Brief communications

452

incidence of coronavirus shedding in normal stabled animals is well established. 3,4 Winter dysentery and calfhood coronavirus diarrhea do not coexist on susceptible farms. In fact, absence of disease in calves and youngstock below a given age, 9 months in some herds, up to 18 months in others, constitutes a criterion for the diagnosis of winter dysentery. 17 The coronavirus of winter dysentery may be antigenically related to, but different from, the calf diarrhea coronaviruses. There may be sufficient antigenic variation to preclude adults from infection with the calf diarrhea coronaviruses and to preclude calves from the winter dysentery coronavirus. Koch’s postulates remain to be fulfilled. Acknowledgements. We thank the following veterinarians for their participation by identifying herds with winter dysentery and obtaining sera: Drs. Frank Welcome, Cherry Valley, NY; Alice V. Ennis, Brooklyn, CT; Robert Olson, Middletown, CT; Howard Levine, South Woodstock, CT; William Pomper, Bolton, CT; Kenneth W. Malm, Bolton, CT; Vem Durie, Cobleskill, NY; and Charles Guard, Ithaca, NY. We thank Mr. Hans Cremers for skillful technical assistance and Ms. Sharon Edmonds for preparation of the manuscript. This research was supported by US Department of Agriculture Grant No. 89-34 116-4860 and is submitted as Scientific Contribution No. 1374, Storrs Agricultural Experiment Station, University of Connecticut, Storrs, CT 06268.

References 1. Benfield DA, Saif LJ: 1990, Cell culture propagation of a coronavirus isolated from cows with winter dysentery. J Clin Microbiol 28:1454-1457. 2. Broes A, Van Opdenbosch E, Wellemans G: 1984, Isolement d’un coronavirus chez des bovins atteints d’enterite hemorragique hivenale (winter dysentery) en Belgique. Ann Med Vet 128:299-303. 3. Collins JK, Riegel CA, Olson JD, Fountain A: 1987, Shedding of enteric coronavirus in adult cattle. Am J Vet Res 48:361-

365. 4. Crouch CF, Acres SD: 1984, Prevalence of rotavirus and coronavirus antigens in the feces of normal cows. Can J Comp Med 48:340-342. 5. Fleetwood AJ, Edwards S, Foxell PW, Thorns CJ: 1989, Winter dysentery in adult dairy cattle. Vet Ret 125:553-554.

6. Gaul SK, Simpson TF, Woode GN, Fulton RW: 1982, Antigenie relationships among some animal rotaviruses: virus neutralization in vivo and cross-protection in piglets. J Clin Microbiol 16:495-503. 7. Koopmans M: 1990, Diagnosis and epidemiology of torovirus infections in cattle. PhD Thesis, Utrecht State University, Utrecht, The Netherlands, pp. 71-82. 8. Koopmans M, Ederveen J, Woode GN, Horzinek MC: 1986, Surface proteins of Breda virus. Am J Vet Res 47: 1896-1900. 9. Koopmans M, Van den Boom U, Woode G, Horzinek MC: 1989, Seroepidemiology of Breda virus in cattle using ELISA. Vet Microbiol 19:233-243. 10. Koopmans M, Van Wuijckhuise-Sjouke L, Cremers H, Horzinek MC: 1991, Association of diarrhea in cattle with torovirus infections on farms. Am J Vet Res 52: 1769-1773. 11. Nakane PK, Pierce BG: 1967, Enzyme labelled antibodies: preparation and application for localization of antigens. J Histochem Cytochem 22: 1084-1091. 12. Pohlenz JFL, Cheville NF, Woode GN, Mokresh AH: 1984, Cellular lesions in intestinal mucosa of gnotobiotic calves experimentally infected with a new unclassified bovine virus (Breda virus). Vet Pathol 21:407-417. 13. Saif LJ: 1990, A review of evidence implicating bovine coronavirus in the etiology of winter dysentery in cows: an enigma resolved? Cornell Vet 80:303-311. 14. Saif LJ, Brock KV, Redman DR, Kohler EM: 1991, Winter dysentery in dairy herds: electron microscopic and serologic evidence for an association with coronavirus infection. Vet Rec 128:447-449. 15. Takahashi E, Inaba Y, Soto K, et al.: 1980, Epizootic diarrhea of adult cattle associated with a coronavirus-like agent. Vet Microbiol 5: 151-154. 16. Van Kruiningen HJ, Castellano VP, Torres A, Sharpee RL: 1991, Serologic evidence of coronavirus infection in New York and New England dairy cattle with winter dysentery. J Vet Diagn Invest 3:293-296. 17. Van Kruiningen HJ, Hiestand L, Hill DL, et al.: 1985, Winter dysentery in dairy cattle: recent findings. Comp on Cont Ed Pratt Vet 7:S591-S599. 18. Van Kruiningen HJ, Khairallah LH, Sasseville VG, et al.: 1987, Calfhood coronavirus enterocolitis: a clue to the etiology of winter dysentery. Vet Pathol 24:564-567.

J Vet Diagn Invest 4:452-455 (1992)

Detection of infectious bursal disease virus in digested formalin-fixed paraffin-embedded tissue sections by polymerase chain reaction C. C. Wu, T. L. Lin Infectious bursal disease (IBD) affects the bursa of Fabricius of young chickens, resulting in immunosuppression, reduced weight gain, and reduced feed efficiency9 ImmunoFrom the College of Veterinary Medicine, Mississippi State University, PO Drawer V, Mississippi State, MS 39762. Received for publication November 13, 1991.

suppression may result in poor vaccination response to other infectious agents. Despite recent advances in vaccination programs, outbreaks of this disease still occur. To help control the disease, a rapid and sensitive method for identifying IBD virus (IBDV) is essential Viral isolation, electron microscopy, immunofluorescence, immunodiffusion, viral neutralization, enzyme-linked im-

Downloaded from vdi.sagepub.com at University of Bath - The Library on June 13, 2015

Brief communications

munosorbent assay (ELISA), monoclonal antibody assay, and cDNA probes have been used for the diagnosis of IBD; however, they all have several disadvantages, such as being time consuming, labor intensive, expensive, nonspecific, and in9,10 Recently , the polymerase chain reaction (PCR) sensitive. was developed to detect small amounts of DNA sequences 3,8,12 The PCR uses 2 oligonucleotide primers to in tissues. hybridize to segments of template DNA, allowing DNA polymerase to produce more DNA by copying the template DNA lying between the 3' ends of the 2 primers. Repeated cycles of high-temperature denaturation of double-stranded DNA, annealing of the primers to the single-stranded DNA, and primer extension by the DNA polymerase produces a discrete target sequence that accumulates exponentially with each successive cycle of amplification. The PCR has been adapted to detect IBDV USDA standard challenge strain (STC) from experimentally infected fresh bursae or fecal samples.1 The objective of this study was to utilize the PCR for the detection of IBDV in routine formalin-fixed paraffin-embedded bursal tissue sections as an alternative diagnostic approach. Paraffin-embedded blocks of formalin-fixed bursae were obtained from a previous study. In that study, 20 broiler chickens with maternal antibodies to IBDV (geometric mean ELISA titer = 1,055) were orally challenged with 104.5 EID50/ ml of IBDV variant strain E at 14 days of age. Bursae were evaluated 5 days after challenge. For microscopic examination, bursae were fixed in 10% neutral buffered formalin for 18 hours and processed into paraffin-embedded blocks by routine methods at room temperature. Grossly, bursae appeared markedly small. Microscopically, there was marked diffuse lymphoid atrophy in each bursa. Variant strain E virus was isolated from the bursa of each challenged chicken and was further confirmed by viral neutralization test. Five broiler chickens not challenged with IBDV served as controls. Paraffin-embedded blocks were stored at room temperature for 2 months until processed for PCR. Twenty blocks of infected bursae and 5 blocks of control bursae, 1 from each bird, were used. Five 6-µm sections were cut from each block of infected or control bursae and then were further cut into smaller fragments with razor blades. Bursae were deparaffinized with xylene (4 changes of 3 minutes each) and absolute alcohol (2 changes of 3 minutes each) and rehydrated with water (2 changes of 3 minutes each) at room temperature. Tissues were spun down by a microfuge between each change. Bursae were resuspended in 1 ml of 0.1 M ethylenediaminetetraacetic acid (EDTA) plus 0.2 M Tris-HC1 (pH 8.5). Double-stranded IBDV RNA was either purified from the tissue by a lengthy procedure modified from Davis et al. followed by a differential LiCl precipitation method1,2 or prepared in a crude tissue extract by a rapid digestion method modified from Higuchi’s protocol. 1,5 For purification, the tissue was treated with proteinase K (500 &ml), sodium dodecyl sulfate (1%), and diethyl pyrocarbonate (0.2%) for 3 hours. The nucleic acids were precipitated by ammonium acetate and subsequently by ethanol overnight. Doublestranded IBDV RNA was separated from host nucleic acid by adding 8 M LiCl to produce a final concentration of 4 M. Following a 4 C incubation for at least 8 hours, the doublestranded RNA was pelleted by centrifugation and then resuspended in TE buffer (10 mM Tris-HCl, 1 mM EDTA [pH

453

7.41). To allow rapid extraction, the tissue was freeze-thawed twice followed by centrifugation at 6,000 x g for 1 minute. Forty-five microliters of the supernatant was added to 5 µ1 of a 10x modified cDNA buffer (0.5 M Tris [pH 8.31, 0.75 M KCl, 30 mM MgC12, 100 mM dithiothreitol [DTT], 1 mg/ ml proteinase K, 4.5% Tween 20). The mixture was incubated at 55 C for 1.5 hours and then at 95 C for 10 minutes. A pair of primers that specify a 351 -base-pair (bp) sequence of IBDV genome was selected from the published cDNA sequence of the large segment genome of the strain STC.6 Their sequences are as follows: 5'ACAATCACACTGTTCTCAGCC3' (downstream primer) and 5'ATAGTTGCCACCGTGGATCG3' (upstream primer).a For firststranded cDNA synthesis, purified IBDV RNA (4 ng) or crude tissue extract (4 µ1) was mixed with 1 of 3 primers (30 ng): random hexanucleotides,b downstream primer, or upstream primer. The mixture was added to cDNA buffer (50 mM Tris-HC1 [pH 8.31, 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 0.5 mM deoxynucleoside triphosphates [dNTPs]) and 200 units (1 µ1) of Maloney Murine leukemia virus reverse transcriptase.c The reaction mixture was incubated at 37 C for 1 hour, then an additional 1 µ1 of the reverse transcriptase was added and incubated for another 30 minutes. The PCR was performed using the procedures according to Saiki et al. 11 Briefly, 5 µ1 of the cDNA reaction mixture was mixed with 1 µ1 (5 units) of Taq DNA polymerase, d 1 µ1 of upstream and downstream primers at a concentration of 300 ng/µl each, 50 mM Tris-HC1 (pH 9.0), 50 mM KCl, 7.5 mM MgCl2, 0.2 mM of each dNTP, 0.5% Triton X- 100, and 0.01% gelatin in a final volume of 100 µ1. The reaction mixture was subjected to 30 cycles of amplification in a programmable thermal cyclere: 1 minute at 94 C for denaturation, 1 minute at 50 C for annealing, and 3 minutes at 70 C for primer extension. Twenty microliters of the PCR product was electrophoresed on a 4% polyacrylamide gel (50 volts for 1 hour) and stained with ethidium bromide for visualization of amplified DNA. The PCR products were further directly sequenced by the dideoxy chain termination method with the use of Taq polymerase.7 Briefly, 3 µ1 of purified template cDNA was mixed with 1 ml of 5' end-labeled primer (either upstream or downstream primer), 4.5 µ1 of 10 x sequencing buffer (300 mM Tris-HC1 [pH 9.01, 50 mM MgCl2, 500 mM KCl, 0.5% (wt/vol) W- 1c), and 0.5 µl Taq DNA polymerase in a total volume of 36 µ1. From this mixture, 8 µ1 was added to 2 µ1 of each termination mix containing the dNTPs and either ddGTP, ddATP, ddTTP, or ddCTP. The reaction was carried out at 70 C for 5 minutes. Each reaction was stopped with 5 µl of stop solution and heated to 90 C for 5 minutes. Two microliters of the reaction mixture was loaded on 6% ureadenatured polyacrylamide sequencing gel. The oligonucleotide primers successfully amplified a 351bp segment of IBDV cDNA that was derived from either conventionally purified IBDV RNA or crude tissue digest prepared from formalin-fixed paraffin-embedded bursae experimentally challenged with the variant strain E. After 30 cycles of PCR, a single band of DNA of the expected size was seen on the polyacrylamide gel (Fig. 1). Sequencing data of 310 bases lying between the 3' ends of the primers were obtained by directly sequencing the PCR product and were

Downloaded from vdi.sagepub.com at University of Bath - The Library on June 13, 2015

454

Brief communications

Figure 1. Ethidium-bromide staining of amplified 351-bp cDNA segments (arrow) from the variant strain E (VE) of infectious bursal disease virus (IBDV) in formalin-fixed paraffin-embedded bursae after 30 cycles of polymerase chain reaction (PCR) with a pair of primers in polyacrylamide gel electrophoresis. Lane 1: negative control without template DNA or RNA. Lane 2: chicken bursal nucleic acid. Lane 3: double-stranded RNA of VE from infected bursal tissue was prepared by purification. Lane 4: double-stranded RNA of VE from infected bursal tissue was treated by rapid digestion method. Lane 5: molecular-weight marker (12,216 bp, . . . , 1,018 bp, 506 bp, 396 bp, 344 bp, 298 bp, 220 bp, . . . , 75 bp).

identical to the published sequence of the variant strain E.4 There were 295 bases homologous to the published sequence of the strain STC (Fig. 2).6 The PCR results were positive for all bursae from the challenged chickens. No amplified product was detected from any control bursa. Nucleotide sequence coding for the PCR product from each infected bursa was identical. This study demonstrated that the PCR could be applied to paraffin-embedded blocks of formalin-fixed bursae for the detection of IBDV genome. The double-stranded RNA of IBDV could be obtained from formalin-fixed paraffin-embedded bursae by either conventional purification procedure or rapid digestion method. Both extraction methods provided the starting material suitable for the PCR; however, the digestion method was much faster and simpler. Because no purification steps were required, the bursal samples could be quickly digested, and the impure IBDV RNA would be ready for reverse transcription and subsequent PCR. Total time for all procedures from deparaffinization to cDNA synthesis was