Journal of Virological Methods 211 (2015) 12–18
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Detection of influenza A virus subtypes using a solid-phase PCR microplate chip assay Xin-Cheng Sun a,b , YunLong Wang a,e , Liping Yang c,∗ , HuiRu Zhang d a
Basic Medical School of Zhengzhou University, Zhengzhou, China College of Food and Biological Engineering, Zhengzhou University of Light Industry, Zhengzhou, China Basic Medical School of Henan University of Traditional Chinese Medicine, Zhengzhou, China d Bioengineering Research Center of Henan Province, Zhengzhou, China e Henan Biotechnology Research Centre, Zhengzhou, China b c
a b s t r a c t Article history: Received 30 October 2013 Received in revised form 26 September 2014 Accepted 3 October 2014 Available online 14 October 2014 Keywords: Influenza A virus Solid-phase RT-PCR Microplate chip
A rapid and sensitive microplate chip based on solid PCR was developed to identify influenza A subtypes. A simple ultraviolet cross-linking method was used to immobilize DNA probes on pretreated microplates. Solid-phase PCR was proven to be a convenient method for influenza A screening. The sensitivity of the microplate chip was 10−3 g/mL for the enzymatic colorimetric method and 10−4 g/mL for the fluorescence method. The 10 sets of primers and probes for the microplate chip were highly specific and did not interfere with each other. These results suggest that the microplate chip based on solid PCR can be used to rapidly detect universal influenza A and its subtypes. This platform can also be used to detect other pathogenic microorganisms. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Influenza is an important acute respiratory infectious disease in humans. Influenza causes millions of infections worldwide, with an estimated 250,000–500,000 deaths per year (Kaiser, 2006). The potential pandemic threat associated with the influenza virus can be ascribed to the emergence of a new human influenza virus A strain, H1N1, which originated from swine, in the spring of 2009 (Peiris et al., 2009; Smith et al., 2009). Depending on their matrix and nucleoproteins, influenza viruses can be classified into three types (A, B, and C), of which influenza A is the most common (Peiris et al., 2009). On the basis of antigenic differences in the hemagglutinin (HA) and neuraminidase (NA) proteins, the influenza A virus is divided into 16 HA and 9 NA subtypes. Influenza A exhibits rapid variation and has numerous known subtypes; hence, developing a sensitive, effective diagnostic method is crucial to prevent the virus. The gold standard method for distinguishing influenza virus strains usually involves virus isolation, culture, and immunological identification. However, this method is time consuming (3–7 days). Various molecular methods based on PCR have been
∗ Corresponding author. Tel.: +86 13937138471; fax: +86 371 65934070. E-mail address: [email protected] (L. Yang). http://dx.doi.org/10.1016/j.jviromet.2014.10.002 0166-0934/© 2014 Elsevier B.V. All rights reserved.
recently developed using universal primers or specific primers for detecting and classifying clinical subtypes of the influenza A virus; these methods include reverse transcriptase PCR (Xie et al., 2006; Lee et al., 2008; Chiapponi et al., 2012; Tang et al., 2012; Wu et al., 2013), real time RT-PCR (Wu et al., 2008; Hymas et al., 2010; Mölsä et al., 2012), and NASBA (nucleic acid sequence-based amplification, NASBA) (Spackman et al., 2002; Collins et al., 2002, 2003; Catherine et al., 2010). PCR-based detection has the advantages of rapid processing, high sensitivity and specificity, and capacity to reduce the risks associated with handling infectious materials. However, conventional PCR cannot provide complete information on multiple subtypes contained within mixed samples, specifically those with different influenza virus subtypes. Therefore, this method is not sufficient to meet the clinical requirements for the simultaneous detection of multiple subtypes. Microarrays are superior to RT-PCR and sequencing because they can detect hundreds or thousands of genes in parallel. Various microarrays have been recently used to detect, differentially diagnose, and subtype influenza A viruses (Kessler et al., 2004; Han et al., 2008; Wang et al., 2008; Gall et al., 2009). However, the widespread applications of microarray platforms for routine diagnostic investigations are limited by their complicated and time-consuming protocols. Previous studies have performed solid-phase PCR using specific, high-throughput, oligonucleotide primers immobilized on glass slides (Fedurco et al., 2006; Huber et al., 2001; Sun et al., 2011).
X.-C. Sun et al. / Journal of Virological Methods 211 (2015) 12–18 Table 1 Reference sequence of virus strains. Subtype
Gene
Virus strains
A H1N1 H1N2 H2N2 H3N1 H3N2 H5N1 H6 H7N7 H9N2
M HA HA HA HA HA HA HA HA HA
Influenza A virus (A/Sydney/DD3-51/2010(H1N1) Influenza A virus (A/Puerto Rico/8/1934(H1N1)) Influenza A virus (A/swine/Iowa/A01267774/2012(H1N2)) Influenza A virus (A/Korea/426/1968(H2N2)) Influenza A virus (A/swine/England/704563/1995(H3N1) Influenza A virus (A/New York/392/2004(H3N2)) Influenza A virus (A/Goose/Guangdong/1/96(H5N1)) Influenza A virus (A/mallard-Ohio-123-1989(H6N8) Influenza A virus (A/equine/Kirgiziya/26/1974(H7N7) Influenza A virus (A/Hong Kong/1073/99(H9N2)
However, oligonucleotide primers immobilized on microplates have never been reported to date. This study developed a microplate chip based on solid-phase PCR for detecting influenza A virus subtypes. In this method, universal or subtype-specific influenza A virus probes were fixed on pretreated microplates. 2. Materials and methods 2.1. Plasmids and reference sequence of virus strains On the basis of the virus strain sequences obtained from NCBI, partial sequences of the HA and M genes were synthesized at Sangon Biotech (Shanghai). Plasmids that contain HA or M genes were diluted to 1 g/mL and used as positive samples for detection (Table 1). 2.2. Primers and probes Universal influenza A virus primers based on the M gene were designed using DNAMAN, primer 5, and BLAST software. Subtypespecific primers based on the HA gene were designed for each subtype to ensure that the Tm and GC% of each subtype primer
13
were approximately 50–55 ◦ C and 40%–60%, respectively. Table 2 shows a list of the primers and probes used for solid-phase PCR amplification. The M gene was selected for the influenza A virus because it is conserved across all type A influenza viruses. Primers and probes for H1N1, H1N2, H1N1, H2N2, H3N1, H3N2, H5N1, H6, H7N7, and H9N2 subtypes were targeted at the HA gene of the influenza virus. Each forward primer was NH2 labeled at the 5 -end to directly visualize the solid-phase RT-PCR results on the microplate. The probes (immobilized primers) were modified at the 5 -end with a poly(T)15 to facilitate attachment to the solid substrate as previously described. All oligonucleotide primers and probes were synthesized at Sangon Biotech (Shanghai). 2.3. Microplate treatment for solid-phase PCR amplification Briefly, 96-well microplates were washed with double distilled water, immersed in 2.5 M NaOH solution overnight, washed thrice with double distilled water, washed for 15 min in an ultrasonic cleaning apparatus, washed thrice with double distilled water, and then air-dried. An amino silane solution prepared by mixing methanol and water at a ratio of 95:5 and then supplemented with 1% APS was added to each well at 50 ◦ C for 2 h in an electric drying oven. Then, the microplates were washed twice with methanol and twice with double distilled water. The cleaned 96well microplates were placed in the drying oven at 120 ◦ C for 1 h. The cooled microplates were placed in a vacuum for future use. 2.4. Preparation of DNA microarrays for solid-phase PCR Microarrays were produced on the microplates through a simple method using T-tagged probes. The 96-well microplates were purchased from Corning (New York, USA) and pretreated as described above. Ten oligonucleotide probes with poly(T) 15 were diluted to a final concentration of 20 mol/L with deionized water and mixed with a buffer solution (3× SSC and 0.05 M SDS at a ratio of 1:1)
Table 2 List of specific primers and probes used in this article. Type or subtype
Target gene
Primers and probes
Sequences (5 –3 )
A
M
H1N1
HA
H1N2
HA
H2N2
HA
H3N1
HA
H3N2
HA
H5N1
HA
H6
HA
H7N7
HA
H9N2
HA
P1-M-s P1-M P2-M P1-H1N1-s P1-H1N1 P2-H1N1 P1-H1N2-s P1-H1N2 P2-H1N2 P1-H2N2-s P1-H2N2 P2-H2N2 P1-H3N1-s P1-H3N1 P2-H3N1 P1-H3N2-s P1-H3N2 P2-H3N2 P1-H5N1-s P1-H5N1 P2-H5N1 P1-H6-s P1-H6 P2-H6 P1-H7N7-s P1-H7N7 P2-H7N7 P1-H9N2-s P1-H9N2 P2-H9N2
NH2-ttttttttttttttt- AGATGAGTCTTCTAACCGAGGTC AGATGAGTCTTCTAACCGAGGTC TGCAAAAACATCTTCAAGTCTCTG NH2-ttttttttttttttt- CCACAACGGAAAACTATGT CCACAACGGAAAACTATGT TGTTTCTACAATGTAGGACCATG NH2-ttttttttttttttt- CACAATGGGAAGCTGTGC CACAATGGGAAGCTGTGC TGATTTCTTGGAAATCAGTGAT NH2-ttttttttttttttt- AGCATTTGTTCTCCGCTC AGCATTTGTTCTCCGCTC TGGTCTGGCTGACAACG NH2-ttttttttttttttt-CTTTAAGCTACATTTTATGTTTGAC CTTTAAGCTACATTTTATGTTTGAC GCATTAGTTACTTCAATCTGATCAC NH2-ttttttttttttttt- GGGTTACTTCAAAATACGAAG GGGTTACTTCAAAATACGAAG GTTTACATTTTGAAATGGTTTG NH2-ttttttttttttttt- CATGTCCATACCATGGGAG CATGTCCATACCATGGGAG GTGAATCCCCCACAGTACT NH2-ttttttttttttttt-CTGCAGAGTCTTGAATAAAGC CTGCAGAGTCTTGAATAAAGC CCTCTCTACTATGTATGACCAACT NH2-ttttttttttttttt-AATATTAGCCATTTCGGCAT AATATTAGCCATTTCGGCAT GCATTTACAACTTCTATTCCCT NH2-ttttttttttttttt-GCCAAACATTGCGAGTAC GCCAAACATTGCGAGTAC TGCACTACACAATTACCACC
Amplicon (bps)
101
140
117
80
148
130
137
124
123
124
14
X.-C. Sun et al. / Journal of Virological Methods 211 (2015) 12–18
Fig. 1. Sampling mode 1 (4 × 9). Well 1A–1D: p1-H1N1-s: 2A–2D: p1-H1N2-s: 3A–3D: p1-H2N2-s: 4A–4D: p1-H3N1-s: 5A–5D: p1-H3N2-s: 6A–6D: p1-H5N1-s: 7A–7D: p1-H6-s: 8A–8D: p1-H7N7-s: 9A–9D: p1-H9N2-s.
to obtain a 10 M probe sample buffer. The probe sample buffer (2 L) was added into the 96-well microplates. The plates were placed in the oven at 80 ◦ C for 30 min, and the probes were immobilized through UV irradiation under an ultraviolet lamp for 10 min using a UV cross-linking instrument (DIY-2010). The microplates were rinsed in deionized water and then dried for use. The microplate chip layout is shown in Figs. 1 and 2. The probes were immobilized using the method described above. 2.5. Solid-phase PCR amplification conditions The PCR reaction mixture (25 L) contained 2.5 L of 10 × RTPCR buffer, 0.5 L of 10 mmol/L DNTP mix (Biotin-11-dUTP, final concentration 2 M), 1 L of Taq DNA polymerase (final concentration 0.25 U), 1 L of the DNA sample, 10 pairs of primers P1 and P2 at final concentrations of 0.005 and 0.5 mol/L, respectively, and 1 mg/mL BSA. The mixed PCR reaction liquid was added into corresponding wells of the 96-well microplates and then fixed with the probes. The microplates were sealed with a PCR sealing film, and PCR was carried out in a thermal cycler (bio-rad mycycler PCR, USA). The cycling conditions were as follows: denaturation for 5 min at 94 ◦ C; 30 cycles of 25 s at 94 ◦ C, 45 s at 50 ◦ C, and 30 s at 72 ◦ C; and a final extension of 5 min at 72 ◦ C. 2.6. Signal detection 2.6.1. Enzymatic colorimetric method (sampling mode 1) The PCR reaction liquid was removed from the wells after terminating the reaction. A 100 L aliquot of wash buffer solution (1 × PBS and 0.001% Tween20) was added into each well. The wells were washed twice for 2 min each time. The wash buffer solution was removed, and 100 L of blocking buffer solution (1 × PBS, 0.005% SDS, and 20 mg/mL BSA) was added at 37 ◦ C for 30 min. A 100 L aliquot of alkaline phosphatase labeled by streptavidin solution was added and then incubated at 37 ◦ C for 30 min. A 100 L aliquot of wash buffer solution (3 × SSC, 0.05% SDS) was added at 37 ◦ C for 5 min, and then the buffer solution was removed.
This process was repeated three times. A 100 L aliquot of 1 × PBS buffer was added at 37 ◦ C for 30 min and then removed. After the wells were added with 25 L of BCIP/NBT solution, the microplates were incubated at 37 ◦ C for 30 min. The plates were washed twice with 100 L of ddH2 O and then allowed to air-dry. The results were analyzed using optical scanners. The appearance of blue violet precipitates was considered to indicate positive results. 2.6.2. Fluorescence method (sampling mode 2) The PCR reaction liquid was removed from the microplate wells. Then, 1 L of Green-DNA dye nucleotide colloidal dye solution was added into each well at 37 ◦ C for 5 min. The PCR amplicons were analyzed using a gel imaging system (bio-rad). 2.7. Single-sample microplate chip based on solid-phase PCR According to sampling modes 1 (4 × 9) and 2 (4 × 6), single plasmids that contain different virus subtypes were identified through solid-phase PCR under the above amplification conditions and using the signal detection method. 2.8. Mixed-sample microplate chip based on solid-phase PCR According to sampling modes 1 (4 × 9) and 2 (4 × 6), mixed plasmids that contain different virus subtypes (H1N1, H1N2, and H2N2 plasmids; H3N1, H3N2, and H5N1 plasmids; H7N7, H6, and H9N2 plasmids) were identified through solid-phase PCR under the above amplification conditions and using the signal detection method. 2.9. Sensitivity of the microplate chip based on the solid-phase RT-PCR According to sampling modes 1 (4 × 9) and 2 (4 × 6), the sensitivity of the microplate chip based on solid-phase RT-PCR was evaluated. Tenfold serial dilutions of the plasmids containing influenza strain H1N1 ranging from 1 × 10−1 to 1 × 10−5 g/mL were prepared. Each dilution (1 L) was used as a template for
Fig. 2. Sampling mode (2.4 × 6). 1A–1B: p1-M-s; 2A–2B: p1-H1N1-s; 3A–3B: p1-H1N2-s; 4A–4B: p1-H2N2-s; 5A–5B: p1-H3N1-s; 6A–6B: p1-H3N2-s; 1C–1D: p1-H5N1-s; 2C–2D: p1-H6-s; 3C–3D: p1-H7N7-s; 4C–4D: p1-H9N2-s; 5C–5D: ddH2 O; 6C–6D: p1-M-s.
X.-C. Sun et al. / Journal of Virological Methods 211 (2015) 12–18
15
Fig. 3. Amplified results of single plasmid containing virus samples (enzyme). (a) H1N1: (1A–1B); (b) H1N2: (2A–2B); (c) H2N2: (3A–3B); (d) H3N1: (4A–4B); (e) H3N2: (5A–5B); (f) H5N1: (6A–6B); (g) H6N1: (7A–7B); (h) H6: (8A–8B); (i) H9N2: (9A–9B).
solid-phase PCR. The plasmid containing influenza A strain H1N2 was used as the positive control.
3. Results 3.1. Detection of a single plasmid containing the influenza virus subtype HA gene The microplate chip was prepared according to sampling modes 1 and 2. Fluorescent images of the microarray after solid-phase PCR using single plasmids that contain templates of the influenza virus subtype HA gene are shown in Fig. 3(a–i). The following nine strains were unambiguously identified on the basis of distinct patterns: H1N1(1A/1B), H1N2 (2A/2B), H2N2 (3A/3B), H3N1 (4A/4B), H3N2 (5A/5B), H5N1 (6A/6B), H6N1 (7A/7B), H6 (8A/8B), and H9N2 (9A/9B). For all of the nine viruses, specificity was determined when only their own probe for the HA gene was amplified while the other probes were not amplified, i.e., only the 1A–1B probe was amplified for H1N1 (Fig. 3a) and only the 2A–2B probe was amplified for H1N2 (Fig. 3b). Despite the presence of all the primers and probes, non-specific amplification was not
observed. This result demonstrates the specificity of the primers and probes.
3.2. Detection of single samples (sampling mode 2) According sampling mode 2, different DNA plasmids that contain the influenza A subtypes were amplified using solid-phase PCR. The primers and probes were proven specific because only the corresponding influenza A subtype was positive when the respective primers and probes were used (Fig. 4).
3.3. Detection of mixed samples (sampling mode 2) According sampling mode 2, mixed plasmid DNA that contains the different influenza subtypes (H1N1, H1N2, and H2N2; H3N1, H3N2, and H5N1; H7N7, H6, and H9N2) was amplified using solidphase PCR. The primers and probes were proven specific because only the corresponding influenza subtype mixture was positive when the respective primers and probes were used (Fig. 5).
Fig. 4. Amplified results of single virus plasmid samples. (a–i) Microplate 1A–1B and 6C–6D: M clone plasmid; 5C–5D: DDH2 O; others microplate: (a) H1N1 plasmid; (b) H1N2 plasmid; (c) H2N2 plasmid; (d) H3N1 plasmid; (e) H3N2 plasmid; (f) H5N1 plasmid; (g) H6 plasmid; (h) H7N7 plasmid; (i) H9N2 plasmid.
16
X.-C. Sun et al. / Journal of Virological Methods 211 (2015) 12–18
Fig. 5. Solid phage PCR amplified result of mixed plasmids containing influenza A virus subtype. (a) Amplified result of mixed plasmids containing influenza A virus H1N1, H1N2 and H2N2 subtype; (b) amplified result of mixed plasmids containing influenza A virus H3N1, H3N2 and H5N1 subtype; (c) amplified result of mixed plasmids containing influenza A virus H7N7, H6and H9N2 subtype.
3.4. Detection of mixed samples (sampling mode 1) Mixed DNA template 1 (H1N1, H1N2, and H2N2 plasmids at a 1:1:1 ratio), mixed DNA template 2 (H3N1, H3N2, and H5N1 plasmids at a 1:1:1 ratio), and mixed DNA template 3 (H7N7, H6, and H9N2 plasmids at a 1:1:1 ratio) were detected through amplification using solid-phase PCR according to sampling mode 1. Fluorescent images of the microarray after solid-phase RT-PCR using the templates from the three mixed samples are shown in Fig. 6(a–c). The three mixed viruses were unambiguously identified by their distinct patterns. For H1N1, H1N2, and H2N2, only their respective probes were amplified (Fig. 6a). H3N1, H3N2, and H5N1 were positive at their corresponding probes (Fig. 6b). H7N7, H6, and H9N2 were also amplified only at their respective probes (Fig. 6c). These results confirm the specificity of the primers and the probes used in this study. 3.5. Sensitivity analysis of the microplate chip The sensitivity of the microplate chip based on solidphase PCR was investigated. A tenfold serial dilution (1 × 10−1 –1 × 10−5 g/mL) of H2N2 was prepared, and the plasmid was used as a template. The H1N2 plasmid was used as a control. The sensitivity of the microplate chip was 10−3 g/mL for sampling mode 1 (Fig. 7) and 10−4 g/mL sampling mode 2 (Fig. 8). 4. Discussion To date, an effective prevention method is still unavailable for influenza, an infectious respiratory tract disease. Four worldwide (pandemic) outbreaks of influenza were recorded in the 20th and 21st centuries. Each outbreak differed from the others with respect to etiologic agents, epidemiology, and disease severity. These outbreaks represent four antigenic subtypes of the influenza A virus: H1N1, H2N2, H3N2, and H1N1 (2009), respectively. Human
Fig. 6. Solid phage PCR amplified result of mixed plasmids containing influenza A virus subtype. (a–c) Microplate 1A–1B and 6C–6D series: plasmid DNA containing influenza A virus M gene; well 5C–5D series: DDH2 O; others microplate: (a) amplified result of mixed plasmids containing influenza A virus H1N1, H1N2and H2N2 subtype; (b) amplified result of mixed plasmids containing influenza A virus H3N1, H3N2 and H5N1 subtype; (c) amplified result of mixed plasmids containing influenza A virus H7N7, H6 and H9N2 subtype.
infections with a new avian influenza A (H7N9) virus were first reported in China in March 2013. Human infections with other H7 influenza subtypes (H7N2, H7N3, and H7N7) have also been reported. The pandemic threat associated with the new influenza virus subtypes can be attributed to the lack of detection methods with high accuracy. Therefore, the development of a rapid and convenient detection method is an urgent concern. Among all the existing detection methods, the gene chip assay has become popular because of its high throughput and sensitivity. However, the detection result of the common gene chip requires a fluorescence scanning system after the reaction. This method is unsuitable for use in basic research laboratories and hospitals only equipped with simple instruments. Video chip technology can produce visible results through the use of a special processing method for hybridization results. Visual gene chip technology is advantageous because of its high throughput, rapid processing, and high accuracy and efficiency without the need for expensive equipment. In this study, classic virus strains H1N1 (2009), H1N2, H2N2, H3N2, H3N1, H3N2, H5N1, H6, H7N7, and H9N2 were selected. The primers and probes used in solid-phase PCR were specific to each virus. A DNA microplate chip-based solid-phase PCR platform was developed for the rapid identification of various influenza virus subtypes. This platform may also be used to simultaneously detect other influenza A subtypes. This high-throughput, rapid, and accurate method may also be employed to discover new virus subtypes and to effectively monitor epidemic situations. Previous microarrays were produced on glass slides (Wang et al., 2008; Sun et al., 2011; Bodrossy and Sessitsch, 2004). The present study is the first to produce a microplate chip. This microplate chip has some advantages, such as avoiding cross-contamination, convenient pretreatment, efficient amplification, and simple result observation.
X.-C. Sun et al. / Journal of Virological Methods 211 (2015) 12–18
17
Fig. 7. Detection sensitivity results of solid phage PCR amplification. (a–f) A1–A9 and B1–B9 series (not including 2A–2B): 1 × g/mL H2N2 plasmid, 1 × 10−1 g/mL H2N2 plasmid, 1 × 10−2 g/mL H2N2 plasmid, 1 × 10−3 g/mL H2N2 plasmid, 1 × 10−4 g/mL H2N2 plasmid, 1 × 10−5 g/mL H2N2 plasmid respectively. microplate 2A-2B: H1N2 plasmid; C1–C9 and D1–D9 series wells: ddH2 O
Fig. 8. Detection sensitivity results of solid phage PCR amplification. (a–e) Microplate 1A–1B and 6C–6D series: plasmid DNA containing influenza A virus M gene; 5C–D series: DDH2 O; others microplate: (a) amplified result of mixed plasmids containing influenza A virus H1N1, H2N2 plasmid dilution products: (a–e) 2A–2B H1N1. Their concentration is 1 g/mL, 1 × 10−1 g/mL, 1 × 10−1 g/mL, 1 × 10−2 g/mL, 1 × 10−3 g/mL, 1 × 10−4 g/mL;4A–4B: H2N2plasmid concentration is 1 g/mL, 1 × 10−1 g/mL, 1 × 10−1 g/mL, 1 × 10−2 g/mL, 1 × 10−3 g/mL, 1 × 10−4 g/mL.
The signal detection enzymatic colorimetric method and fluorescence method were also developed. These two methods could be used for signal detection. The microplate chip using the fluorescence method exhibited higher sensitivity and simpler operations than that using the enzymatic colorimetric method (Figs. 7 and 8). Microarrays were assayed using plasmid DNA that contains the HA gene of influenza virus samples. The detection sensitivity and specificity of the method for each subtype were satisfactory. The microarrays developed in this study will be further improved with respect to the reaction system, reaction conditions, and the design of additional influenza subtype primers and probes. 5. Conclusions This study developed a microplate chip-based solid-phase PCR method that can rapidly detect general influenza virus type A and simultaneously identify the subtypes H1N1, H1N2, H1N1, H2N2, H3N1, H3N2, H5N1, H6, H7N7, and H9N2. This method may also be used to detect pathogenic microorganisms.
Acknowledgement This work was supported by the key scientific and technological research projects of Henan Province, P.R. China (102102310093 and 102102310082). References Bodrossy, L., Sessitsch, A., 2004. Oligonucleotide microarrays in microbial diagnostics. Ecol. Ind. Microbiol. 7, 245–254. Catherine, M., Jean-Noel, T., Sally, C., Moore, C., Telles, J.N., Corden, S., Gao, R.B., Vernet, G., Van Aarle, P., Shu, Y.L., 2010. Development and validation of a commercial real-time NASBA assay for the rapid confirmation of influenza A H5N1 virus in clinical samples. J. Virol. Methods 170, 173–176. Chiapponi, C., Moreno, A., Barbieri, I., Merenda, M., Foni, E., 2012. Multiplex RT-PCR assay for differentiating European swine influenza virus subtypes H1N1, H1N2 and H3N2. J. Virol. Methods 184, 117–120. Collins, R.A., Ko, L.S., Fung, K.Y., Chan, K.Y., Xing, J., Lau, L.T., Yu, A.C., 2003. Rapid and sensitive detection of avian influenza virus subtype H7 using NASBA. Biochem. Biophys. Res. Commun. 300, 507–515. Collins, R.A., Ko, L.S., So, K.L., Ellis, T., Lau, L.T., Yu, A.C., 2002. Detection of highly pathogenic and low pathogenic avian influenza subtype H5 (Eurasian lineage) using NASBA. J. Virol. Methods 102, 213–225.
18
X.-C. Sun et al. / Journal of Virological Methods 211 (2015) 12–18
Fedurco, M., Romieu, A., Williams, S., Lawrence, I., Turcatti, G., 2006. A novel reagent for DNA attachment on glass and efficient generation of solid-phase amplified DNA colonies. Nucleic Acids Res. 3, 22–34. Gall, A., Hoffmann, B., Harder, T., Grund, C., Höper, D., Beer, M., 2009. Design and validation of a microarray for detection, hemagglutinin subtyping and pathotyping of avian influenza viruses. J. Clin. Microbiol. 47, 327–334. Han, X., Lin, X., Liu, B., Hou, Y., Huang, J., Wu, S., Liu, J., Mei, L., Jia, G., Zhu, Q., 2008. Simultaneously subtyping of all influenza A viruses using DNA microarrays. J. Virol. Methods 152, 117–121. Huber, M., Losert, D., Hiller, R., Harwanegg, C., Mueller, M.W., Schmidt, W.M., 2001. Detection of single base alterations in genomic DNA by solid phase polymerase chain reaction on oligonucleotide microarrays. Anal. Biochem. 299, 24–30. Hymas, W.C., Mills, A., Ferguson, S., Langer, J., She, R.C., Mahoney, W., Hillyard, D.R., 2010. Development of a multiplex real-time RT-PCR assay for detection of influenza A, influenza B, RSV and typing of the 2009-H1N1 influenza virus. J. Virol. Methods 167, 113–118. Kaiser, J.A., 2006. One-size-fits-all flu vaccine. Science 5772, 380–382. Kessler, N1, Ferraris, O., Palmer, K., Marsh, W., Steel, A., 2004. Use of the DNA flowthru chip, a three-dimensional biochip, for typing and subtyping of influenza viruses. J. Clin. Microbiol. 42, 2173–2185. Lee, C.S., Kang, B.K., Lee, D.H., Lyou, S.H., Park, B.K., Ann, S.K., Jung, K., Song, D.S., 2008. One-step multiplex RT-PCR for detection and subtyping of swine influenza H1, H3, N1, N2 viruses in clinical samples using a dual priming oligonucleotide (DPO) system. J. Virol. Methods 151, 30–34. Peiris, J.S., Tu, W.W., Yen, H.L., 2009. A novel H1N1 virus causes the first pandemic of the 21(st) century. Eur. J. Immunol. 39, 2946–2954. Mölsä, M., Koskela, K.A., Rönkkö, E., Ikonen, N., Ziegler, T., Nikkari, S., 2012. Detection of influenza A viruses with a portable real-time PCR instrument. J. Virol. Methods 181, 188–191.
Smith, G.J., Vijaykrishna, D., Bahl, J., Lycett, S.J., Worobey, M., Pybus, O.G., Ma, S.K., Cheung, C.L., Raghwani, J., Bhatt, S., Peiris, J.S., Guan, Y., Rambaut, A., 2009. Origins and evolutionary genomics of the 2009 swine-origin H1N1 influenza A epidemic. Nature 459, 1122–1125. Spackman, E., Senne, D.A., Myers, T.J., Bulaga, L.L., Garber, L.P., Perdue, M.L., Lohman, K., Daum, L.T., Suarez, D.L., 2002. Development of a real-time reverse transcriptase PCR assay for type A influenza virus and the avian H5 and H7 hemagglutinin subtypes. J. Clin. Microbiol. 40, 3256–3260. Sun, Y1, Dhumpa, R., Bang, D.D., Handberg, K., Wolff, A., 2011. DNA microarraybased solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7. Diagn. Microbiol. Infect. Dis. 69, 432–439. Tang, Q., Wang, J., Bao, J., Sun, H., Sun, Y., Liu, J., Pu, J., 2012. A multiplex RT-PCR assay for detection and differentiation of avian H3, H5, and H9 subtype influenza viruses and Newcastle disease viruses. J. Virol. Methods 181, 164–169. Wang, L.C., Pan, C.H., Severinghaus, L.L., Liu, L.Y., Chen, C.T., Pu, C.E., Huang, D., Lir, J.T., Chin, S.C., Cheng, M.C., Lee, S.H., Wang, C.H., 2008. Simultaneous detection and differentiation of Newcastle disease and avian influenza viruses using oligonucleotide microarrays. Vet. Microbiol. 127, 217–226. Wu, C., Cheng, X., He, J., Lv, X., Wang, J., Deng, R., Long, Q., Wang, X., 2008. A multiplex real-time RT-PCR for detection and identification of influenza virus types A and B and subtypes H5 and N1. J. Virol. Methods 14, 881–888. Wu, L., Ding, L., Pei, Z., Huo, X., Wen, G., Pan, Z., 2013. A multiplex reverse transcription-PCR assay for the detection of influenza A virus and differentiation of the H1, H3, H5 and H9 subtypes. J. Virol. Methods 188, 47–50. Xie, Z., Pang, Y.S., Liu, J., Deng, X., Tang, X., Sun, J., Khan, M.I., 2006. A multiplex RTPCR for detection of type A influenza virus and differentiation of avian H5, H7, and H9 hemagglutinin subtypes. Mol. Cell. Probes 20, 245–249.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Detection of influenza A virus subtypes using a solid-phase PCR microplate chip assay Xin-Cheng Sun a,b , YunLong Wang a,e , Liping Yang c,∗ , HuiRu Zhang d a
Basic Medical School of Zhengzhou University, Zhengzhou, China College of Food and Biological Engineering, Zhengzhou University of Light Industry, Zhengzhou, China Basic Medical School of Henan University of Traditional Chinese Medicine, Zhengzhou, China d Bioengineering Research Center of Henan Province, Zhengzhou, China e Henan Biotechnology Research Centre, Zhengzhou, China b c
a b s t r a c t Article history: Received 30 October 2013 Received in revised form 26 September 2014 Accepted 3 October 2014 Available online 14 October 2014 Keywords: Influenza A virus Solid-phase RT-PCR Microplate chip
A rapid and sensitive microplate chip based on solid PCR was developed to identify influenza A subtypes. A simple ultraviolet cross-linking method was used to immobilize DNA probes on pretreated microplates. Solid-phase PCR was proven to be a convenient method for influenza A screening. The sensitivity of the microplate chip was 10−3 g/mL for the enzymatic colorimetric method and 10−4 g/mL for the fluorescence method. The 10 sets of primers and probes for the microplate chip were highly specific and did not interfere with each other. These results suggest that the microplate chip based on solid PCR can be used to rapidly detect universal influenza A and its subtypes. This platform can also be used to detect other pathogenic microorganisms. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Influenza is an important acute respiratory infectious disease in humans. Influenza causes millions of infections worldwide, with an estimated 250,000–500,000 deaths per year (Kaiser, 2006). The potential pandemic threat associated with the influenza virus can be ascribed to the emergence of a new human influenza virus A strain, H1N1, which originated from swine, in the spring of 2009 (Peiris et al., 2009; Smith et al., 2009). Depending on their matrix and nucleoproteins, influenza viruses can be classified into three types (A, B, and C), of which influenza A is the most common (Peiris et al., 2009). On the basis of antigenic differences in the hemagglutinin (HA) and neuraminidase (NA) proteins, the influenza A virus is divided into 16 HA and 9 NA subtypes. Influenza A exhibits rapid variation and has numerous known subtypes; hence, developing a sensitive, effective diagnostic method is crucial to prevent the virus. The gold standard method for distinguishing influenza virus strains usually involves virus isolation, culture, and immunological identification. However, this method is time consuming (3–7 days). Various molecular methods based on PCR have been
∗ Corresponding author. Tel.: +86 13937138471; fax: +86 371 65934070. E-mail address: [email protected] (L. Yang). http://dx.doi.org/10.1016/j.jviromet.2014.10.002 0166-0934/© 2014 Elsevier B.V. All rights reserved.
recently developed using universal primers or specific primers for detecting and classifying clinical subtypes of the influenza A virus; these methods include reverse transcriptase PCR (Xie et al., 2006; Lee et al., 2008; Chiapponi et al., 2012; Tang et al., 2012; Wu et al., 2013), real time RT-PCR (Wu et al., 2008; Hymas et al., 2010; Mölsä et al., 2012), and NASBA (nucleic acid sequence-based amplification, NASBA) (Spackman et al., 2002; Collins et al., 2002, 2003; Catherine et al., 2010). PCR-based detection has the advantages of rapid processing, high sensitivity and specificity, and capacity to reduce the risks associated with handling infectious materials. However, conventional PCR cannot provide complete information on multiple subtypes contained within mixed samples, specifically those with different influenza virus subtypes. Therefore, this method is not sufficient to meet the clinical requirements for the simultaneous detection of multiple subtypes. Microarrays are superior to RT-PCR and sequencing because they can detect hundreds or thousands of genes in parallel. Various microarrays have been recently used to detect, differentially diagnose, and subtype influenza A viruses (Kessler et al., 2004; Han et al., 2008; Wang et al., 2008; Gall et al., 2009). However, the widespread applications of microarray platforms for routine diagnostic investigations are limited by their complicated and time-consuming protocols. Previous studies have performed solid-phase PCR using specific, high-throughput, oligonucleotide primers immobilized on glass slides (Fedurco et al., 2006; Huber et al., 2001; Sun et al., 2011).
X.-C. Sun et al. / Journal of Virological Methods 211 (2015) 12–18 Table 1 Reference sequence of virus strains. Subtype
Gene
Virus strains
A H1N1 H1N2 H2N2 H3N1 H3N2 H5N1 H6 H7N7 H9N2
M HA HA HA HA HA HA HA HA HA
Influenza A virus (A/Sydney/DD3-51/2010(H1N1) Influenza A virus (A/Puerto Rico/8/1934(H1N1)) Influenza A virus (A/swine/Iowa/A01267774/2012(H1N2)) Influenza A virus (A/Korea/426/1968(H2N2)) Influenza A virus (A/swine/England/704563/1995(H3N1) Influenza A virus (A/New York/392/2004(H3N2)) Influenza A virus (A/Goose/Guangdong/1/96(H5N1)) Influenza A virus (A/mallard-Ohio-123-1989(H6N8) Influenza A virus (A/equine/Kirgiziya/26/1974(H7N7) Influenza A virus (A/Hong Kong/1073/99(H9N2)
However, oligonucleotide primers immobilized on microplates have never been reported to date. This study developed a microplate chip based on solid-phase PCR for detecting influenza A virus subtypes. In this method, universal or subtype-specific influenza A virus probes were fixed on pretreated microplates. 2. Materials and methods 2.1. Plasmids and reference sequence of virus strains On the basis of the virus strain sequences obtained from NCBI, partial sequences of the HA and M genes were synthesized at Sangon Biotech (Shanghai). Plasmids that contain HA or M genes were diluted to 1 g/mL and used as positive samples for detection (Table 1). 2.2. Primers and probes Universal influenza A virus primers based on the M gene were designed using DNAMAN, primer 5, and BLAST software. Subtypespecific primers based on the HA gene were designed for each subtype to ensure that the Tm and GC% of each subtype primer
13
were approximately 50–55 ◦ C and 40%–60%, respectively. Table 2 shows a list of the primers and probes used for solid-phase PCR amplification. The M gene was selected for the influenza A virus because it is conserved across all type A influenza viruses. Primers and probes for H1N1, H1N2, H1N1, H2N2, H3N1, H3N2, H5N1, H6, H7N7, and H9N2 subtypes were targeted at the HA gene of the influenza virus. Each forward primer was NH2 labeled at the 5 -end to directly visualize the solid-phase RT-PCR results on the microplate. The probes (immobilized primers) were modified at the 5 -end with a poly(T)15 to facilitate attachment to the solid substrate as previously described. All oligonucleotide primers and probes were synthesized at Sangon Biotech (Shanghai). 2.3. Microplate treatment for solid-phase PCR amplification Briefly, 96-well microplates were washed with double distilled water, immersed in 2.5 M NaOH solution overnight, washed thrice with double distilled water, washed for 15 min in an ultrasonic cleaning apparatus, washed thrice with double distilled water, and then air-dried. An amino silane solution prepared by mixing methanol and water at a ratio of 95:5 and then supplemented with 1% APS was added to each well at 50 ◦ C for 2 h in an electric drying oven. Then, the microplates were washed twice with methanol and twice with double distilled water. The cleaned 96well microplates were placed in the drying oven at 120 ◦ C for 1 h. The cooled microplates were placed in a vacuum for future use. 2.4. Preparation of DNA microarrays for solid-phase PCR Microarrays were produced on the microplates through a simple method using T-tagged probes. The 96-well microplates were purchased from Corning (New York, USA) and pretreated as described above. Ten oligonucleotide probes with poly(T) 15 were diluted to a final concentration of 20 mol/L with deionized water and mixed with a buffer solution (3× SSC and 0.05 M SDS at a ratio of 1:1)
Table 2 List of specific primers and probes used in this article. Type or subtype
Target gene
Primers and probes
Sequences (5 –3 )
A
M
H1N1
HA
H1N2
HA
H2N2
HA
H3N1
HA
H3N2
HA
H5N1
HA
H6
HA
H7N7
HA
H9N2
HA
P1-M-s P1-M P2-M P1-H1N1-s P1-H1N1 P2-H1N1 P1-H1N2-s P1-H1N2 P2-H1N2 P1-H2N2-s P1-H2N2 P2-H2N2 P1-H3N1-s P1-H3N1 P2-H3N1 P1-H3N2-s P1-H3N2 P2-H3N2 P1-H5N1-s P1-H5N1 P2-H5N1 P1-H6-s P1-H6 P2-H6 P1-H7N7-s P1-H7N7 P2-H7N7 P1-H9N2-s P1-H9N2 P2-H9N2
NH2-ttttttttttttttt- AGATGAGTCTTCTAACCGAGGTC AGATGAGTCTTCTAACCGAGGTC TGCAAAAACATCTTCAAGTCTCTG NH2-ttttttttttttttt- CCACAACGGAAAACTATGT CCACAACGGAAAACTATGT TGTTTCTACAATGTAGGACCATG NH2-ttttttttttttttt- CACAATGGGAAGCTGTGC CACAATGGGAAGCTGTGC TGATTTCTTGGAAATCAGTGAT NH2-ttttttttttttttt- AGCATTTGTTCTCCGCTC AGCATTTGTTCTCCGCTC TGGTCTGGCTGACAACG NH2-ttttttttttttttt-CTTTAAGCTACATTTTATGTTTGAC CTTTAAGCTACATTTTATGTTTGAC GCATTAGTTACTTCAATCTGATCAC NH2-ttttttttttttttt- GGGTTACTTCAAAATACGAAG GGGTTACTTCAAAATACGAAG GTTTACATTTTGAAATGGTTTG NH2-ttttttttttttttt- CATGTCCATACCATGGGAG CATGTCCATACCATGGGAG GTGAATCCCCCACAGTACT NH2-ttttttttttttttt-CTGCAGAGTCTTGAATAAAGC CTGCAGAGTCTTGAATAAAGC CCTCTCTACTATGTATGACCAACT NH2-ttttttttttttttt-AATATTAGCCATTTCGGCAT AATATTAGCCATTTCGGCAT GCATTTACAACTTCTATTCCCT NH2-ttttttttttttttt-GCCAAACATTGCGAGTAC GCCAAACATTGCGAGTAC TGCACTACACAATTACCACC
Amplicon (bps)
101
140
117
80
148
130
137
124
123
124
14
X.-C. Sun et al. / Journal of Virological Methods 211 (2015) 12–18
Fig. 1. Sampling mode 1 (4 × 9). Well 1A–1D: p1-H1N1-s: 2A–2D: p1-H1N2-s: 3A–3D: p1-H2N2-s: 4A–4D: p1-H3N1-s: 5A–5D: p1-H3N2-s: 6A–6D: p1-H5N1-s: 7A–7D: p1-H6-s: 8A–8D: p1-H7N7-s: 9A–9D: p1-H9N2-s.
to obtain a 10 M probe sample buffer. The probe sample buffer (2 L) was added into the 96-well microplates. The plates were placed in the oven at 80 ◦ C for 30 min, and the probes were immobilized through UV irradiation under an ultraviolet lamp for 10 min using a UV cross-linking instrument (DIY-2010). The microplates were rinsed in deionized water and then dried for use. The microplate chip layout is shown in Figs. 1 and 2. The probes were immobilized using the method described above. 2.5. Solid-phase PCR amplification conditions The PCR reaction mixture (25 L) contained 2.5 L of 10 × RTPCR buffer, 0.5 L of 10 mmol/L DNTP mix (Biotin-11-dUTP, final concentration 2 M), 1 L of Taq DNA polymerase (final concentration 0.25 U), 1 L of the DNA sample, 10 pairs of primers P1 and P2 at final concentrations of 0.005 and 0.5 mol/L, respectively, and 1 mg/mL BSA. The mixed PCR reaction liquid was added into corresponding wells of the 96-well microplates and then fixed with the probes. The microplates were sealed with a PCR sealing film, and PCR was carried out in a thermal cycler (bio-rad mycycler PCR, USA). The cycling conditions were as follows: denaturation for 5 min at 94 ◦ C; 30 cycles of 25 s at 94 ◦ C, 45 s at 50 ◦ C, and 30 s at 72 ◦ C; and a final extension of 5 min at 72 ◦ C. 2.6. Signal detection 2.6.1. Enzymatic colorimetric method (sampling mode 1) The PCR reaction liquid was removed from the wells after terminating the reaction. A 100 L aliquot of wash buffer solution (1 × PBS and 0.001% Tween20) was added into each well. The wells were washed twice for 2 min each time. The wash buffer solution was removed, and 100 L of blocking buffer solution (1 × PBS, 0.005% SDS, and 20 mg/mL BSA) was added at 37 ◦ C for 30 min. A 100 L aliquot of alkaline phosphatase labeled by streptavidin solution was added and then incubated at 37 ◦ C for 30 min. A 100 L aliquot of wash buffer solution (3 × SSC, 0.05% SDS) was added at 37 ◦ C for 5 min, and then the buffer solution was removed.
This process was repeated three times. A 100 L aliquot of 1 × PBS buffer was added at 37 ◦ C for 30 min and then removed. After the wells were added with 25 L of BCIP/NBT solution, the microplates were incubated at 37 ◦ C for 30 min. The plates were washed twice with 100 L of ddH2 O and then allowed to air-dry. The results were analyzed using optical scanners. The appearance of blue violet precipitates was considered to indicate positive results. 2.6.2. Fluorescence method (sampling mode 2) The PCR reaction liquid was removed from the microplate wells. Then, 1 L of Green-DNA dye nucleotide colloidal dye solution was added into each well at 37 ◦ C for 5 min. The PCR amplicons were analyzed using a gel imaging system (bio-rad). 2.7. Single-sample microplate chip based on solid-phase PCR According to sampling modes 1 (4 × 9) and 2 (4 × 6), single plasmids that contain different virus subtypes were identified through solid-phase PCR under the above amplification conditions and using the signal detection method. 2.8. Mixed-sample microplate chip based on solid-phase PCR According to sampling modes 1 (4 × 9) and 2 (4 × 6), mixed plasmids that contain different virus subtypes (H1N1, H1N2, and H2N2 plasmids; H3N1, H3N2, and H5N1 plasmids; H7N7, H6, and H9N2 plasmids) were identified through solid-phase PCR under the above amplification conditions and using the signal detection method. 2.9. Sensitivity of the microplate chip based on the solid-phase RT-PCR According to sampling modes 1 (4 × 9) and 2 (4 × 6), the sensitivity of the microplate chip based on solid-phase RT-PCR was evaluated. Tenfold serial dilutions of the plasmids containing influenza strain H1N1 ranging from 1 × 10−1 to 1 × 10−5 g/mL were prepared. Each dilution (1 L) was used as a template for
Fig. 2. Sampling mode (2.4 × 6). 1A–1B: p1-M-s; 2A–2B: p1-H1N1-s; 3A–3B: p1-H1N2-s; 4A–4B: p1-H2N2-s; 5A–5B: p1-H3N1-s; 6A–6B: p1-H3N2-s; 1C–1D: p1-H5N1-s; 2C–2D: p1-H6-s; 3C–3D: p1-H7N7-s; 4C–4D: p1-H9N2-s; 5C–5D: ddH2 O; 6C–6D: p1-M-s.
X.-C. Sun et al. / Journal of Virological Methods 211 (2015) 12–18
15
Fig. 3. Amplified results of single plasmid containing virus samples (enzyme). (a) H1N1: (1A–1B); (b) H1N2: (2A–2B); (c) H2N2: (3A–3B); (d) H3N1: (4A–4B); (e) H3N2: (5A–5B); (f) H5N1: (6A–6B); (g) H6N1: (7A–7B); (h) H6: (8A–8B); (i) H9N2: (9A–9B).
solid-phase PCR. The plasmid containing influenza A strain H1N2 was used as the positive control.
3. Results 3.1. Detection of a single plasmid containing the influenza virus subtype HA gene The microplate chip was prepared according to sampling modes 1 and 2. Fluorescent images of the microarray after solid-phase PCR using single plasmids that contain templates of the influenza virus subtype HA gene are shown in Fig. 3(a–i). The following nine strains were unambiguously identified on the basis of distinct patterns: H1N1(1A/1B), H1N2 (2A/2B), H2N2 (3A/3B), H3N1 (4A/4B), H3N2 (5A/5B), H5N1 (6A/6B), H6N1 (7A/7B), H6 (8A/8B), and H9N2 (9A/9B). For all of the nine viruses, specificity was determined when only their own probe for the HA gene was amplified while the other probes were not amplified, i.e., only the 1A–1B probe was amplified for H1N1 (Fig. 3a) and only the 2A–2B probe was amplified for H1N2 (Fig. 3b). Despite the presence of all the primers and probes, non-specific amplification was not
observed. This result demonstrates the specificity of the primers and probes.
3.2. Detection of single samples (sampling mode 2) According sampling mode 2, different DNA plasmids that contain the influenza A subtypes were amplified using solid-phase PCR. The primers and probes were proven specific because only the corresponding influenza A subtype was positive when the respective primers and probes were used (Fig. 4).
3.3. Detection of mixed samples (sampling mode 2) According sampling mode 2, mixed plasmid DNA that contains the different influenza subtypes (H1N1, H1N2, and H2N2; H3N1, H3N2, and H5N1; H7N7, H6, and H9N2) was amplified using solidphase PCR. The primers and probes were proven specific because only the corresponding influenza subtype mixture was positive when the respective primers and probes were used (Fig. 5).
Fig. 4. Amplified results of single virus plasmid samples. (a–i) Microplate 1A–1B and 6C–6D: M clone plasmid; 5C–5D: DDH2 O; others microplate: (a) H1N1 plasmid; (b) H1N2 plasmid; (c) H2N2 plasmid; (d) H3N1 plasmid; (e) H3N2 plasmid; (f) H5N1 plasmid; (g) H6 plasmid; (h) H7N7 plasmid; (i) H9N2 plasmid.
16
X.-C. Sun et al. / Journal of Virological Methods 211 (2015) 12–18
Fig. 5. Solid phage PCR amplified result of mixed plasmids containing influenza A virus subtype. (a) Amplified result of mixed plasmids containing influenza A virus H1N1, H1N2 and H2N2 subtype; (b) amplified result of mixed plasmids containing influenza A virus H3N1, H3N2 and H5N1 subtype; (c) amplified result of mixed plasmids containing influenza A virus H7N7, H6and H9N2 subtype.
3.4. Detection of mixed samples (sampling mode 1) Mixed DNA template 1 (H1N1, H1N2, and H2N2 plasmids at a 1:1:1 ratio), mixed DNA template 2 (H3N1, H3N2, and H5N1 plasmids at a 1:1:1 ratio), and mixed DNA template 3 (H7N7, H6, and H9N2 plasmids at a 1:1:1 ratio) were detected through amplification using solid-phase PCR according to sampling mode 1. Fluorescent images of the microarray after solid-phase RT-PCR using the templates from the three mixed samples are shown in Fig. 6(a–c). The three mixed viruses were unambiguously identified by their distinct patterns. For H1N1, H1N2, and H2N2, only their respective probes were amplified (Fig. 6a). H3N1, H3N2, and H5N1 were positive at their corresponding probes (Fig. 6b). H7N7, H6, and H9N2 were also amplified only at their respective probes (Fig. 6c). These results confirm the specificity of the primers and the probes used in this study. 3.5. Sensitivity analysis of the microplate chip The sensitivity of the microplate chip based on solidphase PCR was investigated. A tenfold serial dilution (1 × 10−1 –1 × 10−5 g/mL) of H2N2 was prepared, and the plasmid was used as a template. The H1N2 plasmid was used as a control. The sensitivity of the microplate chip was 10−3 g/mL for sampling mode 1 (Fig. 7) and 10−4 g/mL sampling mode 2 (Fig. 8). 4. Discussion To date, an effective prevention method is still unavailable for influenza, an infectious respiratory tract disease. Four worldwide (pandemic) outbreaks of influenza were recorded in the 20th and 21st centuries. Each outbreak differed from the others with respect to etiologic agents, epidemiology, and disease severity. These outbreaks represent four antigenic subtypes of the influenza A virus: H1N1, H2N2, H3N2, and H1N1 (2009), respectively. Human
Fig. 6. Solid phage PCR amplified result of mixed plasmids containing influenza A virus subtype. (a–c) Microplate 1A–1B and 6C–6D series: plasmid DNA containing influenza A virus M gene; well 5C–5D series: DDH2 O; others microplate: (a) amplified result of mixed plasmids containing influenza A virus H1N1, H1N2and H2N2 subtype; (b) amplified result of mixed plasmids containing influenza A virus H3N1, H3N2 and H5N1 subtype; (c) amplified result of mixed plasmids containing influenza A virus H7N7, H6 and H9N2 subtype.
infections with a new avian influenza A (H7N9) virus were first reported in China in March 2013. Human infections with other H7 influenza subtypes (H7N2, H7N3, and H7N7) have also been reported. The pandemic threat associated with the new influenza virus subtypes can be attributed to the lack of detection methods with high accuracy. Therefore, the development of a rapid and convenient detection method is an urgent concern. Among all the existing detection methods, the gene chip assay has become popular because of its high throughput and sensitivity. However, the detection result of the common gene chip requires a fluorescence scanning system after the reaction. This method is unsuitable for use in basic research laboratories and hospitals only equipped with simple instruments. Video chip technology can produce visible results through the use of a special processing method for hybridization results. Visual gene chip technology is advantageous because of its high throughput, rapid processing, and high accuracy and efficiency without the need for expensive equipment. In this study, classic virus strains H1N1 (2009), H1N2, H2N2, H3N2, H3N1, H3N2, H5N1, H6, H7N7, and H9N2 were selected. The primers and probes used in solid-phase PCR were specific to each virus. A DNA microplate chip-based solid-phase PCR platform was developed for the rapid identification of various influenza virus subtypes. This platform may also be used to simultaneously detect other influenza A subtypes. This high-throughput, rapid, and accurate method may also be employed to discover new virus subtypes and to effectively monitor epidemic situations. Previous microarrays were produced on glass slides (Wang et al., 2008; Sun et al., 2011; Bodrossy and Sessitsch, 2004). The present study is the first to produce a microplate chip. This microplate chip has some advantages, such as avoiding cross-contamination, convenient pretreatment, efficient amplification, and simple result observation.
X.-C. Sun et al. / Journal of Virological Methods 211 (2015) 12–18
17
Fig. 7. Detection sensitivity results of solid phage PCR amplification. (a–f) A1–A9 and B1–B9 series (not including 2A–2B): 1 × g/mL H2N2 plasmid, 1 × 10−1 g/mL H2N2 plasmid, 1 × 10−2 g/mL H2N2 plasmid, 1 × 10−3 g/mL H2N2 plasmid, 1 × 10−4 g/mL H2N2 plasmid, 1 × 10−5 g/mL H2N2 plasmid respectively. microplate 2A-2B: H1N2 plasmid; C1–C9 and D1–D9 series wells: ddH2 O
Fig. 8. Detection sensitivity results of solid phage PCR amplification. (a–e) Microplate 1A–1B and 6C–6D series: plasmid DNA containing influenza A virus M gene; 5C–D series: DDH2 O; others microplate: (a) amplified result of mixed plasmids containing influenza A virus H1N1, H2N2 plasmid dilution products: (a–e) 2A–2B H1N1. Their concentration is 1 g/mL, 1 × 10−1 g/mL, 1 × 10−1 g/mL, 1 × 10−2 g/mL, 1 × 10−3 g/mL, 1 × 10−4 g/mL;4A–4B: H2N2plasmid concentration is 1 g/mL, 1 × 10−1 g/mL, 1 × 10−1 g/mL, 1 × 10−2 g/mL, 1 × 10−3 g/mL, 1 × 10−4 g/mL.
The signal detection enzymatic colorimetric method and fluorescence method were also developed. These two methods could be used for signal detection. The microplate chip using the fluorescence method exhibited higher sensitivity and simpler operations than that using the enzymatic colorimetric method (Figs. 7 and 8). Microarrays were assayed using plasmid DNA that contains the HA gene of influenza virus samples. The detection sensitivity and specificity of the method for each subtype were satisfactory. The microarrays developed in this study will be further improved with respect to the reaction system, reaction conditions, and the design of additional influenza subtype primers and probes. 5. Conclusions This study developed a microplate chip-based solid-phase PCR method that can rapidly detect general influenza virus type A and simultaneously identify the subtypes H1N1, H1N2, H1N1, H2N2, H3N1, H3N2, H5N1, H6, H7N7, and H9N2. This method may also be used to detect pathogenic microorganisms.
Acknowledgement This work was supported by the key scientific and technological research projects of Henan Province, P.R. China (102102310093 and 102102310082). References Bodrossy, L., Sessitsch, A., 2004. Oligonucleotide microarrays in microbial diagnostics. Ecol. Ind. Microbiol. 7, 245–254. Catherine, M., Jean-Noel, T., Sally, C., Moore, C., Telles, J.N., Corden, S., Gao, R.B., Vernet, G., Van Aarle, P., Shu, Y.L., 2010. Development and validation of a commercial real-time NASBA assay for the rapid confirmation of influenza A H5N1 virus in clinical samples. J. Virol. Methods 170, 173–176. Chiapponi, C., Moreno, A., Barbieri, I., Merenda, M., Foni, E., 2012. Multiplex RT-PCR assay for differentiating European swine influenza virus subtypes H1N1, H1N2 and H3N2. J. Virol. Methods 184, 117–120. Collins, R.A., Ko, L.S., Fung, K.Y., Chan, K.Y., Xing, J., Lau, L.T., Yu, A.C., 2003. Rapid and sensitive detection of avian influenza virus subtype H7 using NASBA. Biochem. Biophys. Res. Commun. 300, 507–515. Collins, R.A., Ko, L.S., So, K.L., Ellis, T., Lau, L.T., Yu, A.C., 2002. Detection of highly pathogenic and low pathogenic avian influenza subtype H5 (Eurasian lineage) using NASBA. J. Virol. Methods 102, 213–225.
18
X.-C. Sun et al. / Journal of Virological Methods 211 (2015) 12–18
Fedurco, M., Romieu, A., Williams, S., Lawrence, I., Turcatti, G., 2006. A novel reagent for DNA attachment on glass and efficient generation of solid-phase amplified DNA colonies. Nucleic Acids Res. 3, 22–34. Gall, A., Hoffmann, B., Harder, T., Grund, C., Höper, D., Beer, M., 2009. Design and validation of a microarray for detection, hemagglutinin subtyping and pathotyping of avian influenza viruses. J. Clin. Microbiol. 47, 327–334. Han, X., Lin, X., Liu, B., Hou, Y., Huang, J., Wu, S., Liu, J., Mei, L., Jia, G., Zhu, Q., 2008. Simultaneously subtyping of all influenza A viruses using DNA microarrays. J. Virol. Methods 152, 117–121. Huber, M., Losert, D., Hiller, R., Harwanegg, C., Mueller, M.W., Schmidt, W.M., 2001. Detection of single base alterations in genomic DNA by solid phase polymerase chain reaction on oligonucleotide microarrays. Anal. Biochem. 299, 24–30. Hymas, W.C., Mills, A., Ferguson, S., Langer, J., She, R.C., Mahoney, W., Hillyard, D.R., 2010. Development of a multiplex real-time RT-PCR assay for detection of influenza A, influenza B, RSV and typing of the 2009-H1N1 influenza virus. J. Virol. Methods 167, 113–118. Kaiser, J.A., 2006. One-size-fits-all flu vaccine. Science 5772, 380–382. Kessler, N1, Ferraris, O., Palmer, K., Marsh, W., Steel, A., 2004. Use of the DNA flowthru chip, a three-dimensional biochip, for typing and subtyping of influenza viruses. J. Clin. Microbiol. 42, 2173–2185. Lee, C.S., Kang, B.K., Lee, D.H., Lyou, S.H., Park, B.K., Ann, S.K., Jung, K., Song, D.S., 2008. One-step multiplex RT-PCR for detection and subtyping of swine influenza H1, H3, N1, N2 viruses in clinical samples using a dual priming oligonucleotide (DPO) system. J. Virol. Methods 151, 30–34. Peiris, J.S., Tu, W.W., Yen, H.L., 2009. A novel H1N1 virus causes the first pandemic of the 21(st) century. Eur. J. Immunol. 39, 2946–2954. Mölsä, M., Koskela, K.A., Rönkkö, E., Ikonen, N., Ziegler, T., Nikkari, S., 2012. Detection of influenza A viruses with a portable real-time PCR instrument. J. Virol. Methods 181, 188–191.
Smith, G.J., Vijaykrishna, D., Bahl, J., Lycett, S.J., Worobey, M., Pybus, O.G., Ma, S.K., Cheung, C.L., Raghwani, J., Bhatt, S., Peiris, J.S., Guan, Y., Rambaut, A., 2009. Origins and evolutionary genomics of the 2009 swine-origin H1N1 influenza A epidemic. Nature 459, 1122–1125. Spackman, E., Senne, D.A., Myers, T.J., Bulaga, L.L., Garber, L.P., Perdue, M.L., Lohman, K., Daum, L.T., Suarez, D.L., 2002. Development of a real-time reverse transcriptase PCR assay for type A influenza virus and the avian H5 and H7 hemagglutinin subtypes. J. Clin. Microbiol. 40, 3256–3260. Sun, Y1, Dhumpa, R., Bang, D.D., Handberg, K., Wolff, A., 2011. DNA microarraybased solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7. Diagn. Microbiol. Infect. Dis. 69, 432–439. Tang, Q., Wang, J., Bao, J., Sun, H., Sun, Y., Liu, J., Pu, J., 2012. A multiplex RT-PCR assay for detection and differentiation of avian H3, H5, and H9 subtype influenza viruses and Newcastle disease viruses. J. Virol. Methods 181, 164–169. Wang, L.C., Pan, C.H., Severinghaus, L.L., Liu, L.Y., Chen, C.T., Pu, C.E., Huang, D., Lir, J.T., Chin, S.C., Cheng, M.C., Lee, S.H., Wang, C.H., 2008. Simultaneous detection and differentiation of Newcastle disease and avian influenza viruses using oligonucleotide microarrays. Vet. Microbiol. 127, 217–226. Wu, C., Cheng, X., He, J., Lv, X., Wang, J., Deng, R., Long, Q., Wang, X., 2008. A multiplex real-time RT-PCR for detection and identification of influenza virus types A and B and subtypes H5 and N1. J. Virol. Methods 14, 881–888. Wu, L., Ding, L., Pei, Z., Huo, X., Wen, G., Pan, Z., 2013. A multiplex reverse transcription-PCR assay for the detection of influenza A virus and differentiation of the H1, H3, H5 and H9 subtypes. J. Virol. Methods 188, 47–50. Xie, Z., Pang, Y.S., Liu, J., Deng, X., Tang, X., Sun, J., Khan, M.I., 2006. A multiplex RTPCR for detection of type A influenza virus and differentiation of avian H5, H7, and H9 hemagglutinin subtypes. Mol. Cell. Probes 20, 245–249.
