British Joiirrial of Haematology, 1992, 82 1)eacon. E.. Rowe. hl. & Beard. M.J. 11 992) Epstein-Barr viral DNA i n a c u t e large granular lyniphocyte(natural killer)leukemic cells. Blood. 79. 2 1 1 h-2 I 2 3. Henlc. \V, 8 Henle. G , (1973) Epstein-Rarr virus and infectious mononucleosis. S a i v Eriglririd loirrrinl of Merlicirw, 288, 2h3-264. Shiniakage. h1.. Chatani. M.. Ikegami. N . & Hirai. K. (1989) Rearranged Epstein-Rarr virus genomes and clonal origin in nasopharyngeal carcinoma. Japnnes~lourrial OJ Cancer Rescorch, 80. h 12-6 I f > .
\Te reported previously the existence of niyeloperoxidase negative, myeloid antigen positive acute myelogenous leukaemia ( M Y ) -\re AML) (Imamura c’t 111. 1 9 8 8 ) which was recently classitied as Abll.-MO by FAB group (Hennett ~t ((1. 199 1 1. M’e report here a case of A W A O which had a hot spot point mutation on the H-KAS oncogene. \r 41-year-old man ~ v a sadmitted to the hospital with a 2week history of feVer and general tiredness. The haemoglobin was 13.6 g/dl. the platelet count was 94 x 10yll, and the IVBC 1 4 . 5 x lO‘’9I with 82.5% abnormal cells. The abnormal cells were MPO and SBB-negative with a basophilic cytoplasm and prominent nucleolus. No hepatosplenomegaly was observed. Blood serum lactic dehydrogenase ~ v a selevated to 870 L:I (normal range 1 1 0 - 3 3 0 ) . The leukaeniic cells were separated from heparinized whole blood by a density-gradient technique (Ficollisodium metrizoate). Monoclonal antibodies corresponding to each CI1 (Cluster of Differentiation) number as stated belolv Lvere obtained either commercially or through the courtesy of Ortho Diagnostic Systems K.K. (Tokyo). Japan Scientific Instruments (Tokyo). Cosmo Bio (Tokyo) and Professor H. Shiku (Nagasaki ITniversity). hlonoclonal antibodies ( H 1 , HZ against H-KAS oncogene products were made by us. Cellsurface antigens were analysed by means of a fluorescenceactivated cell sorter (FACS 117. utilizing a panel of monoclonal antibodies as described previously (Imamura et r t l . 1988. 1990). A majority of the cells from the peripheral blood and bone marrow coexpressed the antigens against monoclonal antibodies. C l l l l . CDl 3 , C1113. C1133. CD34. CD38. Ia(HLA-1)K) and CD71. but did not express the antigens against CD1. CD2. C I H . CD4, CI>5. C D i , CD19. U 2 0 . CU21. CD1.2, CD25. Cl15h. C D 5 i and TCR rip. Surface immunoglobulins (Smlghl. igG, IgA. IgD. K and j . ) were not detected. No association tvith human T-cell leukaemia virus1 (HTLY-1 ) Lvas found by means of electron microscopic studies or the application of monoclonal antibodies to p l 9 a n d p 2 3 of HTI.1’-1. By means of two-colour fluorescence. it was clearly demonstrated that the leukaemic cells possessing C’I) 3 3 in the peripheral blood and bone niarrow coexpressed CIl 34. The diagnosis of Abll.-!vlO was confirmed by the detection of MPO protein in the cytoplasm of leukaemic cells by thc indirect irninunofltroresce~~ce test utilizing anti-MPO monoclonal antibodies.
The expression of RAS oncogenes was analysed by a fluorescence-activated cell sorter with a panel of MAbs. The high expression of UWP. which was reported to recognize activated KAS oncogene (Carney rt nl. 1986).was found in this patient. and was associated with high H-KAS expression (Fig 1.A). These facts prompted us to analyse the DNA sequence of RAS genes by an automated DNA sequencer (Applied Biosystems Inc.. 373A. Calif.. 1J.S.A.). I-nexpectedly. as shown in Fig 1R. various H-KAS point mutations were found including a hot spot point mutation at codon 12. whereas the K-KAS point mutation, which is different from the codons 12. 1 3 and 61 (no hot spot point mutation). was only found on three sites (Fig 1C). N o point mutation in exons 5-8 of the p53 suppressor oncogene was detected. whereas leukaemic cells had chromosome abnormality. i(1 i q ) . at no. 1 7 where the p53 gene is located. Almost normal levels of p5 3 gene expression were found by FACS analysis in agreement with DNA analysis. So far we have found two cases of p53 gene point mutation out of six patients with AM.. KAS oncogenes encode 21 kl) proteins (p21) that are associated with the inner plasma membrane, bind guanine nucleotides. and possess GTPase activity (Barbacid, 1987), which is presumably activated by binding to a recently described cytosolic protein termed GAP (for GTPase activating protein). Oncogenic forms of p21 that are capable of transforming cultured rodent cells in vitro usually result from single amino acid substitutions at one of a few critical regions in the protein. At least some of these mutations are believed to act by reducing the intrinsic GTPase activity of the protein, as well as its activation by GAP. These mutations have been detected it7 v i w in either codon 12 or 6 1 of any of the three RAS genes or in codon 1 3 of the N-RAS gene a t frequencies ranging from 10%to 90%. depending on both the type of tumour and the methods used to detect these mutations (Bos. 1988). To our knowledge. there is n o report concerning H-RAS point mutation in human leukaemias and lymphomas. On the basis of these findings, we suggest that H-KAS point mutation together with p i 3 gene mutation may play an important role in leukaemogenesis. Incidence of RAS oncogene point niutations in patients with AML-MO remains to be elucidated.
Case Reports
British Journal of Haernatology, 1992, 82 A C K N 0W LEDG MEN T S
A
inax.
Control
I:
L
a8
777
The authors thank Ms H. Ota and Ms T. Hayashi for technical assistance, Ms H. Sumida for typing the manuscript, and Professor H. Shiku (Nagasaki University), Ortho Diagnostic Systems K.K. (Tokyo), Japan Scientific Intrument Co. (Tokyo), and Pujisawa Pharmaceutical Co. (Osaka) for providing monoclonal antibodies.
DWP
1
n E
t
Department of Internal Medicine, Research Institute for Nuclear Medicine and Biologg, Hiroshima University. 1-2-3 Kasumi. Minami-ku, Hiroshima 734, Iapari
8
NOBUTAKA IMAMITRA ATSIJSHIKIJRAMOTO
0
250
REFERENCES
Intensity(log1
Fluor-
Barbacid, M. (1987) ras genes. Annual Review of Hiochemistr!\. 56. 779-82 7 . C-Ha-ras- I Bennett, J.M., Catovsky. D.. Daniel. M-T.. Flandrin. G., Galton. Exon I D.A.G.. Cralnick. H.R. & Sultan. C. (1991) Proposal for the 10 II 12 13 15 recognition of minimally differentiated acute myeloid leukaemia A~'~~AC(~CA~TA~'AAGCTCCTGCTGGTGGGCCCCG~GTCGGCAACA~TCCCCTGA~CATCCA~CTCA'~C (AML-MU). British ]ournal of Haernatology. 78, 32 5-329. C Bos. J.L. (19 8 8 ) The ras gene family and human carcinomogenesis. CACAACCATTTTGTGGACGAATACGACCCCACTATAGAG Mutation Research, 195, 255-271. Carney. W.P.. Petit, D.. Hamer. P., Der. C.J.. Finkel. T.. Cooper, G.M.. Exon 2 61 Lefebvre, M.. Mobtaker. H., Deiellis. R.. Tischler. AS., Dayal. Y., GATTCCTACCGGAAGCAGGTGGTCATTGATGGGGAGACGTGCCTGTTGGACATCCTGGATACCGCCG~C~ Wolfe, H. & Kabin. H. (1986)Monoclonal antibody specific for an A A activated RAS protein. Proceedings of the Nationiil Actidenug of GAGGAGTACAGCGCCATGCGGGACCAGTACAT~CGCACCGGGGAGGGCTTCCTGTGTGTG~TGCCATCAAC Sciences of the United States ofdrneriru. 8 3 , 7485-7489. t 4 T A T Imamura, N.. Kusunoki, Y.. Kawa-Ha. K.. Yumura. K., Hara, 1.. Oda. AACACCAAGTCTTTTGAGGACATCCACCAGTACAG K., Abe. K.. Dohy. H.. Inada. T.. Kajihara, H. & Kuramoto. A. ( 1990) Aggressive natural killer cell leukaemia/lymphoma: report of four cases and review of the literature. Possible existence of a c-Ki-ras-2 C new clinical entity originating from the third lineage of lymphoid cells. British l o i h a l of Haernatology. 75, 49-59. Exon I 12 13 Imamura. N.. Tanaka, R., Kajihara. H. & Kuramoto. A. ( 1 9 8 8 ) ATGACTGAATATAAACTTCTGGTAGTTGGAGCT~G'rAGGCAAGAGTCCCTTCACGATACAIiCTAATT Analysis of peroxidase negative acute unclassifiable leukemias by monoclonal antibodies. 1. Acute myelogenous leukemia and acute CAGAATCATTTTGTGGACGAATATGATCCAACAATAGAG myelomonocytic leukemia. European ]ourrial of H u t ~ i i i t o / o p 41, ~. 420-428.
B
:: t
z
t
t
A
Exon 2 61 GATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGT~ GAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAAT
A AATACTAAATCA+TTGAAGATATTCACCATTATAG
Fig 1 . (A)High expression of RAS p2 1, H-RAS and DWP was found in a case of acute myelogenous leukaemia (AML-MO)by FACS analysis. (B)and (C) DNA sequences of H-RAS (B) and K-RAS (C) oncogenes in this case by DNA sequencer. Arrows show point mutation.
\Te reported previously the existence of niyeloperoxidase negative, myeloid antigen positive acute myelogenous leukaemia ( M Y ) -\re AML) (Imamura c’t 111. 1 9 8 8 ) which was recently classitied as Abll.-MO by FAB group (Hennett ~t ((1. 199 1 1. M’e report here a case of A W A O which had a hot spot point mutation on the H-KAS oncogene. \r 41-year-old man ~ v a sadmitted to the hospital with a 2week history of feVer and general tiredness. The haemoglobin was 13.6 g/dl. the platelet count was 94 x 10yll, and the IVBC 1 4 . 5 x lO‘’9I with 82.5% abnormal cells. The abnormal cells were MPO and SBB-negative with a basophilic cytoplasm and prominent nucleolus. No hepatosplenomegaly was observed. Blood serum lactic dehydrogenase ~ v a selevated to 870 L:I (normal range 1 1 0 - 3 3 0 ) . The leukaeniic cells were separated from heparinized whole blood by a density-gradient technique (Ficollisodium metrizoate). Monoclonal antibodies corresponding to each CI1 (Cluster of Differentiation) number as stated belolv Lvere obtained either commercially or through the courtesy of Ortho Diagnostic Systems K.K. (Tokyo). Japan Scientific Instruments (Tokyo). Cosmo Bio (Tokyo) and Professor H. Shiku (Nagasaki ITniversity). hlonoclonal antibodies ( H 1 , HZ against H-KAS oncogene products were made by us. Cellsurface antigens were analysed by means of a fluorescenceactivated cell sorter (FACS 117. utilizing a panel of monoclonal antibodies as described previously (Imamura et r t l . 1988. 1990). A majority of the cells from the peripheral blood and bone marrow coexpressed the antigens against monoclonal antibodies. C l l l l . CDl 3 , C1113. C1133. CD34. CD38. Ia(HLA-1)K) and CD71. but did not express the antigens against CD1. CD2. C I H . CD4, CI>5. C D i , CD19. U 2 0 . CU21. CD1.2, CD25. Cl15h. C D 5 i and TCR rip. Surface immunoglobulins (Smlghl. igG, IgA. IgD. K and j . ) were not detected. No association tvith human T-cell leukaemia virus1 (HTLY-1 ) Lvas found by means of electron microscopic studies or the application of monoclonal antibodies to p l 9 a n d p 2 3 of HTI.1’-1. By means of two-colour fluorescence. it was clearly demonstrated that the leukaemic cells possessing C’I) 3 3 in the peripheral blood and bone niarrow coexpressed CIl 34. The diagnosis of Abll.-!vlO was confirmed by the detection of MPO protein in the cytoplasm of leukaemic cells by thc indirect irninunofltroresce~~ce test utilizing anti-MPO monoclonal antibodies.
The expression of RAS oncogenes was analysed by a fluorescence-activated cell sorter with a panel of MAbs. The high expression of UWP. which was reported to recognize activated KAS oncogene (Carney rt nl. 1986).was found in this patient. and was associated with high H-KAS expression (Fig 1.A). These facts prompted us to analyse the DNA sequence of RAS genes by an automated DNA sequencer (Applied Biosystems Inc.. 373A. Calif.. 1J.S.A.). I-nexpectedly. as shown in Fig 1R. various H-KAS point mutations were found including a hot spot point mutation at codon 12. whereas the K-KAS point mutation, which is different from the codons 12. 1 3 and 61 (no hot spot point mutation). was only found on three sites (Fig 1C). N o point mutation in exons 5-8 of the p53 suppressor oncogene was detected. whereas leukaemic cells had chromosome abnormality. i(1 i q ) . at no. 1 7 where the p53 gene is located. Almost normal levels of p5 3 gene expression were found by FACS analysis in agreement with DNA analysis. So far we have found two cases of p53 gene point mutation out of six patients with AM.. KAS oncogenes encode 21 kl) proteins (p21) that are associated with the inner plasma membrane, bind guanine nucleotides. and possess GTPase activity (Barbacid, 1987), which is presumably activated by binding to a recently described cytosolic protein termed GAP (for GTPase activating protein). Oncogenic forms of p21 that are capable of transforming cultured rodent cells in vitro usually result from single amino acid substitutions at one of a few critical regions in the protein. At least some of these mutations are believed to act by reducing the intrinsic GTPase activity of the protein, as well as its activation by GAP. These mutations have been detected it7 v i w in either codon 12 or 6 1 of any of the three RAS genes or in codon 1 3 of the N-RAS gene a t frequencies ranging from 10%to 90%. depending on both the type of tumour and the methods used to detect these mutations (Bos. 1988). To our knowledge. there is n o report concerning H-RAS point mutation in human leukaemias and lymphomas. On the basis of these findings, we suggest that H-KAS point mutation together with p i 3 gene mutation may play an important role in leukaemogenesis. Incidence of RAS oncogene point niutations in patients with AML-MO remains to be elucidated.
Case Reports
British Journal of Haernatology, 1992, 82 A C K N 0W LEDG MEN T S
A
inax.
Control
I:
L
a8
777
The authors thank Ms H. Ota and Ms T. Hayashi for technical assistance, Ms H. Sumida for typing the manuscript, and Professor H. Shiku (Nagasaki University), Ortho Diagnostic Systems K.K. (Tokyo), Japan Scientific Intrument Co. (Tokyo), and Pujisawa Pharmaceutical Co. (Osaka) for providing monoclonal antibodies.
DWP
1
n E
t
Department of Internal Medicine, Research Institute for Nuclear Medicine and Biologg, Hiroshima University. 1-2-3 Kasumi. Minami-ku, Hiroshima 734, Iapari
8
NOBUTAKA IMAMITRA ATSIJSHIKIJRAMOTO
0
250
REFERENCES
Intensity(log1
Fluor-
Barbacid, M. (1987) ras genes. Annual Review of Hiochemistr!\. 56. 779-82 7 . C-Ha-ras- I Bennett, J.M., Catovsky. D.. Daniel. M-T.. Flandrin. G., Galton. Exon I D.A.G.. Cralnick. H.R. & Sultan. C. (1991) Proposal for the 10 II 12 13 15 recognition of minimally differentiated acute myeloid leukaemia A~'~~AC(~CA~TA~'AAGCTCCTGCTGGTGGGCCCCG~GTCGGCAACA~TCCCCTGA~CATCCA~CTCA'~C (AML-MU). British ]ournal of Haernatology. 78, 32 5-329. C Bos. J.L. (19 8 8 ) The ras gene family and human carcinomogenesis. CACAACCATTTTGTGGACGAATACGACCCCACTATAGAG Mutation Research, 195, 255-271. Carney. W.P.. Petit, D.. Hamer. P., Der. C.J.. Finkel. T.. Cooper, G.M.. Exon 2 61 Lefebvre, M.. Mobtaker. H., Deiellis. R.. Tischler. AS., Dayal. Y., GATTCCTACCGGAAGCAGGTGGTCATTGATGGGGAGACGTGCCTGTTGGACATCCTGGATACCGCCG~C~ Wolfe, H. & Kabin. H. (1986)Monoclonal antibody specific for an A A activated RAS protein. Proceedings of the Nationiil Actidenug of GAGGAGTACAGCGCCATGCGGGACCAGTACAT~CGCACCGGGGAGGGCTTCCTGTGTGTG~TGCCATCAAC Sciences of the United States ofdrneriru. 8 3 , 7485-7489. t 4 T A T Imamura, N.. Kusunoki, Y.. Kawa-Ha. K.. Yumura. K., Hara, 1.. Oda. AACACCAAGTCTTTTGAGGACATCCACCAGTACAG K., Abe. K.. Dohy. H.. Inada. T.. Kajihara, H. & Kuramoto. A. ( 1990) Aggressive natural killer cell leukaemia/lymphoma: report of four cases and review of the literature. Possible existence of a c-Ki-ras-2 C new clinical entity originating from the third lineage of lymphoid cells. British l o i h a l of Haernatology. 75, 49-59. Exon I 12 13 Imamura. N.. Tanaka, R., Kajihara. H. & Kuramoto. A. ( 1 9 8 8 ) ATGACTGAATATAAACTTCTGGTAGTTGGAGCT~G'rAGGCAAGAGTCCCTTCACGATACAIiCTAATT Analysis of peroxidase negative acute unclassifiable leukemias by monoclonal antibodies. 1. Acute myelogenous leukemia and acute CAGAATCATTTTGTGGACGAATATGATCCAACAATAGAG myelomonocytic leukemia. European ]ourrial of H u t ~ i i i t o / o p 41, ~. 420-428.
B
:: t
z
t
t
A
Exon 2 61 GATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGT~ GAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAAT
A AATACTAAATCA+TTGAAGATATTCACCATTATAG
Fig 1 . (A)High expression of RAS p2 1, H-RAS and DWP was found in a case of acute myelogenous leukaemia (AML-MO)by FACS analysis. (B)and (C) DNA sequences of H-RAS (B) and K-RAS (C) oncogenes in this case by DNA sequencer. Arrows show point mutation.
