13
Inf J Gynecol Obsret, 1992, 37: 13-18 International Federation of Gynecology
and Obstetrics
Detection of human papillomavirus types 16 and 18 in the exfoliated cervical cells using the polymerase chain reaction A. Nakazawa, Department
M. Inoue,
of Obstetrics
J. Saito, T. Sasagawa,
and Gynecology,
(Received October 5th, 1990) (Revised and accepted January
23rd,
Osaka University
Medical School, Osaka (Japan)
1991)
Abstract We applied the polymerase chain reaction (PCR) to detect HPV 16 and 18 in cytological samples obtained from the uterine cervices of Japanese women. HPV infection was detected in 17 (2X%) of 67 with UN and I1 (37’S) of 30 with cervical carcinoma. It is notable that II (16%) of 69 women with normal cervices were infected with either HPV 16 or 18. The polymerase chain reaction is sensitive and useful for epidemiological studies.
Keywords: Human papillomavirus; Exfoliated cervical’ cells; Squamous cell carcinoma; Subclinical HPV infection; Polymerase chain reaction. Introduction
Up to the present time, more than 60 distinct types of human papillomaviruses (HPVs) have been identified, and some of them have been found to be closely associated with anogenital carcinomas [24,25]. HPV types 16 and 18 are most commonly found in cervical carcinomas, their precursors (cervical intraepithelial neoplasias), and cervical carcinoma-derived cell lines [2,3,12]. In addi0020-7292j92603.50 0 1992 International Federation Published and Printed in Ireland
G. Ueda and 0. Tanizawa
tion, recent molecular biological research work showed that open reading frame E7 or E6 of HPVs 16 and 18 encodes a transforming gene for rodent cells [ 1,8,16] as well as human keratinocytes [5,11]. Thus, the presence of HPV 16 or HPV 18 appears to be a major risk factor for the development of cervical carcinoma. Therefore, identification of those HPV DNAs in routine clinical samples is very important for understanding HPV infection and its role in carcinogenesis. However, current methods of HPV detection such as imfilter of HPV antigen, munodetection hybridization (Southern blot) and in situ hybridization of HPV DNA are cumbersome in practical medicine [9,13,18]. These circumstances prompted us to use the new in vitro gene amplification technology, i.e., the polymerase chain reaction (PCR), which enables detection of specific DNA sequences rapidly, sensitively, and specifically in routinely processed clinical materials [ 14,171. Materials and methods
Samples of exfoliated cervical cells were obtained from the uterine ectocervix of 169 patients who visited the outpatient clinic of the Department of Obstetrics and Gynecology, Osaka University Medical School from February to November, 1989. The diagnosis Article
of Gynecology
and Obstetrics
14
Nakazawa
of these patients was carried out by routine of colposcopyexamination histological directed punch-biopsy specimen or cytologic analysis. There were 69 normal cases, three 67 cervical intracervical condylomas, epithelial neoplasias (CIN) and 30 invasive squamous cell carcinomas. The age distribution of these patients is summarized in Table 1. All patients were Japanese living in Kansai district, in the midwest region of Japan. The exfoliated cells obtained with a cotton-tipped swab from the ectocervix were resuspended in 2 ml of phosphate-buffered saline (PBS, pH 7.2), and stored at -20°C until DNA extraction. Samples were digested overnight with 100 pg/ml proteinase K in 50 mM Tris-HCl buffer (pH 8.2) containing 10 mM EDTA and 2% sodium dodecyl sulfate at room temperature. Cellular DNA was collected by precipitation with ethanol after three extractions using phenol and chloroformisoamyl alcohol (24:1), as previously described [lS]. The polymerase chain reaction (PCR) was performed to generate amplified fragments surrounding the E6 open reading frames of both HPV 16 and 18. Primers used were 5’ATTAGTGAGTATAGACATTA3 ’ (Hl), 5’GGCTTTTGACAGTTAATACA3’ (H2), ’ and 5 ‘GGTTTCTGGCACCGCAGGCA3 (H3). Hl and H2 correspond to the nucleotide positions (np) 320-339 and 410429 of HPV 16, respectively. Hl and H3 correspond
Table 1.
The age distribution
Age (years)
of patients
tested.
Diagnosis Normal
Condyloma
GIN”
CCb
lo-19 2629
0 9
0 3
2 II
I
3&39 4&49 5&59 6c-
21 19 15 5
0 0 0 0
26 19 6 3
4 I 10 8
Total
69
3
67
30
“Cervical blnvasive
intraepithelial neoplasia. carcinoma of the cervix
Int J Gynecol Obstet 37
to np 328-347 and 418437 of HPV 18, respectively [17]. The reaction mixture containing 1 pg of sample DNA, 1 pg of each primer, and 200 PM each of dATP, dGTP, dCTP and dTTP in 100 mM Tris-HCl buffer (pH 8.2) was denatured for 5 min at 95°C followed by the addition of 2.5 units of Taq polymerase. One cycle of PCR consists of denaturation at 94°C for 1 min, reannealing at 55°C for 2 min and polymerization at 72°C for 1 min 30 s. After repeating 25 cycles of PCR, the amplified DNAs were electrophoresed in 1.5% agarose gel and stained with ethidium bromide. Moreover, to confirm the speciticity, they were transferred onto a nylon filter and hybridized with a “2P-labeled oligomer probe specific for E6 of HPV 16 (H4; 5 ‘ATGGAACAACATTAGAACAGCAATACAACAAACCGTTGTG3’) or HPV 18 (H5; 5 ‘ATGGAGACACATTGGAAAAACTAACTAACACTGGGTTATA3 ‘) by the Southern blot method. CaSki cells were used as the positive control for HPV 16 and the negative control for HPV 18, respectively. Similarly, HeLa cells served as the negative control for HPV 16 and the positive control for HPV 18. Results Figure 1 shows the results of the gel electrophoresis and Southern blot hybridization for PCR products. The PCR products amplified with two primers (Hl and H2) specific for HPV 16 (lane a) or two primers (Hl and H3) specific for HPV 18 (lane b) were observed as a specific band of the expected size (109 bp) in the gels stained with ethidium bromide. No band was detected in lane CASK1 b or HELA a, which were used as negative controls, while the positive controls showed a single band at 109 bp in lanes CASK1 a and HELA b (Fig. 1, row A). However, some bands were observed apart from 109 bp in lane 2b, lane 3b and HELA-b. To confirm the specificity, hybridization was performed with 32P-labeled oligonucleotide probe H4 or H5. As shown in Fig. 1, row B,
HP V detection with PCR
1
2
3
ab
ab
ab
15
CASKI HELA
ab
ab
M ,632 bp
-I
2%:: =;;;g -15
Fig. 1. Detection of HPV 16 and 18 in cervical scraped samples. Row A: primers specific for HPV 16 (lane a) and HPV 18 (lane b). Row 9: Southern each corresponding to HPV I6 (lane a) and HPV I8 (lane b). Col. I: HPV Case positive for both HPV I6 and 18. CASKI: CaSki cell line positive for M: DNA size marker,
Hinf-I
Table 2. Distribution of human histopathological diagnosis.
the primer for with a probe or 18 (lane b), react with each with ethidium
papillomavirus
PCR positive
(n)
HPV I6 alone
(69) (3)
CIN 67) I(l7) II (13) III (37) Invasive squamous carcinoma (30) “Human
cell
papillomavirus
DNA positive
bromide were not hybridized. Thus, a single band observed at 109 bp could be considered specific. The results of the present study are summarized in Table 2. The PCR method showed
types I6 and 18 detected
Histopathologic diagnosis
Condyloma
Gel electrophoresis of DNA amplified by PCR using blot hybridization of the amplified DNA with probes l6-positive case. Col. 2: HPV I8-positive case. Col. 3: HPV 16. HELA: HeLa cell line positive for HPV 18.
digest of PBR-322.
PCR products amplified with HPV 16 or 18 were hybridized specific for HPV 16 (lane a) respectively, but did not cross other. Several bands stained
Normal
bP
in exfoliated
cells from the uterine cervix on the basis of
for HPV 18 alone
Both HPV I6
Either HPV I6
and I8
and 18 (‘l/u)
6
4
1
11 (16)”
0
0
0
0 (0)”
13 2 2 9
4 3 0 I
0 0 0 0
I7 5 2 10
7
3
1
II (37)”
cases/total
(25)” (29)” (15)” (27)”
cases tested. Article
16
Nakazawa
et al.
infection by either HPV 16 or 18 in none of 3 patients with cervical condylomas, 17 (25%) of 67 with cervical intraepithelial neoplasias (CINs) and 11 (37%) of 30 with invasive squamous cell carcinomas of the cervix. Interestingly, HPV infection was detected in 11 (16%) of 69 women with no pathological lesions of the cervix, vagina or vulva. Ages of these 11 patients were distributed from 21 to 55 years as follows; 2 patients in the 20-29-year-old group, 4 in the 30-39-yearold group, 3 in the 40-49-year-old group and 2 in the XL-59-year-old group. Double infection by HPV 16 and 18 was found in one normal woman and one patient with invasive carcinoma. Discussion Although several methods for detecting HPV DNA in clinical samples have been developed, they have some disadvantages in clinical application from the aspects of sensitivity and handling [9,13,18], and they may underestimate the prevalence of infection. Therefore, development of an improved method for detecting HPV DNA in clinical samples is essential for the performance of valid epidemiological studies. The PCR method is a rapid, automatable, and highly sensitive gene amplification technology for detecting specific DNA sequences in a small amount of DNA [ 14,171. The sensitivity of our PCR assay is such that 20 viral copies per sample can be detected, which means that PCR is at least tenfold more sensitive than Southern blotting [17]. In addition to the easy and highly sensitive method of gene amplification technology, the running cost and equipment for PCR are not so expensive as we may consider. If we synthesize primers by ourselves, the cost per case is estimated to be less than US$lO. The PCR method enabled us to detect HPV DNA easily and rapidly in cytological samples from many patients. However we must pay much attention to avoiding false
Inr J Gynecol Obsret 37
positives with PCR [6]. To avoid contamination, we must prevent the physical transfer of DNA between amplified samples, and between positive and negative controls. We used autoclaved disposable pipette tips, microcentrifuge tubes, deionized water and buffer solutions. All reagents used in the PCR are prepared and stored in an area far from PCR amplified products. Furthermore, we used disposable gloves and changed them in order to avoid transfer of amplified DNA. When we pipetted samples, we are very careful to avoid splashes. Sample DNA was added after all components were prepared. When amplified, we included negative and positive samples as controls with each set of amplifications. In this manner, we confirm that there were no false negatives or false positives. The present study showed the presence of either HPV 16 or 18 in one-third of Japanese patients with CIN or invasive squamous cell carcinoma, findings which correspond well with the results using Southern blot analysis in Japanese women [15,20]. Recent reports from the United Kingdom using the PCR method in exfoliated cells of the uterine cervix showed a high incidence of HPV infections; more than 90% of patients with cytological abnormalities were infected with HPV 16 [ 19,211. The low incidence of HPV infection detected in the present study is not surprising because Southern blot analysis has shown a lower incidence in Japanese [ 15,201 than in the people of Western countries [4,24,25]. The precise origin of this discrepancy is not known, although differences in HPV types, geography, sexual habits, or race may be involved. Routine cervical cytologic examination alone is inadequate for diagnosing cervical HPV infection. HPV DNA sequences have been detected by Southern blot assay in around 20% of the random population with normal PAP smears and normal colposcopic examinations [9,7,23]. Similarly, a report from Australia showed latent HPV infection by PCR assay in one-third of normal females
I7
HPV detection with PCR
[lo]. Two recent reports from the United Kingdom using the PCR technique showed HPV 16 DNA in about 80% of women with a normal cervix [ 19,2 11. We detected HPV 16 or 18 in 16% of Japanese women with normal cervical cytology. Those women with subclinical HPV infection are now being closely followed by cytologic and colposcopic examinations. Despite the recent accumulation of findings suggesting a close association between HPV and cervical cancers, the natural history of HPV infection is still unclear. A prospective surveillance study of HPV infection using a sensitive and convenient method such as PCR will enable us to better understand the role of HPV in the oncogenesis of the uterine cervix.
IO
II
I2
13
I4
HPV I6 DNA in normal and malignant cervical epithelium: implication for the aetiology and behavior of cervical neoplasia. Lancet i: 703, 1987. Morris BJ, Flanagan JL, McKinnon KJ, Nightingale BN: Papillomavirus screening of cervical lavages by polymerase chain reaction. Lancet ii: 1368, 1988. Munger K, Phelps, WC, Bubb V, Howley PM. Schlegel R: The E6 and E7 genes of the human papillomavirus type I6 together are necessary and sufftcient for transformation of primary human keratinocytes. J Virol 63: 4417, 1989. Munoz N, Bosch X, Kaldor JM: Does human papillomavirus cause cervical cancer? The state of the epidemiological evidence. Br J Cancer 57: I, 1988. Nuovo GJ, Richart RM: A comparison of slot blot, southern blot, and in situ hybridization analysis for human papillomavirus DNA in genital tract lesions. Obstet Gynecol 74: 673, 1989. Saiki RK, Scharf S, Faloona F: Enzymatic amplification of P-globin genomic sequences and restrictidan site analysis for diagnosis of sickle cell anemia. Science 230: 1350, 1985.
I5
Saito J, Yutsudo M, lnoue M, Ueda G, Tanizawa 0, Hakura A: New human papillomavirus sequences in female genital tumors from Japanese patients. Jpn J Cancer Res 78: 1081, 1987.
Bedell MA, Jones KH, Laimins, LA: The E&E7 region of human papillomavirus type I8 is sufficient for transformation of NIH 3T3 and rat-l cells. J Virology 61: 3635, 1987.
I6
Schneider-Gadickle A, Schwarz E: Different human cervical carcinoma cell lines show similar transcription patterns of human papillomavirus type I8 early genes. EM90 J 5. 2285, 1986.
Boshart M, Gissmann L. Ikenberg H, Kleinheinz A, Hausen H: A new type of Scheurlen W, zur papillomavirus DNA, its presence in genital cancer biopsies and in cell lines derived from cervical cancer. EM90
I7
I8
Shibata DK, Arheim N, Martin WJ: Detection of human papillomavirus in paraffm-embedded tissue using the polymerase reaction. J Exp Med 167: 225, 1988. Stoler MH, Broker TR: In situ hybridization detection of
I9
human papillomavirus DNAs and messenger RNAs in genital condyloma and a cervical carcinoma. Hum Pathol 17: 1250, 1986. Tidy JA, Parry CC, Ward P, Coleman DV, Peto J,
References
J 3: 1151, 1984. Durst M, Gissmann L, Ike&erg H, zur Hausen H: A papillomavirus DNA from a cervical carcinoma and its prevalence in cancer biopsy samples from different geographic regions. Proc Natl Acad Sci USA 80: 3812, 1983. Gissmann L, Schneider A: Human papillomavirus DNA in preneoplastic and neoplastic genital lesions. Banbury
20
Rep 21: 217, 1986. Kaur P, McDougall JK: HPV-I8 immortalization of human keratinocytes. Virology 173: 302, 1989. Kwok S, Higuchi R: Avoiding false positives with PCR. Nature 339: 237, 1989. Lorincz AT, Temple GF, Patterson JA, Jenson AB, Kurman RJ, Lancaster WD: Correlation of cellular atypia and human papillomavirus deoxyribonucleic acid sequences in exfoliated cells of the uterine cervix. Obstet Gynecol 68: 508, 1986. Matlashewski G, Schneider J. Branks L, Jones N, Murray A, Crawford L: Human papillomavirus type I6 DNA
21
cooperates with activated ras in transforming primary cells. EM90 J 6: 1741, 1987. Meanwell CA, Cox MF, Blackledge G, Maitland NJ:
23
22
Malcolm ADB, Farrell PJ: High rate of human papillomavirus types I6 infection in cytologically normal cervices. Lancet i: 434, 1989. Yoshikawa H, Matsukura T, Yamamoto E, Kawana T, K: Occurrence of human Mizuno M, Yoshiike papillomavirus types I6 and I8 DNA in cervical carcinomas from Japan: age of patients and histological type of carcinomas. Jpn J Cancer Res 76: 667, 1985. Young LS, Bevan IS, Johnson MA, Blomtield PI, Bromidge T, Maitland NJ, Woodman CBJ: The polymerase chain reaction: a new epidemiologic tool for investigating cervical human papillomavirus infection. Br Med J 298: 14, 1989. Yutsudo M, Okamoto Y, Hakura A: Functional dissociation of transforming genes of human papillomavirus type 16. Virology 166: 594, 1988. Villiers EM, Wagner D, Schneider A: Human papillomavirus infection in women with and without abnormal cervical cytology. Lancet ii: 703, 1987.
Article
18 24 25
Nakazowa zur Hausen
H: Papillomaviruses
in human cancer.
Cancer
59: 1692. 1987. zur Hausen H: Papillomaviruses in anogenital cancer as a model to understand the role of viruses in human cancer. Cancer Res 49: 4677, 1989.
Int J Gynecol Obstet 37
Address for reprints: A. Nakazawa Department of Obstetrics and Gynecology Osaka University Medical School l-1-50, Fukushima-ku Osaka 553, Japan
Inf J Gynecol Obsret, 1992, 37: 13-18 International Federation of Gynecology
and Obstetrics
Detection of human papillomavirus types 16 and 18 in the exfoliated cervical cells using the polymerase chain reaction A. Nakazawa, Department
M. Inoue,
of Obstetrics
J. Saito, T. Sasagawa,
and Gynecology,
(Received October 5th, 1990) (Revised and accepted January
23rd,
Osaka University
Medical School, Osaka (Japan)
1991)
Abstract We applied the polymerase chain reaction (PCR) to detect HPV 16 and 18 in cytological samples obtained from the uterine cervices of Japanese women. HPV infection was detected in 17 (2X%) of 67 with UN and I1 (37’S) of 30 with cervical carcinoma. It is notable that II (16%) of 69 women with normal cervices were infected with either HPV 16 or 18. The polymerase chain reaction is sensitive and useful for epidemiological studies.
Keywords: Human papillomavirus; Exfoliated cervical’ cells; Squamous cell carcinoma; Subclinical HPV infection; Polymerase chain reaction. Introduction
Up to the present time, more than 60 distinct types of human papillomaviruses (HPVs) have been identified, and some of them have been found to be closely associated with anogenital carcinomas [24,25]. HPV types 16 and 18 are most commonly found in cervical carcinomas, their precursors (cervical intraepithelial neoplasias), and cervical carcinoma-derived cell lines [2,3,12]. In addi0020-7292j92603.50 0 1992 International Federation Published and Printed in Ireland
G. Ueda and 0. Tanizawa
tion, recent molecular biological research work showed that open reading frame E7 or E6 of HPVs 16 and 18 encodes a transforming gene for rodent cells [ 1,8,16] as well as human keratinocytes [5,11]. Thus, the presence of HPV 16 or HPV 18 appears to be a major risk factor for the development of cervical carcinoma. Therefore, identification of those HPV DNAs in routine clinical samples is very important for understanding HPV infection and its role in carcinogenesis. However, current methods of HPV detection such as imfilter of HPV antigen, munodetection hybridization (Southern blot) and in situ hybridization of HPV DNA are cumbersome in practical medicine [9,13,18]. These circumstances prompted us to use the new in vitro gene amplification technology, i.e., the polymerase chain reaction (PCR), which enables detection of specific DNA sequences rapidly, sensitively, and specifically in routinely processed clinical materials [ 14,171. Materials and methods
Samples of exfoliated cervical cells were obtained from the uterine ectocervix of 169 patients who visited the outpatient clinic of the Department of Obstetrics and Gynecology, Osaka University Medical School from February to November, 1989. The diagnosis Article
of Gynecology
and Obstetrics
14
Nakazawa
of these patients was carried out by routine of colposcopyexamination histological directed punch-biopsy specimen or cytologic analysis. There were 69 normal cases, three 67 cervical intracervical condylomas, epithelial neoplasias (CIN) and 30 invasive squamous cell carcinomas. The age distribution of these patients is summarized in Table 1. All patients were Japanese living in Kansai district, in the midwest region of Japan. The exfoliated cells obtained with a cotton-tipped swab from the ectocervix were resuspended in 2 ml of phosphate-buffered saline (PBS, pH 7.2), and stored at -20°C until DNA extraction. Samples were digested overnight with 100 pg/ml proteinase K in 50 mM Tris-HCl buffer (pH 8.2) containing 10 mM EDTA and 2% sodium dodecyl sulfate at room temperature. Cellular DNA was collected by precipitation with ethanol after three extractions using phenol and chloroformisoamyl alcohol (24:1), as previously described [lS]. The polymerase chain reaction (PCR) was performed to generate amplified fragments surrounding the E6 open reading frames of both HPV 16 and 18. Primers used were 5’ATTAGTGAGTATAGACATTA3 ’ (Hl), 5’GGCTTTTGACAGTTAATACA3’ (H2), ’ and 5 ‘GGTTTCTGGCACCGCAGGCA3 (H3). Hl and H2 correspond to the nucleotide positions (np) 320-339 and 410429 of HPV 16, respectively. Hl and H3 correspond
Table 1.
The age distribution
Age (years)
of patients
tested.
Diagnosis Normal
Condyloma
GIN”
CCb
lo-19 2629
0 9
0 3
2 II
I
3&39 4&49 5&59 6c-
21 19 15 5
0 0 0 0
26 19 6 3
4 I 10 8
Total
69
3
67
30
“Cervical blnvasive
intraepithelial neoplasia. carcinoma of the cervix
Int J Gynecol Obstet 37
to np 328-347 and 418437 of HPV 18, respectively [17]. The reaction mixture containing 1 pg of sample DNA, 1 pg of each primer, and 200 PM each of dATP, dGTP, dCTP and dTTP in 100 mM Tris-HCl buffer (pH 8.2) was denatured for 5 min at 95°C followed by the addition of 2.5 units of Taq polymerase. One cycle of PCR consists of denaturation at 94°C for 1 min, reannealing at 55°C for 2 min and polymerization at 72°C for 1 min 30 s. After repeating 25 cycles of PCR, the amplified DNAs were electrophoresed in 1.5% agarose gel and stained with ethidium bromide. Moreover, to confirm the speciticity, they were transferred onto a nylon filter and hybridized with a “2P-labeled oligomer probe specific for E6 of HPV 16 (H4; 5 ‘ATGGAACAACATTAGAACAGCAATACAACAAACCGTTGTG3’) or HPV 18 (H5; 5 ‘ATGGAGACACATTGGAAAAACTAACTAACACTGGGTTATA3 ‘) by the Southern blot method. CaSki cells were used as the positive control for HPV 16 and the negative control for HPV 18, respectively. Similarly, HeLa cells served as the negative control for HPV 16 and the positive control for HPV 18. Results Figure 1 shows the results of the gel electrophoresis and Southern blot hybridization for PCR products. The PCR products amplified with two primers (Hl and H2) specific for HPV 16 (lane a) or two primers (Hl and H3) specific for HPV 18 (lane b) were observed as a specific band of the expected size (109 bp) in the gels stained with ethidium bromide. No band was detected in lane CASK1 b or HELA a, which were used as negative controls, while the positive controls showed a single band at 109 bp in lanes CASK1 a and HELA b (Fig. 1, row A). However, some bands were observed apart from 109 bp in lane 2b, lane 3b and HELA-b. To confirm the specificity, hybridization was performed with 32P-labeled oligonucleotide probe H4 or H5. As shown in Fig. 1, row B,
HP V detection with PCR
1
2
3
ab
ab
ab
15
CASKI HELA
ab
ab
M ,632 bp
-I
2%:: =;;;g -15
Fig. 1. Detection of HPV 16 and 18 in cervical scraped samples. Row A: primers specific for HPV 16 (lane a) and HPV 18 (lane b). Row 9: Southern each corresponding to HPV I6 (lane a) and HPV I8 (lane b). Col. I: HPV Case positive for both HPV I6 and 18. CASKI: CaSki cell line positive for M: DNA size marker,
Hinf-I
Table 2. Distribution of human histopathological diagnosis.
the primer for with a probe or 18 (lane b), react with each with ethidium
papillomavirus
PCR positive
(n)
HPV I6 alone
(69) (3)
CIN 67) I(l7) II (13) III (37) Invasive squamous carcinoma (30) “Human
cell
papillomavirus
DNA positive
bromide were not hybridized. Thus, a single band observed at 109 bp could be considered specific. The results of the present study are summarized in Table 2. The PCR method showed
types I6 and 18 detected
Histopathologic diagnosis
Condyloma
Gel electrophoresis of DNA amplified by PCR using blot hybridization of the amplified DNA with probes l6-positive case. Col. 2: HPV I8-positive case. Col. 3: HPV 16. HELA: HeLa cell line positive for HPV 18.
digest of PBR-322.
PCR products amplified with HPV 16 or 18 were hybridized specific for HPV 16 (lane a) respectively, but did not cross other. Several bands stained
Normal
bP
in exfoliated
cells from the uterine cervix on the basis of
for HPV 18 alone
Both HPV I6
Either HPV I6
and I8
and 18 (‘l/u)
6
4
1
11 (16)”
0
0
0
0 (0)”
13 2 2 9
4 3 0 I
0 0 0 0
I7 5 2 10
7
3
1
II (37)”
cases/total
(25)” (29)” (15)” (27)”
cases tested. Article
16
Nakazawa
et al.
infection by either HPV 16 or 18 in none of 3 patients with cervical condylomas, 17 (25%) of 67 with cervical intraepithelial neoplasias (CINs) and 11 (37%) of 30 with invasive squamous cell carcinomas of the cervix. Interestingly, HPV infection was detected in 11 (16%) of 69 women with no pathological lesions of the cervix, vagina or vulva. Ages of these 11 patients were distributed from 21 to 55 years as follows; 2 patients in the 20-29-year-old group, 4 in the 30-39-yearold group, 3 in the 40-49-year-old group and 2 in the XL-59-year-old group. Double infection by HPV 16 and 18 was found in one normal woman and one patient with invasive carcinoma. Discussion Although several methods for detecting HPV DNA in clinical samples have been developed, they have some disadvantages in clinical application from the aspects of sensitivity and handling [9,13,18], and they may underestimate the prevalence of infection. Therefore, development of an improved method for detecting HPV DNA in clinical samples is essential for the performance of valid epidemiological studies. The PCR method is a rapid, automatable, and highly sensitive gene amplification technology for detecting specific DNA sequences in a small amount of DNA [ 14,171. The sensitivity of our PCR assay is such that 20 viral copies per sample can be detected, which means that PCR is at least tenfold more sensitive than Southern blotting [17]. In addition to the easy and highly sensitive method of gene amplification technology, the running cost and equipment for PCR are not so expensive as we may consider. If we synthesize primers by ourselves, the cost per case is estimated to be less than US$lO. The PCR method enabled us to detect HPV DNA easily and rapidly in cytological samples from many patients. However we must pay much attention to avoiding false
Inr J Gynecol Obsret 37
positives with PCR [6]. To avoid contamination, we must prevent the physical transfer of DNA between amplified samples, and between positive and negative controls. We used autoclaved disposable pipette tips, microcentrifuge tubes, deionized water and buffer solutions. All reagents used in the PCR are prepared and stored in an area far from PCR amplified products. Furthermore, we used disposable gloves and changed them in order to avoid transfer of amplified DNA. When we pipetted samples, we are very careful to avoid splashes. Sample DNA was added after all components were prepared. When amplified, we included negative and positive samples as controls with each set of amplifications. In this manner, we confirm that there were no false negatives or false positives. The present study showed the presence of either HPV 16 or 18 in one-third of Japanese patients with CIN or invasive squamous cell carcinoma, findings which correspond well with the results using Southern blot analysis in Japanese women [15,20]. Recent reports from the United Kingdom using the PCR method in exfoliated cells of the uterine cervix showed a high incidence of HPV infections; more than 90% of patients with cytological abnormalities were infected with HPV 16 [ 19,211. The low incidence of HPV infection detected in the present study is not surprising because Southern blot analysis has shown a lower incidence in Japanese [ 15,201 than in the people of Western countries [4,24,25]. The precise origin of this discrepancy is not known, although differences in HPV types, geography, sexual habits, or race may be involved. Routine cervical cytologic examination alone is inadequate for diagnosing cervical HPV infection. HPV DNA sequences have been detected by Southern blot assay in around 20% of the random population with normal PAP smears and normal colposcopic examinations [9,7,23]. Similarly, a report from Australia showed latent HPV infection by PCR assay in one-third of normal females
I7
HPV detection with PCR
[lo]. Two recent reports from the United Kingdom using the PCR technique showed HPV 16 DNA in about 80% of women with a normal cervix [ 19,2 11. We detected HPV 16 or 18 in 16% of Japanese women with normal cervical cytology. Those women with subclinical HPV infection are now being closely followed by cytologic and colposcopic examinations. Despite the recent accumulation of findings suggesting a close association between HPV and cervical cancers, the natural history of HPV infection is still unclear. A prospective surveillance study of HPV infection using a sensitive and convenient method such as PCR will enable us to better understand the role of HPV in the oncogenesis of the uterine cervix.
IO
II
I2
13
I4
HPV I6 DNA in normal and malignant cervical epithelium: implication for the aetiology and behavior of cervical neoplasia. Lancet i: 703, 1987. Morris BJ, Flanagan JL, McKinnon KJ, Nightingale BN: Papillomavirus screening of cervical lavages by polymerase chain reaction. Lancet ii: 1368, 1988. Munger K, Phelps, WC, Bubb V, Howley PM. Schlegel R: The E6 and E7 genes of the human papillomavirus type I6 together are necessary and sufftcient for transformation of primary human keratinocytes. J Virol 63: 4417, 1989. Munoz N, Bosch X, Kaldor JM: Does human papillomavirus cause cervical cancer? The state of the epidemiological evidence. Br J Cancer 57: I, 1988. Nuovo GJ, Richart RM: A comparison of slot blot, southern blot, and in situ hybridization analysis for human papillomavirus DNA in genital tract lesions. Obstet Gynecol 74: 673, 1989. Saiki RK, Scharf S, Faloona F: Enzymatic amplification of P-globin genomic sequences and restrictidan site analysis for diagnosis of sickle cell anemia. Science 230: 1350, 1985.
I5
Saito J, Yutsudo M, lnoue M, Ueda G, Tanizawa 0, Hakura A: New human papillomavirus sequences in female genital tumors from Japanese patients. Jpn J Cancer Res 78: 1081, 1987.
Bedell MA, Jones KH, Laimins, LA: The E&E7 region of human papillomavirus type I8 is sufficient for transformation of NIH 3T3 and rat-l cells. J Virology 61: 3635, 1987.
I6
Schneider-Gadickle A, Schwarz E: Different human cervical carcinoma cell lines show similar transcription patterns of human papillomavirus type I8 early genes. EM90 J 5. 2285, 1986.
Boshart M, Gissmann L. Ikenberg H, Kleinheinz A, Hausen H: A new type of Scheurlen W, zur papillomavirus DNA, its presence in genital cancer biopsies and in cell lines derived from cervical cancer. EM90
I7
I8
Shibata DK, Arheim N, Martin WJ: Detection of human papillomavirus in paraffm-embedded tissue using the polymerase reaction. J Exp Med 167: 225, 1988. Stoler MH, Broker TR: In situ hybridization detection of
I9
human papillomavirus DNAs and messenger RNAs in genital condyloma and a cervical carcinoma. Hum Pathol 17: 1250, 1986. Tidy JA, Parry CC, Ward P, Coleman DV, Peto J,
References
J 3: 1151, 1984. Durst M, Gissmann L, Ike&erg H, zur Hausen H: A papillomavirus DNA from a cervical carcinoma and its prevalence in cancer biopsy samples from different geographic regions. Proc Natl Acad Sci USA 80: 3812, 1983. Gissmann L, Schneider A: Human papillomavirus DNA in preneoplastic and neoplastic genital lesions. Banbury
20
Rep 21: 217, 1986. Kaur P, McDougall JK: HPV-I8 immortalization of human keratinocytes. Virology 173: 302, 1989. Kwok S, Higuchi R: Avoiding false positives with PCR. Nature 339: 237, 1989. Lorincz AT, Temple GF, Patterson JA, Jenson AB, Kurman RJ, Lancaster WD: Correlation of cellular atypia and human papillomavirus deoxyribonucleic acid sequences in exfoliated cells of the uterine cervix. Obstet Gynecol 68: 508, 1986. Matlashewski G, Schneider J. Branks L, Jones N, Murray A, Crawford L: Human papillomavirus type I6 DNA
21
cooperates with activated ras in transforming primary cells. EM90 J 6: 1741, 1987. Meanwell CA, Cox MF, Blackledge G, Maitland NJ:
23
22
Malcolm ADB, Farrell PJ: High rate of human papillomavirus types I6 infection in cytologically normal cervices. Lancet i: 434, 1989. Yoshikawa H, Matsukura T, Yamamoto E, Kawana T, K: Occurrence of human Mizuno M, Yoshiike papillomavirus types I6 and I8 DNA in cervical carcinomas from Japan: age of patients and histological type of carcinomas. Jpn J Cancer Res 76: 667, 1985. Young LS, Bevan IS, Johnson MA, Blomtield PI, Bromidge T, Maitland NJ, Woodman CBJ: The polymerase chain reaction: a new epidemiologic tool for investigating cervical human papillomavirus infection. Br Med J 298: 14, 1989. Yutsudo M, Okamoto Y, Hakura A: Functional dissociation of transforming genes of human papillomavirus type 16. Virology 166: 594, 1988. Villiers EM, Wagner D, Schneider A: Human papillomavirus infection in women with and without abnormal cervical cytology. Lancet ii: 703, 1987.
Article
18 24 25
Nakazowa zur Hausen
H: Papillomaviruses
in human cancer.
Cancer
59: 1692. 1987. zur Hausen H: Papillomaviruses in anogenital cancer as a model to understand the role of viruses in human cancer. Cancer Res 49: 4677, 1989.
Int J Gynecol Obstet 37
Address for reprints: A. Nakazawa Department of Obstetrics and Gynecology Osaka University Medical School l-1-50, Fukushima-ku Osaka 553, Japan
