dilutions were made in TE buffer (10 mm Tris-CI, 1 mm EDTA, pH 8 .0) prior to use as template in the PCR . RFLP analysis to establish amplicon integrity . Ten-microliter aliquots of the amplified fragments recovered after the PCR using nucleic acids from the coleslaw-associated L . monocytogenes 4b strain and single primer pairs were subjected to RE digestions using Mbo II for hlyA and Hinf I for /maA (Gibco-BRL) as recommended by the manufacturer . Based on the published sequences for these genes, Mbo 11 was predicted to digest the hlyA amplicon into 137- and 97-bp fragments whereas Hinf I was predicted to yield 138- and 119-bp fragments from the ImaA amplicon . The digested samples were analysed by standard submarine gel electrophoresis as above .
We gratefully acknowledge extensive use of the Sequence Analysis Software Package, Genetics Computer Group, University of Wisconsin . We also wish to acknowledge the excellent technical assistance of A . Ryan, M . Bellefeuille, and E . Ofori . A .G .W . is the recipient of a Natural Sciences and Engineering Research Council of Canada Visiting Fellowship .
References 1 . Schlech WF, Lavigne PM, Bortolussi RA . Epidemic listeriosis-evidence for transmission by food . N Engl J Mad 1983 ; 308: 203-6 . 2 . Conner DE, Scott VM, Sumner SS, Bernard DT . Pathogenicity of foodborne, environmental and clinical isolates of Listeria monocytogenes in mice . J Food Sci 1989; 54 : 1553-6 . 3 . Geoffroy C, Gaillard JL, Alouf JE, Berche P . Purification, characterization, and toxicity of the sulfhydrylactivated hemolysin listeriolysin 0 from Listeria monocytogenes . Infect Immun 1987 ; 55 : 1641-6 . 4 . Mounier J, Ryter A, Coquis-Rondon M, Sansonetti PJ . Intracellular and cell-to-cell spread of Listeria monocytogenes involves interaction with F-actin in the enterocytelike cell line Caco-2 . Infect Immun 1990;58 :1048-58 .
Berche P, Reich KA, Bonnichon M . Detection of anti-listeriolysin 0 for serodiagnosis of human listeriosis . Lancet 1990 ; 335 : 624-7 . 6 . Bessesen MT, Luo Q, Rotbart HA, Blaser MJ, Ellison RT Ill . Detection of Listeria monocytogenes by using the polymerase chain reaction . Appl Environ Microbiol 1990 ; 56 : 2930-2. 7 . Leimeister-Wachter M, Chakraborty T . Detection of listeriolysin, the thiol-dependent hemolysin in Listeria monocytogenes, Listeria ivanovii, and Listeria seeligeri. Infect Immun 1989 ; 57 : 2350-7 . 5.
86
W . M . Johnson et a/.
8 . Mengaud J, Vicente M-F, Chenevert J . Expression in Escherichia co/i and sequence analysis of the listeriolysin 0 determinant of Listeria monocytogenes . Infect Immun 1988 ; 56 : 766-72 . 9 . Deneer HG, Boychuk I . Species-specific detection of Listeria monocytogenes by DNA amplification . App] Environ Microbiol 1991 ; 57 : 606-9 . 10 . Flamm RK, Hinrichs DJ, Thomashow MF . Cloning of a gene encoding a major secreted polypeptide of Listeria monocytogenes and its potential use as a species-specific probe . App] Environ Microbiol 1989 ; 55 : 2251-6 . 11 . Gohmann S, Leimeister-Wachter M, Schiltz E, Goebel W, Chakraborty T . Characterization of a Listeria monocytogenes-specific protein capable of inducing delayed hypersensitivity in Listeria-immune mice . Mol Microbiol 1990; 4:1091-9 . 12 . Notermans S, Chakraborty T, Leimeister-Wachter M . Specific gene probe for detection of bioptyped and serotyped Listeria strains . Appl Environ Microbiol 1989 ; 55 : 902-6 . 13 . Border PM, Howard JJ, Plastow GS, Siggens LW . Detection of Listeria monocytogenes using polymerase chain reaction . Lett App] Microbiol 1990 ; 11 : 158-62 . 14 . Johnson WM, Tyler SD, Ewan EP, Ashton FE, Pollard DR, Rozee KR . Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin-1 in Staphylococcus aureus by the polymerase chain reaction . J Clin Microbiol 1991 ; 29 : 426-30 . 15 . Pollard DR, Johnson WM, Lior H, Tyler SD, Rozee KR . Rapid and specific detection of verotoxin genes in Escherichia coil by the polymerase chain reaction . J Clin Microbiol 1990 ; 28 : 540-5 . 16 . Pollard DR, Johnson WM, Lior H, Tyler SD, Rozee KR . Detection of the aerolysin gene in Aeromonas hydrophila by the polymerase chain reaction . J Clin Microbiol 1990 ; 28 : 2477-81 . 17 . Gormley E, Mengaud J, Cossart P . Sequences homologous to the listeriolysin 0 gene region of Listeria monocytogenes are present in virulent and avirulent haemolytic species of the genus Listeria . Res Microbiol 1989; 140 : 631-43 . 18 . Kathariou S, Pine L . The type strain(s) of Listeria monocytogenes : a source of continuing difficulties . Int J Syst Bacteriol 1991 ; 41 : 328-30 . 19 . Kaufmann SHE . Acquired resistance to facultative intracellular bacteria : relationship between persistence, cross-reactivity at the T-cell level, and capacity to stimulate cellular immunity of different Listeria strains . Infect Immun 1984 ; 45 : 234-41 . 20 . Schochetman G, Ou C-Y, Jones WK . Polymerase chain reaction . J Infect Dis 1988 ; 158 : 1154-7 . 21 . Bibb WF, Gellin BG, Weaver R . Analysis of clinical and foodborne isolates of Listeria monocytogenes in the United States by multilocus enzyme electrophoresis and application of the method to epidemiologic investigations. Appl Environ Microbiol 1990 ; 56 : 2133-41 . 22 . Selander RK, Caugant DA, Ochman H, Musser JM, Gilmour MN, Whittam TS . Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics . Appl Environ Microbiol 1986 ; 51 : 873-84 . 23 . Seeliger H PR, HOhne K . Serotyping of Listeria monocytogenes and related species . In : Bergan T, Norris JR, eds . Methods in microbiology, Vol . 13 . New York : Academic Press, 1979 : 31-49 . 24 . Devereux J, Haeberli P, Smithies 0 . A comprehensive set of sequence analysis programs for the VAX . Nucleic Acids Res 1984 ; 12 : 387-95 . 25 . Kwok S, Higuchi R . Avoiding false positives with PCR . Nature 1989 ; 339 : 237-8 .
Detection of genes coding for listeriolysin and Listeria monocytogenes antigen A (ImaA) in Listeria spp . by the polymerase chain reaction W . M . Johnson, S . D . Tyler, E . P . Ewan, F . E . Ashton, G . Wang and K . R . Rozee National Laboratory for Bacteriology, Bureau of Microbiology, Laboratory Centre for Disease Control, Health and Welfare Canada, Tunney s Pasture, Ottawa, Ontario, K1A OL2, Canada (Received June 24,1991 ; accepted in revised form September 23, 1991)
Johnson, W . M . (National Laboratory for Bacteriology, Bureau of Microbiology, Laboratory Centre for Disease Control, Health and Welfare Canada, Tunney's Pasture, Ottawa, Ontario K1 A OL2, Canada), S . D . Tyler, E . P . Ewan, F . E . Ashton, G . Wang and K . R . Rozee . Detection of genes coding for listeriolysin and Listeria monocytogenes antigen A (ImaA) in Listeria s pp . by the polymerase chain reaction . Microbial Pathogenesis 1992; 12 : 79-86 . Two pairs of synthetic oligonucleotide primers were used in a polymerase chain reaction (PCR) protocol to detect targeted sequences in genes coding for listeriolysin 0 and Listeria monocytogenes antigen A (ImaA) . Strains of Listeria spp . used in this study were isolated from clinical specimens, contaminated foods, and environmental sources . Primers were targeted to internal regions of the genes coding for listeriolysin (h/yA) and Listeria antigen (ImaA) and amplification fragments were detected after the PCR by agarose gel electrophoresis . PCR was performed using nucleic acids extracted from a collection of 74 strains of Listeria spp . including 18 reference strains, 41 L . monocytogenes, nine L . innocua, five L . seeligeri and one L . ivanovii, encompassing representative sources, serovars, and enzyme electrophoretic types . Although the listeriolysin gene was found exclusively in L . monocytogenes, some strains of serovar 4c were negative . Simultaneous presence of both genes was restricted to L . monocytogenes strains of serovars 1 /2, 3, and 4 . The ImaA gene was identified in five of 10 L . innocua strains and one L . ivanovii isolated from pork . Strains of L . seeligeri, L . we/shimeri, and L . grayi were negative for both genes . The detection limits in the PCR were found to be 10 pg of nucleic acids for the hlyA gene and 1 pg for the ImaA gene . Key words : Listeria ; listeriolysin ; L . monocytogenes antigen A (ImaA) ; polymerase chain reaction ; molecular epidemiology .
Introduction Listeria monocytogenes and L . ivanovii are recognized as sources of infection in humans and animals, respectively, while other members of the genus Listeria are generally considered non-pathogenic . Human infections often occur in immunocompromised hosts, are potentially very serious, and frequently fatal, with sequelae of meningitis and sepsis . Following an outbreak of listeriosis in the Maritime provinces of Canada in 1981,' which was traced to contaminated coleslaw, it became clear that food-borne transmission is important in this disease . Epidemiological links between animals and humans have been suggested and laboratory efforts have focused on a variety of epidemiological markers in L . monocytogenes, including serovar, phage type, and enzyme electrophoretic type . 0882-4010/92/010079+08 $03 .00/0
© 1992 Academic Press Limited
80
W. M . Johnson et al.
Pathogenicity in Listeria spp . was initially thought to reside totally in the ability of virulent strains to multiply within professional phagocytic cells, including macrophages and monocytes; L . monocytogenes has long been considered a model intracellular parasite for the study of T-cell-mediated immunity . More recent studies suggest that the pathogenicity of L . monocytogenes is multifactorial . Potential and putative virulence factors have included /3-hemolysins, a protein associated with the ability to invade tissue cells, components responsible for immunomodulation in the host, and a 21 kDa polypeptide antigen termed L . monocytogenes antigen A (ImaA) which is capable of eliciting a specific delayed-type hypersensitivity response in Listeriaimmune mice . Listeriolysin 0, the L . monocytogenes hemolysin, is a sulfhydryldependent protein toxin of 58 kDa essential for intracellular growth, as demonstrated in the mouse infection model assay . 2 It is theorized that hemolysin-mediated lysis of the phagocytic vacuole and subsequent interaction with host cell microfilaments may allow tissue colonization and thereby represent a major virulence factor .` A recent study of over 200 isolates of L . monocytogenes indicated that hemolytic activity was related to pathogenicity in immunocompromised mice whereas initial source and serovar of the isolate were not related to virulence . 2 Serodiagnostically, antibodies to listeriolysin 0 which persisted for several months were identified soon after clinical onset of illness in 27 of 28 patients with listeriosis, 5 further implicating listeriolysin as a virulence factor and serving as a good marker of clinical infection . Target-specific genetic probes have been developed and applied to Listeria s pp . t o 6-9 detect genes coding for /3-hemolysin, listeriolysin 0, major secreted polypeptide, 10 and delayed type hypersensitivity factor .' 1,12 Genus-specific probes targeting 16S ribosomal RNA (rRNA) have also been described ." The current study was performed to detect the putative virulence genes, h/yA and ImaA, in a collection of Listeria strains using PCR protocols designed to target specific sequences internal to the genes coding for listeriolysin and ImaA . Strains were isolated from cases of human disease, contaminated foods and environmental sources, and PCR protocols were performed using template nucleic acids extracted from a collection of 74 strains of Listeria, including 18 reference strains and different species . The results obtained in our study suggest a somewhat different distribution of these two genes in Listeria spp . than was previously reported ."' 1,12
Results Specificity and sensitivity of the oligonucleotide primers targeting hlyA and ImaA genes in Listeria spp . Two pairs of synthetic toxin-specific oligonucleotide primers directed at specific nucleotide sequences internal to the coding region for the target genes (Table 1) were used in the PCR protocol . The primers were selected by computerized analysis using published sequences for the h/yA 8 and ImaA genes ." Figure 1 shows the presence and occurrence of the amplified products after agarose gel electrophoresis when nucleic acids extracted from representative Listeria strains were used as template in the PCR . The observed sizes of the amplicons were identical with those predicted from the design of the primers (Table 1), 234 by for h/yA and 257 by for ImaA . Figure 1 illustrates representative genotypes and includes a strain of L . monocytogenes 4b isolated from the cerebrospinal fluid of a patient in the coleslaw-associated outbreak (lanes b and c) and L . monocytogenes 1/2b (lanes d and e) . Lanes f and g of Fig . 1 demonstrate h/yA-negative and /maA-positive results in a strain of L . innocua 6a isolated from cheese . The sensitivity limit of this PCR application in detecting h/yA and ImaA genes in Listeria nucleic acids was 10 pg for h/yA and 1 pg for /maA .
81
PCR detection of hlyA and /maA genes in Listeria
Table 1 Base sequences and predicted sizes of amplified products for the listeriolysin and ImaA primers Gene'
Primer'
hlyA
hlyA-a
hlyA-b lmaA
lmaA-a /maA-b
Oligonucleotide sequence (5'-3') attgcgaaatttggtacagc acttgagatatatgcaggag aacaaggtctaactgtaaac actatagtcagctacaattg
Size of amplified product (bp)
234 257
'Sequences derived from the published nucleotide sequences for h/yA 8 and lmaA ." 'Primers h/yA-b and /maA-b are complementary sequences to the specified gene locations .
As a strategy to confirm and validate amplicon integrity, specific restriction endonuclease sites were identified in the targeted amplicons and restriction fragment length polymorphism (RFLP) patterns were predicted . Digestions were performed with Hinf I on aliquots of the ImaA amplicon generated in the PCR, using nucleic acids from the L . monocytogenes 4b strain isolated from spinal fluid in the coleslaw-associated outbreak (Fig . 1, lane i), as well as L . ivanovii and L . innocua (data not shown) . Identical RFLP patterns were observed for all three species and included 138 and 119 by fragments . Similarly, Mbo II digestion of the h/yA amplicon from the same strain of L . monocytogenes 4b (Fig . 1, lane h) yielded fragments of 97 and 137 by sizes . The RFLP patterns obtained experimentally were identical to those predicted from the published nucleotide sequences for the targeted areas of the h/yA and /maA genes . Primer specificity was determined in the PCR using nucleic acids extracted from 26
Fig . 1 . Agarose gel electrophoresis patterns showing typical amplification fragments in the PCR for the h/yA and /maA genes. Lanes a and j, 123-bp ladder (Bethesda Research Laboratories, Gaithersburg, Maryland) ; lanes b and c, L . monocytogenes 4b, hlyA- and /maA-positive ; lanes d and e, L . monocytogenes 1/2b, h/yA-positive and /maA-negative ; lanes f and g, L . innocua 6a, h/yA-negative and /maA-positive ; lane h, L . monocytogenes 4b h/yA amplicon digested with Mbo II ; lane i, L . monocytogenes 4b /maA amplicon digested with Hinf I .
82
W . M . Johnson et al .
strains of common human pathogens, including reference strains listed in the Materials and methods, and defined in terms of their toxigenicity . None of the recognized toxigenic pathogens tested in this study and previously described in some detail 14--16 contained template capable of producing specific amplicons in the PCR using the primers targeting sequences in the hlyA or ImaA genes . Nucleic acid templates from some hemolytic species of other genera were also tested in the PCR and found not to generate amplicons similar in size to the h/yA or ImaA gene fragments . Distribution of targeted gene sequences in Listeria spp . The results obtained in the PCR targeting h/yA and ImaA gene sequences in Listeria spp . are summarized in Table 2 for reference strains and Table 3 for the clinical and non-human strains . The only strains from either group found to possess the gene coding for hlyA were L . monocytogenes . None of the other representative species tested within the Listeria genus possessed the gene and seven of 53 L . monocytogenes strains tested in this study were negative . Listeria monocytogenes type strain ATCC 15313 and all the h/yA-negative L . monocytogenes of serovar 4c were found to be non-hemolytic when tested on Columbia agar supplemented with five per cent sheep erythrocytes . Although representatives of the nine most common electrophoretic types of L . monocytogenes serovar 4b isolated in Canada were tested in this study, there was no correlation between electrophoretic type and hlyA or ImaA carriage, since all serovar 4b strains were found to possess both genes . The ImaA gene was more widely dispersed and occurred in 36 of 53 L . monocytogenes tested, five of 10 L . innocua, and one of two L . ivanovii. Listeria monocytogenes strains lacking the /maA gene were restricted to serovars 4a (one strain), 4c (15 strains), and a single strain of
Table 2 Listeria reference strains tested in PCR protocols targeting fragments of genes coding for listeriolysin (hlyA) and Listeria monocytogenes antigen A (ImaA) Genes by PCR Strain
ATCC No .
Listeria monocytogenes 'Murray' NCTC 7973 NCTC 5348 NCTC 5105 D-V1916 NCTC 5214 NCTC 10527
15313 19111 19112 19113
19114 19116
NCTC 4883 19117 D-V21 D-V1627 L . ivanovii 19119 L . innocua D-V93/96 L . seeligeri
Serovar
Source'
1/2 1/2a 1/2c 3a 3c 4a 4b 4c 4c 4d 4d
NH NH H H
5
Rabbit Guinea pig Spinal fluid
NH
Sheep brain
NH NH NH
Chicken Fowl myocardium Sheep
NH
Sheep
NH
Soil (avirulent) Spinal fluid
6a 35967
D-V1 383 L . grayi
6 19120
Feces
L . welshimeri 35897
6b
' NH, non-human source; H, human source .
NH
Decayed plant
hlyA
/maA
+ + +
+ + +
+
+
+ + + + + + + +
+ +
+ + +
83
PCR detection of hlyA and ImaA genes in Listeria
Table 3 Listeria strains isolated from clinical cases of listeriosis, food, and environmental sources tested in PCR protocols targeting fragments of genes coding for listeriolysin (hlyA) and Listeria monocytogenes antigen A (ImaA) Genes by PCR No . of strains
Sources
L . monocytogenes 1 H 3 NH 1 NH 2 H 3 NH 1 NH 1 H 1 NH 11 H 2 NH 2 N H 6 N H 7 N H L . innocua 2 N H 3 N H 4 N H L . seeligeri 5 NH L . ivanovii 1 NH
Food Env Food Food Food
Food Env Food Env Food
Serovar
1/2 1/2 1 /2 1/2b 1/2b 1/2bb 3 3 4b` d 4b 4c 4c 4c
hlyA
/maA
+ + + + +
+ + + + +
+
-
+ + +
+ + +
+
+
+ + -
+ -
6a 6a 6a
-
+ + -
1/2b
-
-
5
-
+
aH, human source ; NH Food, non-human food source ; NH Env, nonhuman environmental source . b Strain exhibited atypical electrophoretic mobilities for esterase . `Includes one spinal fluid isolate from a patient involved in the Canadian outbreak . 'Includes a food-borne isolate from coleslaw associated with the Canadian outbreak .
serovar 1 /2b with atypical electrophoretic mobilities for esterase . Only two of 17 L . monocytogenes serovar 4c strains tested contained the ImaA gene . Discussion The distribution of target sequences for hlyA and ImaA genes in representative Listeria species differed somewhat from previous reports using either hybridization- or PCRbased techniques . HlyA targets were confined to L . monocytogenes and ImaA to L . monocytogenes, L . innocua, and L . ivanovii. There were exceptions, with hlyAnegative L . monocytogenes occurring in seven of 17 strains of serovar 4c . In the case of the ImaA gene, some strains of L . monocytogenes 1/2b, 4a, and 4c were negative in this species with the majority being of serovar 4c . Listeria innocua strains also harboured the ImaA gene in five of 10 isolates tested as did a single strain of L . ivanovii isolated from pork . Most L . monocytogenes of serovars 1 /2a-c and all strains of serovars 3 and 4b, contained both hlyA and ImaA targets . Earlier reports describing the incidence of h/yA and ImaA genes in Listeria spp . were based on DNA hybridization studies . Low stringency hybridization suggested that sequences homologous to the h/yA gene and its 5' adjacent regions existed in L . monocytogenes, L . ivanovii, and L . seeligeri" and that L . monocytogenes-specific
84
W . M . Johnson et al .
regions were located downstream from the hlyA coding region . In a study limited to L . monocytogenes, Conner et al.' used hybridization probes directed at the /fhemolysin gene to demonstrate that most pathogenic strains of L . monocytogenes were positive and some strains were negative . In another study using probes encoding the hlyA gene and surrounding sequences, hybridization signals were detected in L . monocytogenes, L . ivanovii, and L . seeligeri' and immunoblotting experiments permitted detection of the protein in supernatants of all three species . Leimeister-Wachter and Chakraborty' found that reference strains of L . ivanovii (ATCC 19119) and L . see/igeri (SLCC 3954) contained a gene homologous to h/yA and produced a product recognized immunologically . Our PCR-based results differ for the ATCC 19119 strain and all L . see/igeri strains tested were h/yA-negative . Listeria monocytogenes type strain ATCC 15313 has been shown not to be typical of the species, demonstrating atypical antigenic structure, no /3-hemolysis on sheep blood agar and non-pathogenicity in mice ." Our PCR-based results indicate that the target gene fragment is present in ATCC 15313, although no hemolysis of sheep red blood cells could be demonstrated . Gohmann et al . used hybridization probes to study pathogenic Listeria" and reported that the ImaA gene was unique to the L . monocytogenes and L . ivanovii species . The exceptions were strains of L . monocytogenes 4a which did not possess the /maA gene and were previously shown to have attenuated virulence in a mouse model ." Using a 1 .1 kb hybridization probe directed at the ImaA gene," the target was detected in all L . monocytogenes tested with the exception of 10 strains of serovar 4a and one strain of serovar 4b isolated from cheese . The gene was not detected in other species tested, including L . seeligeri, L . grayi, L . murrayi, L . innocua, and L . welshimeri. A single reference strain of L . monocytogenes serovar 4c (ATCC 19116) was tested using the hybridization probes of Notermans et al." and found to be /maA-positive . In our study using the PCR, ATCC 19116 was found to be /maA-negative and h/yA-positive . Gene distribution within the L . monocytogenes 4c serovar was found to be variable and many strains were negative for one or both of the /maA or h!yA genes . Four PCR applications have been reported for Listeria spp ., three targeting the h/yA gene s ' 9• 1 3 and the other a genus-specific fragment of 16S rRNA . 13 Bessesen et al. ° detected the hlyA gene in 100% of 95 L . monocytogenes strains from assorted sources, serovars and electrophoretic types and reported negative results for other Listeria spp . and genera tested . Genus- and species-specific PCR protocols described by Border et al." were tested for sensitivity and specificity using eight reference strains of Listeria spp . and another 18 strains from several genera and species . Whereas the genusspecific PCR product was found in DNA from all seven Listeria species tested, the h/yA target was detected only in the two strains of this species tested and not in any of the other six Listeria spp . investigated . The PCR protocols described here could be of potential value in the rapid detection of Listeria genes in foods and other pathological samples 20 and could be used in conjunction with the genus-specific PCR described by Border et al ." Since the PCR allows detection of targeted sequences independent of expression, a positive result in the PCR is only indicative of the presence of the targets and does not necessarily indicate viability or pathogenic potential .
Materials and methods
Bacterial strains and culture media . Clinical isolates, isolates from foods and reference strains were stored on suitable maintenance media and collected by the National Laboratory for Bacteriology, L .C .D .C . Reference strains included in this study appear in Table 2 and all other strains in Table 3 . Electrophoretic types were determined for clinical isolates using methodology previously described .21 .22 Serotyping was based on the antigenic scheme of Seeliger and
PCR detection of hlyA and ImaA genes in Listeria
85
Hohne 23 and reported using the Donker-Voet designation . Bacterial cultures of Listeria were grown in 10 ml of trypticase soy broth overnight at 37°C prior to extraction of nucleic acids using sodium dodecyl sulfate-lysozyme as previously described ." Strains from other genera tested using either set of primers in the Listeria PCR included recognized pathogens such as toxigenic Escherichia coli, Shigella dysenteriae 1, Salmonella spp ., Campylobacter spp ., Streptococcus pyogenes, S . pneumoniae, Staphylococcus aureus, Vibrio cholerae, and Aeromonas spp ., most of which have been previously described in recent publications describing PCR protocols ."-" Hemolytic strains of E. coil, Aeromonas, and Streptococcus were included in the screening to ascertain any possible genetic homology with listeriolysin . PCR . Table 1 describes the listeriolysin- and ImaA-specific oligonucleotide primers designed by computerized sequence analysis 24 and obtained from the Oligonucleotide Synthesis Laboratory, Queen's University, Kingston, Ontario, Canada . Targeted gene sequences corresponded to nucleotide positions 703-936 of the published coding sequence for hlyA 6 and positions 512-768 for the lmaA 11 gene . Nucleic acids were isolated as above from all strains listed in Tables 2 and 3 . PCR was performed as previously described 15 using 10 ng nucleic acid in a 50µl reaction mixture under the following amplification cycles : denaturation for 2 min at 94°C, annealing of primers for 2 min at 55°C, and primer extension for 1 min at 72°C with autoextension . Polymerase chain reaction mixtures were subjected to 30 cycles of amplification in a DNA Thermal Cycler (Perkin Elmer Cetus) after initial denaturation for 5 min at 94°C . Ten microliters of the reaction mixture was then analysed by standard submarine gel electrophoresis (2% agarose ; 5 V/cm), and the reaction products were visualized by staining with ethidium bromide (0 .5 icg/ml in the running buffer) . All PCR protocols were performed using only one primer pair per tube and procedures recommended by Kwok and Higuchi 25 were adopted in order to avoid possible amplicon carryover . To test the sensitivity of the PCR procedure in detecting the hlyA and /maA genes, nucleic acids from reference strains of L . monocytogenes known to carry the target genes were adjusted to a concentration of 200 pg/ml and serial ten-fold dilutions were made in TE buffer (10 mm Tris-CI, 1 mm EDTA, pH 8 .0) prior to use as template in the PCR . RFLP analysis to establish amplicon integrity . Ten-microliter aliquots of the amplified fragments recovered after the PCR using nucleic acids from the coleslaw-associated L . monocytogenes 4b strain and single primer pairs were subjected to RE digestions using Mbo II for hlyA and Hinf I for /maA (Gibco-BRL) as recommended by the manufacturer . Based on the published sequences for these genes, Mbo 11 was predicted to digest the hlyA amplicon into 137- and 97-bp fragments whereas Hinf I was predicted to yield 138- and 119-bp fragments from the ImaA amplicon . The digested samples were analysed by standard submarine gel electrophoresis as above .
We gratefully acknowledge extensive use of the Sequence Analysis Software Package, Genetics Computer Group, University of Wisconsin . We also wish to acknowledge the excellent technical assistance of A . Ryan, M . Bellefeuille, and E . Ofori . A .G .W . is the recipient of a Natural Sciences and Engineering Research Council of Canada Visiting Fellowship .
References 1 . Schlech WF, Lavigne PM, Bortolussi RA . Epidemic listeriosis-evidence for transmission by food . N Engl J Mad 1983 ; 308: 203-6 . 2 . Conner DE, Scott VM, Sumner SS, Bernard DT . Pathogenicity of foodborne, environmental and clinical isolates of Listeria monocytogenes in mice . J Food Sci 1989; 54 : 1553-6 . 3 . Geoffroy C, Gaillard JL, Alouf JE, Berche P . Purification, characterization, and toxicity of the sulfhydrylactivated hemolysin listeriolysin 0 from Listeria monocytogenes . Infect Immun 1987 ; 55 : 1641-6 . 4 . Mounier J, Ryter A, Coquis-Rondon M, Sansonetti PJ . Intracellular and cell-to-cell spread of Listeria monocytogenes involves interaction with F-actin in the enterocytelike cell line Caco-2 . Infect Immun 1990;58 :1048-58 .
Berche P, Reich KA, Bonnichon M . Detection of anti-listeriolysin 0 for serodiagnosis of human listeriosis . Lancet 1990 ; 335 : 624-7 . 6 . Bessesen MT, Luo Q, Rotbart HA, Blaser MJ, Ellison RT Ill . Detection of Listeria monocytogenes by using the polymerase chain reaction . Appl Environ Microbiol 1990 ; 56 : 2930-2. 7 . Leimeister-Wachter M, Chakraborty T . Detection of listeriolysin, the thiol-dependent hemolysin in Listeria monocytogenes, Listeria ivanovii, and Listeria seeligeri. Infect Immun 1989 ; 57 : 2350-7 . 5.
86
W . M . Johnson et a/.
8 . Mengaud J, Vicente M-F, Chenevert J . Expression in Escherichia co/i and sequence analysis of the listeriolysin 0 determinant of Listeria monocytogenes . Infect Immun 1988 ; 56 : 766-72 . 9 . Deneer HG, Boychuk I . Species-specific detection of Listeria monocytogenes by DNA amplification . App] Environ Microbiol 1991 ; 57 : 606-9 . 10 . Flamm RK, Hinrichs DJ, Thomashow MF . Cloning of a gene encoding a major secreted polypeptide of Listeria monocytogenes and its potential use as a species-specific probe . App] Environ Microbiol 1989 ; 55 : 2251-6 . 11 . Gohmann S, Leimeister-Wachter M, Schiltz E, Goebel W, Chakraborty T . Characterization of a Listeria monocytogenes-specific protein capable of inducing delayed hypersensitivity in Listeria-immune mice . Mol Microbiol 1990; 4:1091-9 . 12 . Notermans S, Chakraborty T, Leimeister-Wachter M . Specific gene probe for detection of bioptyped and serotyped Listeria strains . Appl Environ Microbiol 1989 ; 55 : 902-6 . 13 . Border PM, Howard JJ, Plastow GS, Siggens LW . Detection of Listeria monocytogenes using polymerase chain reaction . Lett App] Microbiol 1990 ; 11 : 158-62 . 14 . Johnson WM, Tyler SD, Ewan EP, Ashton FE, Pollard DR, Rozee KR . Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin-1 in Staphylococcus aureus by the polymerase chain reaction . J Clin Microbiol 1991 ; 29 : 426-30 . 15 . Pollard DR, Johnson WM, Lior H, Tyler SD, Rozee KR . Rapid and specific detection of verotoxin genes in Escherichia coil by the polymerase chain reaction . J Clin Microbiol 1990 ; 28 : 540-5 . 16 . Pollard DR, Johnson WM, Lior H, Tyler SD, Rozee KR . Detection of the aerolysin gene in Aeromonas hydrophila by the polymerase chain reaction . J Clin Microbiol 1990 ; 28 : 2477-81 . 17 . Gormley E, Mengaud J, Cossart P . Sequences homologous to the listeriolysin 0 gene region of Listeria monocytogenes are present in virulent and avirulent haemolytic species of the genus Listeria . Res Microbiol 1989; 140 : 631-43 . 18 . Kathariou S, Pine L . The type strain(s) of Listeria monocytogenes : a source of continuing difficulties . Int J Syst Bacteriol 1991 ; 41 : 328-30 . 19 . Kaufmann SHE . Acquired resistance to facultative intracellular bacteria : relationship between persistence, cross-reactivity at the T-cell level, and capacity to stimulate cellular immunity of different Listeria strains . Infect Immun 1984 ; 45 : 234-41 . 20 . Schochetman G, Ou C-Y, Jones WK . Polymerase chain reaction . J Infect Dis 1988 ; 158 : 1154-7 . 21 . Bibb WF, Gellin BG, Weaver R . Analysis of clinical and foodborne isolates of Listeria monocytogenes in the United States by multilocus enzyme electrophoresis and application of the method to epidemiologic investigations. Appl Environ Microbiol 1990 ; 56 : 2133-41 . 22 . Selander RK, Caugant DA, Ochman H, Musser JM, Gilmour MN, Whittam TS . Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics . Appl Environ Microbiol 1986 ; 51 : 873-84 . 23 . Seeliger H PR, HOhne K . Serotyping of Listeria monocytogenes and related species . In : Bergan T, Norris JR, eds . Methods in microbiology, Vol . 13 . New York : Academic Press, 1979 : 31-49 . 24 . Devereux J, Haeberli P, Smithies 0 . A comprehensive set of sequence analysis programs for the VAX . Nucleic Acids Res 1984 ; 12 : 387-95 . 25 . Kwok S, Higuchi R . Avoiding false positives with PCR . Nature 1989 ; 339 : 237-8 .
