GENOMICS 14, 249-255 (1992)
Detection of Single DNA Base Mutations with Mismatch Repair Enzymes A-LIEN LU *'1 AND IH-CHANG
HsuI
*Department of Biological Chemistry and t Department of Pathology, School of Medicine, University of Maryland at Baltimore, Baltimore, Maryland 21201 ReceivedMarch 30, 1992; revisedJune 18, 1992
A novel method for identifying DNA point mutations has been developed by using mismatch repair enzymes. T h e h i g h s p e c i f i c i t y o f t h e E s c h e r i c h i a coli M u t Y p r o tein has permitted the development of a reliable and sensitive method for the detection and characterization o f p o i n t m u t a t i o n s in t h e h u m a n g e n o m e . T h e M u t Y p r o t e i n is i n v o l v e d in a r e p a i r p a t h w a y t h a t c a n c o n v e r t A / G o r A/C m i s m a t c h e s to C/G o r G/C b a s e p a i r s , r e s p e c t i v e l y . A / G o r A/C m i s m a t c h e s f o r m e d b y h y b r i d ization between two amplified genomic DNA samples or between specific DNA probes and target DNA are n i c k e d at t h e m i s p a i r e d a d e n i n e s t r a n d b y M u t Y p r o t e i n . A s l i t t l e as 1% o f t h e m u t a n t s e q u e n c e c a n b e detected by the mismatch repair enzyme cleavage ( M R E C ) m e t h o d in a m i x t u r e o f n o r m a l a n d m u t a t e d D N A s (e.g., m u t a n t c e l l s a r e o n l y p r e s e n t in 1% o f t h e normal cell background). By using different probes, the assay also can determine the nucleotide sequence of the m u t a t i o n . W e h a v e a p p l i e d t h i s m e t h o d to d e t e c t s i n g l e b a s e s u b s t i t u t i o n s in h u m a n o n c o g e n e s . © 1992 Academic Press, Inc.
INTRODUCTION The analysis of mismatch formation has important implications in biomedical research because a significant proportion of human disease is caused by singlebase substitutions in the genome. Inherited disorders are due to the existence of variant alleles carried within the germ line. Other acquired diseases such as cancers are the result of somatic mutations within critical genes. Alterations in the cellular genomes that affect the expression or function of genes and control cell growth or differentiation are considered to be the main cause of cancer (Barbacid, 1987). Single-base mutations at codon 12, 13, or 61 of one of the three ras genes occur in a significant proportion of human cancers. The highest incidences are found in adenocarcinomas of the pancreas (90%), the colon (50%), and the lung (30%); in thyroid tumors (50%); and in myeloid leukemia (30%) 1 To whom correspondence should be addressed. 249
(Bos, 1989). Increasing data show t h a t deletion or mutation of the tumor suppressor genes can lead to malignancy (Weinberg, 1991). Base substitution mutations in the p53 tumor suppressor gene are localized to some conserved codons but differ among diverse types of human cancer (Hollstein et al., 1991). Direct gene analysis will play an increasingly import a n t role in clinical diagnosis as the molecular basis of human disease is defined. Single-base substitutions can be detected by a variety of techniques (Cotton, 1989; Landegren et al., 1988a). These include Southern hybridization of restriction fragment length polymorphisms, oligodeoxynucleotide hybridization assay (Conner et al., 1983), direct DNA sequencing of amplified genes (Wong et al., 1987) by polymerase chain reaction (PCR 2) (Saiki et al., 1985), RNase mismatch cleavage assay (Myers et al., 1985; Winter et al., 1985), denaturing gradient gel electrophoresis (Myers et al., 1987), oligonucleotide ligation assay (Landegren et al., 1988b; Alves and Carr, 1988; Wu and Wallace, 1989), and allele-specific PCR amplification (Chehab and Kan, 1989; Gibbs et al., 1989; Newton et al., 1989; Wu et al., 1989). The oligonucleotide ligation assay has been automated for DNA diagnosis (Nickerson et al., 1990). However, these methods cannot reliably detect a base change in a DNA sample contaminated with more than 80% of normal DNA. The sample contamination problem is especially significant in the case of cancer detection. The presence of normal cells in tumors can produce ambiguities in both the qualitative and quantitative interpretation of results. The specific assignment of mutation to tumor cells requires purification of the tumor cell population (Burmer and Loeb, 1989). We have developed a sensitive and accurate method for detecting single-base substitutions. The assay relies on the high mismatch specificity of E. coli MutY protein (Lu and Chang, 1988; Au et al., 1989; Tsai-Wu et al., 1991). The nicking activity of MutY is specific for A/Gcontaining (weakly on A/C-containing) DNA fragments Abbreviations used: PCR, polymerase chain reaction; 4dNTP, four deoxyribose nucleoside triphosphates; MREC, mismatch repair enzyme cleavage. 0888-7543/92 $5.00 Copyright © 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
250
LU AND HSU TABLE 1
S e q u e n c e s o f the O l i g o n u c l e o t i d e s U s e d in T h i s Study" Chang A16 Chang G16 Chang 23 107n N-ras-61 probe Chang 31 50n N-ras-61 probe P1 103bp left primer P2 103 bp right primer P3 48 bp left primer P4 48 bp right primer P5 210 bp left primer P6 210 bp right primer
5'AATTGTCCTTAAGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGAATTAGGCTTTCCCCGTCAAGCTCTAAA TCGGGGGCTCCCTTTAGGGTTCCGATCTCGAGCTTTACGGCC 3' 5•CCGGGGCCGTAAAGCTCGAGATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGAATTCGGCGAA CGTGGCGAGAAAGGAAGGGAAGAAAGCTTAAGGAC 3' 5'TTGGGGTGAAACCTGTTTGTTGGACATACTGGATACAGCTGGACGAGAAGAGTACAGTGCCATGAGAGACCAATAC ATGAGGACAGGCGAAGGCTTCCTCTGTGTAT 3' 5'GGTGGACATACTGGATACAGCTGGACGAGAAGAGTACAGTGCCATGAGAG 3'
5'GGTGAAACCTGTTTGTTGGA 3' 5'ATACACAGAGGAAGCCTTCG 3' 5'TGGACATACTGGATACAGCT 3' 5'CTCTCATGGCACTGTACTCT 3' 5'GATCGAATTCGATTCTTACAGAAAACAAGT 3' 5'CTAGTTCGAATCCTAGTACCTGTAGAGGTT 3'
a Bases in boldface can form mismatches with target DNA and underlined bases form protruding ends for label with Klenow fragment after anneal with the complementary strand or PCR products.
a n d has no cleavage activity on D N A c o n t a i n i n g the o t h e r m i s p a i r s or h o m o d u p l e x D N A . T h e M u t Y p r o t e i n h a s b o t h N - g l y c o s y l a s e a n d 3' a p u r i n i c / a p y r i m i d i n i c e n d o n u c l e a s e a c t i v i t i e s ( T s a i - W u e t al., 1992). T h e glycosylase r e m o v e s t h e m i s p a i r e d a d e n i n e s o f A / G a n d A / C m i s m a t c h e s , a n d t h e e n d o n u c l e a s e a c t s o n t h e first p h o s p h o d i e s t e r b o n d 3' to t h e a p u r i n i c / a p y r i m i d i n i c sites. N o i n c i s i o n site w a s d e t e c t e d o n t h e o t h e r m i s p a i r e d g u a n i n e - c o n t a i n i n g s t r a n d , Specific D N A p r o b e s c a n b e d e s i g n e d to f o r m a n A / G or a n A / C m i s m a t c h w i t h o n e s t r a n d of t h e t a r g e t D N A so t h a t t h e r e s u l t i n g h e t e r o d u p l e x is s e n s i t i v e t o t h e M u t Y p r o t e i n . O u r a s s a y has higher sensitivity than direct DNA sequencing. A single-base change in a tumor DNA sample contamin a t e d b y 99% n o r m a l D N A c a n be e a s i l y d e t e c t e d . T h i s m i s m a t c h repair e n z y m e cleavage ( M R E C ) assay has applications in both basic cancer research and clinical d i a g n o s i s s u c h as m o n i t o r i n g t h e p r o g r e s s o f t h e t r e a t m e n t s a n d e a r l y d e t e c t i o n of t h e c a n c e r . MATERIALS AND METHODS Human SK-N-SH neuroblastoma cells with a point mutation at codon 61 of the N-ras (CAA to AAA) (Taparowsky et al., 1983) and Hep-G-2 cells from a human hepatoblastoma that was heterozygous with CAA/CTA for codon 61 of the N - r a s (Hsu et al., 1990) were purchased from American Type Culture Collection. However, we found the majority of the SK-N-SH cell culture had a normal ras gene. A culture of the SK-N-SH cells without subcloning and purification contains about 90% of normal cells. Normal human liver tissue was obtained at autopsy (Hsu et al., 1985). Total DNA was isolated from these cells according to the method of Hsu et al. (1990). The region spanning codon 61 of the N-ras gene was amplified by PCR (Saiki et al., 1985) using a pair of oligonucleotides listed in Table 1. PCR products were purified and sequenced by the dideoxy method (Sanger et al., 1977) as described by Hsu et al. (1991). Oligonucleotide primers and repair probes (Table 1) were synthesized using the standard phosphoramidite chemistry on an Applied
Biosystems DNA synthesizer. Oligonucleotides were purified by 8-20% sequencing gels. Oligonucleotides Chang A16 and Chang G16 were annealed to form duplex DNA with an A/G mismatch at position 51. They previously have been used in A/G endonuclease assays (Yeh et al., 1991). Repair probes (Chang 23 and 31) were hybridized to PCR products at 90°C for 3 rain and reannealed gradually to room temperature over 30 min. The probes were designed such that they would contain two to four nucleotides of overhanging sequence at their 5' ends after annealing with the PCR products (see Fig. 1). The resulting recessed 3' ends were labeled by using Klenow fragment of DNA polymerase I and [a-32P]dATP and unlabeled dCTP for probe Chang 23 and [a-32P]dCTP for probe Chang 31 (Maniatis et al., 1982). Unincorporated free nucleoside triphosphates were removed by passing through a Sepadex G25 Quick-Spin column (Boehringer-Mannheim Corp.). The PCR product from SK-N-SH was labeled at both 5' ends with polynucleotide kinase and [7-~2P]ATP. After removing the unincorporated [~,-s2P]ATP, the DNA was denatured at 90°C for 3 rain and reannealed gradually to room temperature over 30 min. Cleavage by E. coli MutY was performed as described in Lu and Chang (1988). Hybrid DNA (1.8 fmol, 2000-6000 cpm) was cut with 30 units of MutY (Fraction V prepared as described in Tsai-Wu et al., 1991) in 10 #1 reaction containing 20 mM Tris-HC1, pH 7.6, 80 mM NaC1, 1 mM dithiothreitol, 1 mM EDTA, and 2.9% (v/v) glycerol for 30 rain at 30°C. After incubation, DNA samples were lyophilized and redissolved in 3 #1 of 90% (v/v) formamide, 10 mM EDTA, 0.1% (w/v) xylene cyanol, and 0.1% (w/v) bromophenol blue. DNA was denatured at 90°C for 3 rain and applied to a standard 8% polyacrylamide-8.3 M urea sequencing gel for eleetrophoresis (Maxam and Gilbert, 1980). RESULTS Experimental
Design
T h e a s s a y s t r a t e g y is i l l u s t r a t e d i n T a b l e 2. F o u r p o s s i ble o l i g o n u c l e o t i d e p r o b e s c a n b e s y n t h e s i z e d . P r o b e s I a n d I I c o r r e s p o n d to t h e c o d i n g s e q u e n c e of t h e g e n e o f i n t e r e s t , a n d p r o b e s I I I a n d I V are c o m p l e m e n t a r y to p r o b e s I a n d II. P r o b e s I a n d I I I c o n t a i n a d e n i n e a n d probes II a n d IV c o n t a i n g u a n i n e at the p a r t i c u l a r posi-
GENE DIAGNOSIS WITH MISMATCH REPAIR ENZYMES
251
TABLE 2 E x p e c t e d M i s m a t c h F o r m a t i o n a n d C l e a v a g e R e s u l t s by U s i n g E s c h e r i e h i a coli MutY
Sequence at the mutation site
I*" (coding, A)
IIb (coding, G)
III*a (noncoding, A)
IVb (noncoding, G)
A T
A* T (-)
G T* (-)
A A* (-)
A* G (++)c
C a
A* G (++)
G G* (-)
C A* (+)
C* G (-)
G C
A* C (+)
G C* (-)
G A* (++)
G* G (-)
T h
A* h (-)
G A* (++)
T A* (-)
T* G (-)
Note. * represents the labeled strand. a Use 5' end-labeledoligonucleotideprobe. bUse unlabeled oligonucleotideto hybridizelabeled PCR-amplifiedN-ras gene. c Expectedpositive result (++) for A/G mismatch-containingDNA that can be nicked well by MutY and (+) for A/C mismatch-containing DNA that is nicked weaklyby MutY. tion where the mutation occurs. Probes I and III can be end-labeled at the 5' end by polynucleotide kinase (Maniatis et al., 1982), while probes II and IV are not labeled (here the PCR-amplified DNAs are labeled). Depending on the sequence of the genomic DNA at the particular position, the probe will generate no mismatch or certain base mismatch after hybridization with PCR products (Table 2). Th e hybrids will be digested with E. coli MutY (Lu and Chang, 1988; Au et al., 1989; Tsai-Wu et al., 1991), and the cleavage products will be analyzed by denaturing gel electrophoresis. Due to the specificity of MutY, DNA t h a t forms an A / G (++) or A/C (+) mismatch with the probe can be detected and localized by the presence and size of mismatch-specific subfragments (positive result). For example, if the target sequence is A (Table 2, line 1), a digestion product will be observed when labeled PCR-amplified gene is hybridized to probe IV. If the target sequence is C (Table 1, line 2), a strong digestion product will be observed when labeled probe I is used, and a weak product can be detected when labeled probe III is used. Higher concentration of MutY enzyme must be used to detect nicking on A/Ccontaining DNA (Tsai-Wu et al., 1992). In this way, one probe is required to detect one kind of mutation. By using all four probes, any sequence change at this position t hat may have arisen by mutation can be detected.
Analysis of D N A Change in H u m a n Liver Tumor Cells We chose single-base mutations at codon 61 of the human N-ras gene to develop the methodology. T h e schematic representation of the assay is shown in Fig. 1. In h u man liver tumor Hep-G-2 cells, one allele has a single-base change at codon 61-CAA (Glu) to CTA (Leu) and the other allele is normal (Fig. 2A, lanes 1-4). This single-base change can be detected by the mismatch repair enzyme cleavage method. Total genomic DNA was isolated from hum a n normal liver cells or H E P - G - 2 cells, and a 103-bp DNA fragment containing codon 48
to codon 81 of the N-ras gene was amplified by P C R (Saiki et al., 1985). This PCR product was hybridized to a 107-nucleotide DNA probe (Chang 23, type II according to Table 2) which contains the 103 nucleotides corresponding to the coding strand of the PCR product except t hat the sequence for codon 61 is CGA and 4 extra nucleotides (T T G G ) are present at its 5' end (Table 1). T h e probe generates a T / G and an A/G mismatch with the PCR product from normal and tumor DNA, respectively. These hybrid DNAs with 5' overhanging ends were then filled in with Klenow fragment in a reaction buffer containing d C T P and [a-32P]dATP. T h e labeled DNAs were digested with E. coli MutY (Fraction V, Tsai-Wu et al., 1991), and the products were analyzed by denaturing gel electrophoresis. A mutation within the tumor DNA was detected and localized by the presence of a 44-nucleotide fragment. Figure 2B shows the results of these experiments. T he 44-nucleotide cleavage product could be detected only in the tumor DNA/probe hybrid and not in the normal DNA/probe hybrid. Using a shorter probe (50-mer) in similar experiments, a 26-nucleotide digestion product was observed in the tumor DNA/probe hybrid (Fig. 2C, lane 4) but not in the normal DNA/probe hybrid (Fig. 2C, lane 3). This method also has been used to detect a single-base mutation at codon 12 of the hum an K-ras gene with a 48-mer probe (data not shown). Therefore, the method should be useful in the detection of other inherited genetic a n d / or somatic mutations.
Sensitivity of the Assay T o test whether the MRE C method is sufficiently sensitive to detect a small subpopulation of single-base mutations, the tumor DNA/probe hybrid was diluted with an increasing amount of normal DNA/probe hybrid and then cleaved with E. coli MutY protein. As shown in Fig. 3, the specific 44-nucleotide product still could be detected in the 1/50 dilution when the DNA was di-
252
LU AND HSU Normal Cells
Tumor Cells
Genoml¢ DNA
~ PCR Amplify N - R a s
--A . . . .
T .
.
103-bp .
.
.
.
.
.
..... T .
.
A . . . . . . .
TTGG
G
ybrldization Ith 107n Probe TTGG ----
G T--
- .
.
.
.
TTGG .
G --A
- . . . . .
-
Klenow Fragment dCTP TTGG AACC
....
G - T . . . . . .
+[o(-32P]d
TTGG AACC ....
ATP
G - A . . . . . .
g e n o m i c D N A f r o m t h e S K - H - S H cell l i n e w a s a m p l i fied b y P C R a n d s e q u e n c e d , s u r p r i s i n g l y , t h e m a j o r i t y o f t h e D N A w a s C A A ( a r r o w in Fig. 4A, l a n e s 1 - 4 ) . W e infer that the majority population from the stock of A m e r i c a n T y p e c u l t u r e c o l l e c t i o n h a s a n o r m a l r a s gene. W e e s t i m a t e t h a t n o m o r e t h a n 10% o f t h e p o p u l a t i o n h a d A A A m u t a t i o n s (* i n Fig. 4A, l a n e 2), b e c a u s e t h e A band was hardly distinguishable from the background in t h e s e q u e n c i n g gel. T h e D N A i s o l a t e d f r o m S K - H - S H cells, w h i c h c o n t a i n e d m o s t l y t h e n o r m a l N - r a s g e n e s a n d a s m a l l p r o p o r t i o n o f m u t a t e d N - r a s alleles, w a s d e n a t u r e d , r e n a t u r e d , a n d d i g e s t e d w i t h t h e E. coli M u t Y enzyme. By these procedures, some heteroduplexes s h o u l d c o n t a i n A / G m i s m a t c h e s a t c o d o n 61 o f N - r a s that would be sensitive to the MutY protein. A 79-nuc l e o t i d e d i g e s t i o n p r o d u c t w a s c l e a r l y p r e s e n t in t h e M u t Y - t r e a t e d s a m p l e w i t h v e r y l i t t l e b a c k g r o u n d (Fig. 4B, c o m p a r e l a n e s 1 a n d 2).
Cut with E. co/i MutY TTGG AACC
...... G - .... T ......
TTGG
G
AACC----.A: I
Sequencing
No Reaction
-
DISCUSSION
-
1
Gel
44-n Product
FIG. 1. Schematic representation of the MREC method to detect a single base substitution. A 107-nucleotide probe (Chang 23) generates a T/G and an A/G mismatch after hybridization with the PCR product from normal and tumor DNA, respectively. These hybrid DNAs with 5' overhanging ends were then filled in with Klenow fragment in a reaction mix containing dCTP and [a-a2P]dATP. The labeled DNAs were digested with Escherichia coli MutY (Fraction V) (Tsai-Wu et al., 1991), and the products were analyzed by denaturing gel electrophoresis. Tumor DNA is detected by the presence of a 44nucleotide fragment. Coding strands are presented as solid lines and noncoding strands as dotted lines. Stars underneath bases represent a2P-labeled nucleotides. When a shorter probe (Chang 31) was used, the hybrid DNA was labeled with [a-~2P]dCTP, and a 26-nucleotide digestion product was generated. g e s t e d w i t h M u t Y p r o t e i n ( F r a c t i o n V). B e c a u s e t h e H e p - G - 2 t u m o r D N A is h e t e r o z y g o u s for t h e N - r a s g e n e (Fig. 2, l a n e s 1 - 4 ) , w e e s t i m a t e t h e s e n s i t i v i t y o f t h e ass a y t o b e u p t o 1%. T h u s , a s i n g l e - b a s e c h a n g e i n g e n o m i c D N A f r o m t u m o r c e l l s t h a t a r e p r e s e n t in o n l y 1% o f a n o r m a l cell b a c k g r o u n d c a n b e d e t e c t e d b y t h e M R E C method. The high sensitivity of our method was confirmed by t h e f o l l o w i n g e x p e r i m e n t s . A h u m a n n e u r o b l a s t o m a cell line (SK-N-SH) has been reported to have a single-base c h a n g e a t c o d o n 61 o f N - r a s [C_AA ( G l u ) t o A_AA ( L y s ) ] ( T a p a r o w s k y e t al., 1983). T h i s C / G t o A / T t r a n s v e r s i o n is u s e f u l f o r t h e M R E C a s s a y w i t h M u t Y p r o t e i n . A n A/G mismatch can be formed when DNA from normal and SK-H-SH cells are cross-hybridized. The resulting m i s m a t c h c a n b e d e t e c t e d b y M u t Y p r o t e i n (see Fig. 4). We tried to take advantage of this specific mutation because the A/G mismatch can be detected by the MREC method without the need of a synthetic probe. When
A s e n s i t i v e a n d r e l i a b l e m e t h o d for d e t e c t i n g s i n g l e base substitutions has been developed. The method employs synthetic oligonucleotides that hybridize to PCR products from target DNA or hybridization between two P C R - a m p l i f i e d p r o d u c t s f r o m g e n o m i c D N A . I f t h e r e is 1 G
A
T
C
1
2
3
4
234
56 1 107
-;!!;~i;61
A
2
3
4 ~ 50
70
)
~26
~*
A
;:= i ¸ ~
44
S
FIG. 2. (A) Direct sequencing of the PCR product from the human liver tumor cell line Hep-G-2. Arrow indicates the mutation site at codon 61 of the N-ras gene. The N-ras gene is heterozygous at codon 61 (CAA and CTA). (B) Identification of a mutation at the N-ras gene by the MREC method with E. coli MutY protein. N-ras DNAs from normal (lanes 1 and 2) and Hep-G-2 liver tumor (lanes 3 and 4) were amplified by PCR to generate 103-bp fragments, which were then hybridized to a 107-nucleotide synthetic probe (Chang 23) and labeled at the 3' end of the noncoding strand as described in Fig. 1. These DNA hybrids were cut with E. coli MutY enzyme (Fraction V) (lanes 2 and 4) and analyzed on an 8% sequencing gel with an unpurified 5' end-labeled synthetic 40-met as a size marker (lane 6). As a control, Fraction V was also used to cut a 120-bp synthetic fragment containing an A/G mismatch (annealed Chang A16 and Chang G16 and filled in with [~-32P]dCTP and followed by 4dNTP) (Yeh et aL, 1991) to generate a 70-nucleotide product (lane 5). (C) A shorter probe (Chang 31, 50-met) was used in the assay similar to that in (B). Lane 1, untreated normal DNA; lane 2, MutY-treated normal DNA; lane 3, untreated tumor DNA; and lane 4, MutY-treated tumor DNA. A specific 26-nucleotide cleavage product was generated in lane 4.
GENE DIAGNOSIS WITH MISMATCH REPAIR ENZYMES -V
+V
if
I i
-=
o
1
2
3
4
5
6
o
7
8 9101112
*- 4 4
FIG. 3. Sensitivity of the MREC method with E. coli MutY protein. The Hep-G-2 tumor DNA/probe hybrid was diluted with increasing amount of normal DNA/probe hybrid (1/0 to 1/100) (lanes 1-6) and then cleaved with Fraction V (lanes 7-12). The 44-nucleotide product can still be seen at 1/50 dilution. a n A / G or A / C m i s m a t c h , the E. coli M u t Y p r o t e i n (Lu a n d Chang, 1988; Au et al., 1989; T s a i - W u et al., 1991) nicks t h e h y b r i d D N A on t h e m i s p a i r e d adenine strand. A / G m i s m a t c h e s c a n be distinguished f r o m A / C mism a t c h e s b y t h e i r higher activity to M u t Y protein. I f t h e r e is p e r f e c t c o m p l e m e n t a r i t y or o t h e r t y p e s of mism a t c h e s , t h e E. coli M u t Y p r o t e i n will n o t cleave the D N A . T h i s powerful m e t h o d h a s b e e n applied to detect p o i n t m u t a t i o n s w i t h i n t h e N - r a s gene of h u m a n liver t u m o r cells. Several m e t h o d s h a v e b e e n developed to diagnose b a s e s u b s t i t u t i o n s (Cotton, 1989; L a n d e g r e n et al., 1988a). H y b r i d i z a t i o n or R N a s e m i s m a t c h assays occasionally give false positive or negative results due to t h e high b a c k g r o u n d or p o o r e n z y m e specificity ( C o n n e r et al., 1983; M y e r s et al., 1985; W i n t e r et al., 1985). T h e ligation m e t h o d is b a s e d on t h e ability of two oligonucleotides to a n n e a l i m m e d i a t e l y a d j a c e n t to each o t h e r on a c o m p l e m e n t a r y t a r g e t D N A molecule ( L a n d e g r e n et al., 1988b; Alves a n d Carr, 1988; W u a n d Wallace, 1989). T h e conditions of ligation m u s t be adjusted to m i n i m i z e ligation w h e n a m i s m a t c h occurs at either side of t h e p o i n t of ligation. T h e allele-specific amplification m e t h o d uses two p r i m e r s in a P C R reaction. One p r i m e r is p e r f e c t l y m a t c h e d w i t h the t e m p l a t e D N A , a n d the o t h e r p r i m e r is either m a t c h e d or m i s m a t c h e d at the 3' terminal with the template D N A after hybridization ( C h e h a b a n d K a n , 1989; G i b b s et al., 1989; N e w t o n et al., 1989; W u et al., 1989). C o n d i t i o n s m u s t be e s t a b l i s h e d such t h a t a P C R p r o d u c t is p r o d u c e d in the f o r m e r case b u t n o t in t h e latter case. T h i s m e t h o d s o m e t i m e s is unreliable due to c o n t a m i n a t i o n of n o r m a l sequences f r o m n o r m a l cells. S o m e m i s m a t c h e s (like G / T a n d A / C) c a n f o r m stable b a s e p a i r i n g a n d t h u s give false re-
253
sults. D N A sequencing is p r o b a b l y t h e m o s t accurate a s s a y b u t is laborious a n d insensitive ( W o n g et al., 1987). I t c a n n o t d e t e r m i n e u n a m b i g u o u s l y a b a s e change in a D N A s a m p l e c o n t a m i n a t e d w i t h m o r e t h a n 80% of n o r m a l D N A . T h e g r e a t e s t a d v a n t a g e of t h e M R E C m e t h o d is its high sensitivity relative to o t h e r m e t h o d s (Cotton, 1989; L a n d e g r e n et al., 1988a). T h e assay c a n detect t h e specific cleavage p r o d u c t even w h e n m u t a n t cells are only p r e s e n t e d in 1% of n o r m a l cell b a c k g r o u n d . F o r diagnosis of m u t a t i o n in h u m a n genetic disease, the high sensitivity of t h e a s s a y is n o t necessary, because cells are eit h e r h o m o z y g o u s or heterozygous. H o w e v e r , t h e presence of n o r m a l cells in t u m o r s is a significant p r o b l e m in cancer detection. D e t e c t i o n of m u t a t i o n s within oncogenes or t u m o r s u p p r e s s o r genes in t h e early developm e n t of h u m a n c a n c e r is i m p e d e d b y the low a b u n d a n c e of the t u m o r cells of early stages. Our assay c a n overcome this s a m p l e c o n t a m i n a t i o n p r o b l e m w i t h o u t the histological e n r i c h m e n t a n d cell sorting p r o c e d u r e s as used b y B u r m e r a n d L o e b (1989). T h e M R E C m e t h o d , like the R N a s e I cleavage a s s a y (Myers et al., 1985; W i n t e r et al., 1985), has the a d v a n t a g e of defining t h e location of t h e b a s e change. T h i s is useful in screening for new m u t a t i o n s . As listed in T a b l e 2, b y using all four probes, t h e M R E C assay c a n d e t e r m i n e t h e n a t u r e of a b a s e sequence. T h e r e f o r e t h e a s s a y not only detects m u t a t i o n s b u t also d e t e r m i n e s t h e sequence changes of m u t a t i o n s . T h i s c e r t a i n l y is simpler a n d m o r e sensitive t h a n direct sequencing. T h e M R E C a s s a y using E. coli M u t Y enzyme is especially useful for C / G to A / T t r a n s v e r s i o n m u t a t i o n s . In this case, no specific p r o b e is needed. G A
T C
1 2 3 4 12 210
:;:::
A ] A 61 ,--(C/a) 79
FIG. 4. (A) Direct DNA sequencing of the PCR product from human neuroblastoma cell line SK-N-SH. Arrow indicates the mutation site at codon 61 of the N-ras gene. * indicates the weak A band in SK-N-SH DNA sample and suggests that the majority of the population is normal cells and no more than 10% of the cell population contain AAA mutations. (B) PCR-amplified DNA (210 bp) from this cell line was labeled at both 5' ends with polynucleotide kinase and [.),_sup]. ATP. The PCR products were self-annealed to form A/G mismatches between normal and tumor DNAs (lane 1) and treated with E. coli MutY protein (lane 2). A 79-nucleotide digestion product shown in the autoradiogram was clearly present in the treated sample with very little background (compare lanes 1 and 2).
254
LU AND HSU
P C R - a m p l i f i e d D N A f r o m m u t a n t cells c a n b e h y b r i d i z e d t o D N A f r o m n o r m a l cells, a n d t h e A / G m i s m a t c h e s formed are sensitive to MutY protein. Recently, MutY h a s b e e n s h o w n t o a c t o n A / C - c o n t a i n i n g D N A , b u t 20f o l d m o r e e n z y m e is r e q u i r e d t o give t h e s a m e a c t i v i t y a s A / G - c o n t a i n i n g D N A ( T s a i - W u e t al., 1992). T h e r e f o r e , with higher enzyme concentration, the MREC method with MutY can also detect C/G to T/A or A/T to G/C transitions by direct hybridization between normal and mutant DNAs. Because transition mutations occur more frequently than transversions, detection of A/C m i s m a t c h e s is v a l u a b l e . A highly specific mismatch recognition endonuclease is u s e d in o u r a s s a y . I n a d d i t i o n t o t h e E . coli M u t Y , other DNA mismatch repair enzymes can be applied in this method. T/G mismatch-specific nicking enzymes f r o m H e L a n u c l e a r e x t r a c t ( W i e b a u e r a n d J i r i c n y , 1989, 1990) a n d f r o m E . coli ( H e n n e c k e e t al., 1991) h a v e b e e n described. Accordingly, specific probes can be designed as in T a b l e 2, a n d h y b r i d D N A c a n b e d i g e s t e d w i t h T / G - s p e c i f i c e n d o n u c l e a s e . T h i s T / G e n d o n u c l e a s e is most useful for detecting C/G to T/A transition mutations by hybridization between normal and mutant DNAs. The MREC assay could also use mismatch-recognition enzymes with lower mismatch specificity. The h u m a n a n d y e a s t a l l - t y p e e n d o n u c l e a s e ( Y e h e t al., 1991; C h a n g a n d L u , 1991) c a n n i c k all e i g h t - b a s e m i s m a t c h e s and can be employed for general screening for any mutat i o n s w i t h i n i n t e r v a l s . I n t h i s case, P C R p r o d u c t s f r o m normal and potential mutant DNAs can be hybridized and tested by the human or yeast all-type endonuclease. T h e d i s a d v a n t a g e o f u s i n g t h e a l l - t y p e e n z y m e s is t h a t d i f f e r e n t m i s m a t c h e s a r e r e c o g n i z e d w i t h d i f f e r e n t efficiencies and neighboring sequence environment has s o m e effect o n c l e a v a g e ( C h a n g a n d L u , 1991; Y e h e t al., 1991; Y e h a n d L u , u n p u b l i s h e d r e s u l t s ) . T h i s c o u l d b e overcome by labeling the PCR products at different ends. Using these different mismatch-recognition enzymes, the MREC method promises to be a useful tool for genetic screening.
ACKNOWLEDGMENTS This work was supported by Grant GM 35132 from the National Institute of General Medical Sciences (to A-L.L.), by Grant BS460 from the American Cancer Society, by Grant R-818104 from the Environmental Protection Agency (to I.-C.H.), and in part by a Special Research Initiative Support Award from UMAB Designated Research Initiative Fund. The authors thank Drs. R. Metcalf and R. Wade for critical reading of the manuscript. REFERENCES
Alves, A. M., and Cart, F. J. (1988). Dot-blot detection of point mutations with adjacently hybridizing synthetic oligonucleotide probes. Nucleic Acids Res, 16: 8723. Au, K. G., Clark, S., Miller, J. H., and Modrich, P. (1989). Escherichia coli m u t Y gene encodes an adenine glycosylase active on G-A mispairs. Proc. Natl. Acad. Sci. USA 8{}: 8877-8881. Barbacid, M. (1987). ras genes. Annu. Rev. Biochem. 56: 779-827.
Bos, J. L. (1989). ras oncogenes in human cancer: A review. Cancer Res. 49: 4682-4689. Burmer, G. C., and Loeb, L. A. (1989). Mutations in the K-ras2 oncogene during progressive stages of human colon carcinoma. Proc. Natl. Acad. Sci. USA 86: 2403-2407. Chang, D.-Y., and Lu, A-L. (1991). Base mismatch-specific endonuclease activity in extracts from Saccharomyces cerevisiae. Nucleic Acids Res. 19: 4761-4766. Chehab, F. F., and Kan, Y. W. (1989). Detection of specific DNA sequences by fluorescence amplification: A color complementation assay. Proc. Natl. Acad. Sci. USA 86: 9178-9182. Conner, B. J., Reye, A. A., Morin, C., Itakura, K., Teplitz, R. L., and Wallace, R. B. (1983). Detection of sickle cell ~S-globin allele by hybridization with synthetic oligonucleotides. Proc. Natl. Acad. Sci. USA 80: 278-282. Cotton, R. G. H. (1989). Detection of single base changes in nucleic acids. Biochem. J. 263: 1-10. Gibbs, R. A., Nguyen, P.-N., and Caskey, C. T. (1989). Detection of single DNA differences by competitive oligonucleotide priming. Nucleic Acids Res. 17: 2437-2448. Hennecke, F., Kolmar, H., Brundl, K., and Fritz, H.-J. (1991). The vsr gene product ofE. coli K-12 is a strand- and sequence-specific DNA mismatch endonuclease. Nature 353: 776-778. Hollstein, M., Sidransky, D., Vogelstein, B., and Harris, C. C. (1991). p53 mutations in human cancers. Science 253: 49-53. Hsu, I. C., Lipsky, M. M., Cole, K. E., Su, C. H., and Trump, B. F. (1985). Isolation and culture of hepatocytes from liver of immediate autopsy. I n Vitro Cell. Dev. Biol. 21: 154-160. Hsu, I. C., Metcalf, R. A., Su, T., Welsh, J. A., Wang, N. J., and Harris, C. C. (1991). p53 gene mutational hotspot in human hepatocellular carcinoma. Nature 350: 427-428. Hsu, I. C., Welsh, J. A., Metcalf, R. A., Brash, D., Su, T., and Harris, C. C. (1990). Oncogene mutation in human liver tumor cells determine by PCR amplification and direct DNA sequencing. Proc. Natl. Am. Assoc. Cancer Res. 31: 806. Landegren, U., Kaiser, R., Caskey, C. T., and Hood, L. (1988a). DNA diagnostics--Molecular techniques and automation. Science 242: 229-237. Landegren, U., Kaiser, R., Sanders, J., and Hood, L. (1988b). A ligasemediated gene detection technique. Science 241: 1077-1080. Lu, A-L., and Chang, D. Y. (1988). A novel nucleotide excision repair for the conversion of an A/G mismatch to C/G base pair in E. coli. Cell 54: 805-812. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982). "Molecular cloning: A Laboratory Manual," Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Maxam, A. M., and Gilbert, W. (1980). Sequencing end-labeled DNA with base-specific chemical cleavage. Methods Enzymol. 65: 499560. Myers, R. M., Latin, Z., and Maniatis, T. (1985). Detection of single base substitutions by ribonuclease cleavage at mismatches in RNA:DNA duplexes. Science 230: 1242-1246. Myers, R. M., Maniatis, T., and Lerman, L. S. (1987). Detection and localization of single base changes by denaturing gradient gel electrophoresis. Methods Enzymol. 155: 501-527. Newton, C. R., Graham, A., Heptinstall, L. E., Summers, S. J., Kalsheker, N., Smith, J. C., and Markham, A. F. (1989). Analysis of any point mutation in DNA, the amplification refractory mutation system (ARMS). Nucleic Acids Res. 17: 2503-2516. Nickerson, D. A., Kaiser, R., Lappin, S., Stewart, J., Hood, L., and Landegren, U. (1990). Automated DNA diagnostics using an ELISA-based oligonucleotide ligation assay. Proc. Natl. Acad. Sci. USA 87: 8923-8927. Saiki, R., Sharf, S., Foloona, F., Mullis, K., Horn, G., Erlich, H. A., and Arnheim, N. (1985). Enzymatic amplification of fl-globin geno-
GENE DIAGNOSIS W I T H MISMATCH REPAIR ENZYMES mic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 2 3 0 : 1350-1353. Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad, Sci. USA 74: 5463-5467. Taparowsky, E., Shimizu, K., Goldfarb, M., and Wigler, M. (1983). Structure and activation of the human N-ras gene. Cell 34: 581586. Tsai-Wu, J.-J., Radicella, J. P., and Lu, A-L. (1991). Nucleotide sequence of the Escherichia coli micA gene required for A/G-specific mismatch repair: Identity of MicA and MutY. J. Bacteriol. 173: 1902-1910. Tsai-Wu, J.-J., Liu, H.-F., and Lu, A-L. (1992). Escherichia coli MutY protein has both N-glycosylase and apurinic/apyrimidinic (AP) endonuclease activities on A/C and A/G mispairs. Proc. Natl. Acad. Sci. USA, in press. Weinberg, R. (1991). Tumor suppressor genes. Science 2 5 4 : 11381146. Wiebauer, K., and Jiricny, J. (1989). In vitro correction of G. T mispairs to G. C pairs in nuclear extracts from human cells. Nature 3 3 9 : 234-236. Wiebauer, K., and Jiricny, J. (1990). Mismatch-specific thymine DNA
255
glycosylase and DNA polymerase/~ mediate the correction of G. T mispairs in nuclear extracts from human cells. Proc. Natl. Acad. Sci. USA 87: 5842-5845. Winter, E., Yamamoto, F., Almoguera, C., and Perucho, M. (1985). A method to detect and characterize point mutations in transcribed genes: Amplification and overexpression of the mutant c-Ki-ras allele in human tumor cells. Proc. Natl. Acad. Sci. USA 82: 75757579. Wong, C., Dowling, C. E., Saiki, R. K., Higuchi, R. G., Erlich, H. A., and Kazazian, H. H., Jr. (1987). Characterization of ~-thalassemia mutations using direct genomic sequencing of amplified single copy DNA. Nature 3 3 0 : 384-386. Wu, D. Y., Ugozzoli, L., Pal, B. K., and Wallace, R. B. (1989). Allespecific enzymatic amplification of f~-globin genomic DNA for diagnosis of sickle cell anemia. Proc. Natl. Acad. Sci. USA 86: 27572760. Wu, D. Y., and Wallace, R. B. (1989). The ligation amplification reaction (LAR)-amplification of specific DNA sequences using sequential rounds of template-dependent ligation. Genomics 4: 560-569. Yeh, Y.-C., Chang, D.-Y., Masin, J., and Lu, A-L. (1991). Two nicking enzyme systems specific for mismatch-containing DNA in nuclear extracts from human cells. J. Biol. Chem. 2 6 6 : 6480-6484.
Detection of Single DNA Base Mutations with Mismatch Repair Enzymes A-LIEN LU *'1 AND IH-CHANG
HsuI
*Department of Biological Chemistry and t Department of Pathology, School of Medicine, University of Maryland at Baltimore, Baltimore, Maryland 21201 ReceivedMarch 30, 1992; revisedJune 18, 1992
A novel method for identifying DNA point mutations has been developed by using mismatch repair enzymes. T h e h i g h s p e c i f i c i t y o f t h e E s c h e r i c h i a coli M u t Y p r o tein has permitted the development of a reliable and sensitive method for the detection and characterization o f p o i n t m u t a t i o n s in t h e h u m a n g e n o m e . T h e M u t Y p r o t e i n is i n v o l v e d in a r e p a i r p a t h w a y t h a t c a n c o n v e r t A / G o r A/C m i s m a t c h e s to C/G o r G/C b a s e p a i r s , r e s p e c t i v e l y . A / G o r A/C m i s m a t c h e s f o r m e d b y h y b r i d ization between two amplified genomic DNA samples or between specific DNA probes and target DNA are n i c k e d at t h e m i s p a i r e d a d e n i n e s t r a n d b y M u t Y p r o t e i n . A s l i t t l e as 1% o f t h e m u t a n t s e q u e n c e c a n b e detected by the mismatch repair enzyme cleavage ( M R E C ) m e t h o d in a m i x t u r e o f n o r m a l a n d m u t a t e d D N A s (e.g., m u t a n t c e l l s a r e o n l y p r e s e n t in 1% o f t h e normal cell background). By using different probes, the assay also can determine the nucleotide sequence of the m u t a t i o n . W e h a v e a p p l i e d t h i s m e t h o d to d e t e c t s i n g l e b a s e s u b s t i t u t i o n s in h u m a n o n c o g e n e s . © 1992 Academic Press, Inc.
INTRODUCTION The analysis of mismatch formation has important implications in biomedical research because a significant proportion of human disease is caused by singlebase substitutions in the genome. Inherited disorders are due to the existence of variant alleles carried within the germ line. Other acquired diseases such as cancers are the result of somatic mutations within critical genes. Alterations in the cellular genomes that affect the expression or function of genes and control cell growth or differentiation are considered to be the main cause of cancer (Barbacid, 1987). Single-base mutations at codon 12, 13, or 61 of one of the three ras genes occur in a significant proportion of human cancers. The highest incidences are found in adenocarcinomas of the pancreas (90%), the colon (50%), and the lung (30%); in thyroid tumors (50%); and in myeloid leukemia (30%) 1 To whom correspondence should be addressed. 249
(Bos, 1989). Increasing data show t h a t deletion or mutation of the tumor suppressor genes can lead to malignancy (Weinberg, 1991). Base substitution mutations in the p53 tumor suppressor gene are localized to some conserved codons but differ among diverse types of human cancer (Hollstein et al., 1991). Direct gene analysis will play an increasingly import a n t role in clinical diagnosis as the molecular basis of human disease is defined. Single-base substitutions can be detected by a variety of techniques (Cotton, 1989; Landegren et al., 1988a). These include Southern hybridization of restriction fragment length polymorphisms, oligodeoxynucleotide hybridization assay (Conner et al., 1983), direct DNA sequencing of amplified genes (Wong et al., 1987) by polymerase chain reaction (PCR 2) (Saiki et al., 1985), RNase mismatch cleavage assay (Myers et al., 1985; Winter et al., 1985), denaturing gradient gel electrophoresis (Myers et al., 1987), oligonucleotide ligation assay (Landegren et al., 1988b; Alves and Carr, 1988; Wu and Wallace, 1989), and allele-specific PCR amplification (Chehab and Kan, 1989; Gibbs et al., 1989; Newton et al., 1989; Wu et al., 1989). The oligonucleotide ligation assay has been automated for DNA diagnosis (Nickerson et al., 1990). However, these methods cannot reliably detect a base change in a DNA sample contaminated with more than 80% of normal DNA. The sample contamination problem is especially significant in the case of cancer detection. The presence of normal cells in tumors can produce ambiguities in both the qualitative and quantitative interpretation of results. The specific assignment of mutation to tumor cells requires purification of the tumor cell population (Burmer and Loeb, 1989). We have developed a sensitive and accurate method for detecting single-base substitutions. The assay relies on the high mismatch specificity of E. coli MutY protein (Lu and Chang, 1988; Au et al., 1989; Tsai-Wu et al., 1991). The nicking activity of MutY is specific for A/Gcontaining (weakly on A/C-containing) DNA fragments Abbreviations used: PCR, polymerase chain reaction; 4dNTP, four deoxyribose nucleoside triphosphates; MREC, mismatch repair enzyme cleavage. 0888-7543/92 $5.00 Copyright © 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
250
LU AND HSU TABLE 1
S e q u e n c e s o f the O l i g o n u c l e o t i d e s U s e d in T h i s Study" Chang A16 Chang G16 Chang 23 107n N-ras-61 probe Chang 31 50n N-ras-61 probe P1 103bp left primer P2 103 bp right primer P3 48 bp left primer P4 48 bp right primer P5 210 bp left primer P6 210 bp right primer
5'AATTGTCCTTAAGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGAATTAGGCTTTCCCCGTCAAGCTCTAAA TCGGGGGCTCCCTTTAGGGTTCCGATCTCGAGCTTTACGGCC 3' 5•CCGGGGCCGTAAAGCTCGAGATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGAATTCGGCGAA CGTGGCGAGAAAGGAAGGGAAGAAAGCTTAAGGAC 3' 5'TTGGGGTGAAACCTGTTTGTTGGACATACTGGATACAGCTGGACGAGAAGAGTACAGTGCCATGAGAGACCAATAC ATGAGGACAGGCGAAGGCTTCCTCTGTGTAT 3' 5'GGTGGACATACTGGATACAGCTGGACGAGAAGAGTACAGTGCCATGAGAG 3'
5'GGTGAAACCTGTTTGTTGGA 3' 5'ATACACAGAGGAAGCCTTCG 3' 5'TGGACATACTGGATACAGCT 3' 5'CTCTCATGGCACTGTACTCT 3' 5'GATCGAATTCGATTCTTACAGAAAACAAGT 3' 5'CTAGTTCGAATCCTAGTACCTGTAGAGGTT 3'
a Bases in boldface can form mismatches with target DNA and underlined bases form protruding ends for label with Klenow fragment after anneal with the complementary strand or PCR products.
a n d has no cleavage activity on D N A c o n t a i n i n g the o t h e r m i s p a i r s or h o m o d u p l e x D N A . T h e M u t Y p r o t e i n h a s b o t h N - g l y c o s y l a s e a n d 3' a p u r i n i c / a p y r i m i d i n i c e n d o n u c l e a s e a c t i v i t i e s ( T s a i - W u e t al., 1992). T h e glycosylase r e m o v e s t h e m i s p a i r e d a d e n i n e s o f A / G a n d A / C m i s m a t c h e s , a n d t h e e n d o n u c l e a s e a c t s o n t h e first p h o s p h o d i e s t e r b o n d 3' to t h e a p u r i n i c / a p y r i m i d i n i c sites. N o i n c i s i o n site w a s d e t e c t e d o n t h e o t h e r m i s p a i r e d g u a n i n e - c o n t a i n i n g s t r a n d , Specific D N A p r o b e s c a n b e d e s i g n e d to f o r m a n A / G or a n A / C m i s m a t c h w i t h o n e s t r a n d of t h e t a r g e t D N A so t h a t t h e r e s u l t i n g h e t e r o d u p l e x is s e n s i t i v e t o t h e M u t Y p r o t e i n . O u r a s s a y has higher sensitivity than direct DNA sequencing. A single-base change in a tumor DNA sample contamin a t e d b y 99% n o r m a l D N A c a n be e a s i l y d e t e c t e d . T h i s m i s m a t c h repair e n z y m e cleavage ( M R E C ) assay has applications in both basic cancer research and clinical d i a g n o s i s s u c h as m o n i t o r i n g t h e p r o g r e s s o f t h e t r e a t m e n t s a n d e a r l y d e t e c t i o n of t h e c a n c e r . MATERIALS AND METHODS Human SK-N-SH neuroblastoma cells with a point mutation at codon 61 of the N-ras (CAA to AAA) (Taparowsky et al., 1983) and Hep-G-2 cells from a human hepatoblastoma that was heterozygous with CAA/CTA for codon 61 of the N - r a s (Hsu et al., 1990) were purchased from American Type Culture Collection. However, we found the majority of the SK-N-SH cell culture had a normal ras gene. A culture of the SK-N-SH cells without subcloning and purification contains about 90% of normal cells. Normal human liver tissue was obtained at autopsy (Hsu et al., 1985). Total DNA was isolated from these cells according to the method of Hsu et al. (1990). The region spanning codon 61 of the N-ras gene was amplified by PCR (Saiki et al., 1985) using a pair of oligonucleotides listed in Table 1. PCR products were purified and sequenced by the dideoxy method (Sanger et al., 1977) as described by Hsu et al. (1991). Oligonucleotide primers and repair probes (Table 1) were synthesized using the standard phosphoramidite chemistry on an Applied
Biosystems DNA synthesizer. Oligonucleotides were purified by 8-20% sequencing gels. Oligonucleotides Chang A16 and Chang G16 were annealed to form duplex DNA with an A/G mismatch at position 51. They previously have been used in A/G endonuclease assays (Yeh et al., 1991). Repair probes (Chang 23 and 31) were hybridized to PCR products at 90°C for 3 rain and reannealed gradually to room temperature over 30 min. The probes were designed such that they would contain two to four nucleotides of overhanging sequence at their 5' ends after annealing with the PCR products (see Fig. 1). The resulting recessed 3' ends were labeled by using Klenow fragment of DNA polymerase I and [a-32P]dATP and unlabeled dCTP for probe Chang 23 and [a-32P]dCTP for probe Chang 31 (Maniatis et al., 1982). Unincorporated free nucleoside triphosphates were removed by passing through a Sepadex G25 Quick-Spin column (Boehringer-Mannheim Corp.). The PCR product from SK-N-SH was labeled at both 5' ends with polynucleotide kinase and [7-~2P]ATP. After removing the unincorporated [~,-s2P]ATP, the DNA was denatured at 90°C for 3 rain and reannealed gradually to room temperature over 30 min. Cleavage by E. coli MutY was performed as described in Lu and Chang (1988). Hybrid DNA (1.8 fmol, 2000-6000 cpm) was cut with 30 units of MutY (Fraction V prepared as described in Tsai-Wu et al., 1991) in 10 #1 reaction containing 20 mM Tris-HC1, pH 7.6, 80 mM NaC1, 1 mM dithiothreitol, 1 mM EDTA, and 2.9% (v/v) glycerol for 30 rain at 30°C. After incubation, DNA samples were lyophilized and redissolved in 3 #1 of 90% (v/v) formamide, 10 mM EDTA, 0.1% (w/v) xylene cyanol, and 0.1% (w/v) bromophenol blue. DNA was denatured at 90°C for 3 rain and applied to a standard 8% polyacrylamide-8.3 M urea sequencing gel for eleetrophoresis (Maxam and Gilbert, 1980). RESULTS Experimental
Design
T h e a s s a y s t r a t e g y is i l l u s t r a t e d i n T a b l e 2. F o u r p o s s i ble o l i g o n u c l e o t i d e p r o b e s c a n b e s y n t h e s i z e d . P r o b e s I a n d I I c o r r e s p o n d to t h e c o d i n g s e q u e n c e of t h e g e n e o f i n t e r e s t , a n d p r o b e s I I I a n d I V are c o m p l e m e n t a r y to p r o b e s I a n d II. P r o b e s I a n d I I I c o n t a i n a d e n i n e a n d probes II a n d IV c o n t a i n g u a n i n e at the p a r t i c u l a r posi-
GENE DIAGNOSIS WITH MISMATCH REPAIR ENZYMES
251
TABLE 2 E x p e c t e d M i s m a t c h F o r m a t i o n a n d C l e a v a g e R e s u l t s by U s i n g E s c h e r i e h i a coli MutY
Sequence at the mutation site
I*" (coding, A)
IIb (coding, G)
III*a (noncoding, A)
IVb (noncoding, G)
A T
A* T (-)
G T* (-)
A A* (-)
A* G (++)c
C a
A* G (++)
G G* (-)
C A* (+)
C* G (-)
G C
A* C (+)
G C* (-)
G A* (++)
G* G (-)
T h
A* h (-)
G A* (++)
T A* (-)
T* G (-)
Note. * represents the labeled strand. a Use 5' end-labeledoligonucleotideprobe. bUse unlabeled oligonucleotideto hybridizelabeled PCR-amplifiedN-ras gene. c Expectedpositive result (++) for A/G mismatch-containingDNA that can be nicked well by MutY and (+) for A/C mismatch-containing DNA that is nicked weaklyby MutY. tion where the mutation occurs. Probes I and III can be end-labeled at the 5' end by polynucleotide kinase (Maniatis et al., 1982), while probes II and IV are not labeled (here the PCR-amplified DNAs are labeled). Depending on the sequence of the genomic DNA at the particular position, the probe will generate no mismatch or certain base mismatch after hybridization with PCR products (Table 2). Th e hybrids will be digested with E. coli MutY (Lu and Chang, 1988; Au et al., 1989; Tsai-Wu et al., 1991), and the cleavage products will be analyzed by denaturing gel electrophoresis. Due to the specificity of MutY, DNA t h a t forms an A / G (++) or A/C (+) mismatch with the probe can be detected and localized by the presence and size of mismatch-specific subfragments (positive result). For example, if the target sequence is A (Table 2, line 1), a digestion product will be observed when labeled PCR-amplified gene is hybridized to probe IV. If the target sequence is C (Table 1, line 2), a strong digestion product will be observed when labeled probe I is used, and a weak product can be detected when labeled probe III is used. Higher concentration of MutY enzyme must be used to detect nicking on A/Ccontaining DNA (Tsai-Wu et al., 1992). In this way, one probe is required to detect one kind of mutation. By using all four probes, any sequence change at this position t hat may have arisen by mutation can be detected.
Analysis of D N A Change in H u m a n Liver Tumor Cells We chose single-base mutations at codon 61 of the human N-ras gene to develop the methodology. T h e schematic representation of the assay is shown in Fig. 1. In h u man liver tumor Hep-G-2 cells, one allele has a single-base change at codon 61-CAA (Glu) to CTA (Leu) and the other allele is normal (Fig. 2A, lanes 1-4). This single-base change can be detected by the mismatch repair enzyme cleavage method. Total genomic DNA was isolated from hum a n normal liver cells or H E P - G - 2 cells, and a 103-bp DNA fragment containing codon 48
to codon 81 of the N-ras gene was amplified by P C R (Saiki et al., 1985). This PCR product was hybridized to a 107-nucleotide DNA probe (Chang 23, type II according to Table 2) which contains the 103 nucleotides corresponding to the coding strand of the PCR product except t hat the sequence for codon 61 is CGA and 4 extra nucleotides (T T G G ) are present at its 5' end (Table 1). T h e probe generates a T / G and an A/G mismatch with the PCR product from normal and tumor DNA, respectively. These hybrid DNAs with 5' overhanging ends were then filled in with Klenow fragment in a reaction buffer containing d C T P and [a-32P]dATP. T h e labeled DNAs were digested with E. coli MutY (Fraction V, Tsai-Wu et al., 1991), and the products were analyzed by denaturing gel electrophoresis. A mutation within the tumor DNA was detected and localized by the presence of a 44-nucleotide fragment. Figure 2B shows the results of these experiments. T he 44-nucleotide cleavage product could be detected only in the tumor DNA/probe hybrid and not in the normal DNA/probe hybrid. Using a shorter probe (50-mer) in similar experiments, a 26-nucleotide digestion product was observed in the tumor DNA/probe hybrid (Fig. 2C, lane 4) but not in the normal DNA/probe hybrid (Fig. 2C, lane 3). This method also has been used to detect a single-base mutation at codon 12 of the hum an K-ras gene with a 48-mer probe (data not shown). Therefore, the method should be useful in the detection of other inherited genetic a n d / or somatic mutations.
Sensitivity of the Assay T o test whether the MRE C method is sufficiently sensitive to detect a small subpopulation of single-base mutations, the tumor DNA/probe hybrid was diluted with an increasing amount of normal DNA/probe hybrid and then cleaved with E. coli MutY protein. As shown in Fig. 3, the specific 44-nucleotide product still could be detected in the 1/50 dilution when the DNA was di-
252
LU AND HSU Normal Cells
Tumor Cells
Genoml¢ DNA
~ PCR Amplify N - R a s
--A . . . .
T .
.
103-bp .
.
.
.
.
.
..... T .
.
A . . . . . . .
TTGG
G
ybrldization Ith 107n Probe TTGG ----
G T--
- .
.
.
.
TTGG .
G --A
- . . . . .
-
Klenow Fragment dCTP TTGG AACC
....
G - T . . . . . .
+[o(-32P]d
TTGG AACC ....
ATP
G - A . . . . . .
g e n o m i c D N A f r o m t h e S K - H - S H cell l i n e w a s a m p l i fied b y P C R a n d s e q u e n c e d , s u r p r i s i n g l y , t h e m a j o r i t y o f t h e D N A w a s C A A ( a r r o w in Fig. 4A, l a n e s 1 - 4 ) . W e infer that the majority population from the stock of A m e r i c a n T y p e c u l t u r e c o l l e c t i o n h a s a n o r m a l r a s gene. W e e s t i m a t e t h a t n o m o r e t h a n 10% o f t h e p o p u l a t i o n h a d A A A m u t a t i o n s (* i n Fig. 4A, l a n e 2), b e c a u s e t h e A band was hardly distinguishable from the background in t h e s e q u e n c i n g gel. T h e D N A i s o l a t e d f r o m S K - H - S H cells, w h i c h c o n t a i n e d m o s t l y t h e n o r m a l N - r a s g e n e s a n d a s m a l l p r o p o r t i o n o f m u t a t e d N - r a s alleles, w a s d e n a t u r e d , r e n a t u r e d , a n d d i g e s t e d w i t h t h e E. coli M u t Y enzyme. By these procedures, some heteroduplexes s h o u l d c o n t a i n A / G m i s m a t c h e s a t c o d o n 61 o f N - r a s that would be sensitive to the MutY protein. A 79-nuc l e o t i d e d i g e s t i o n p r o d u c t w a s c l e a r l y p r e s e n t in t h e M u t Y - t r e a t e d s a m p l e w i t h v e r y l i t t l e b a c k g r o u n d (Fig. 4B, c o m p a r e l a n e s 1 a n d 2).
Cut with E. co/i MutY TTGG AACC
...... G - .... T ......
TTGG
G
AACC----.A: I
Sequencing
No Reaction
-
DISCUSSION
-
1
Gel
44-n Product
FIG. 1. Schematic representation of the MREC method to detect a single base substitution. A 107-nucleotide probe (Chang 23) generates a T/G and an A/G mismatch after hybridization with the PCR product from normal and tumor DNA, respectively. These hybrid DNAs with 5' overhanging ends were then filled in with Klenow fragment in a reaction mix containing dCTP and [a-a2P]dATP. The labeled DNAs were digested with Escherichia coli MutY (Fraction V) (Tsai-Wu et al., 1991), and the products were analyzed by denaturing gel electrophoresis. Tumor DNA is detected by the presence of a 44nucleotide fragment. Coding strands are presented as solid lines and noncoding strands as dotted lines. Stars underneath bases represent a2P-labeled nucleotides. When a shorter probe (Chang 31) was used, the hybrid DNA was labeled with [a-~2P]dCTP, and a 26-nucleotide digestion product was generated. g e s t e d w i t h M u t Y p r o t e i n ( F r a c t i o n V). B e c a u s e t h e H e p - G - 2 t u m o r D N A is h e t e r o z y g o u s for t h e N - r a s g e n e (Fig. 2, l a n e s 1 - 4 ) , w e e s t i m a t e t h e s e n s i t i v i t y o f t h e ass a y t o b e u p t o 1%. T h u s , a s i n g l e - b a s e c h a n g e i n g e n o m i c D N A f r o m t u m o r c e l l s t h a t a r e p r e s e n t in o n l y 1% o f a n o r m a l cell b a c k g r o u n d c a n b e d e t e c t e d b y t h e M R E C method. The high sensitivity of our method was confirmed by t h e f o l l o w i n g e x p e r i m e n t s . A h u m a n n e u r o b l a s t o m a cell line (SK-N-SH) has been reported to have a single-base c h a n g e a t c o d o n 61 o f N - r a s [C_AA ( G l u ) t o A_AA ( L y s ) ] ( T a p a r o w s k y e t al., 1983). T h i s C / G t o A / T t r a n s v e r s i o n is u s e f u l f o r t h e M R E C a s s a y w i t h M u t Y p r o t e i n . A n A/G mismatch can be formed when DNA from normal and SK-H-SH cells are cross-hybridized. The resulting m i s m a t c h c a n b e d e t e c t e d b y M u t Y p r o t e i n (see Fig. 4). We tried to take advantage of this specific mutation because the A/G mismatch can be detected by the MREC method without the need of a synthetic probe. When
A s e n s i t i v e a n d r e l i a b l e m e t h o d for d e t e c t i n g s i n g l e base substitutions has been developed. The method employs synthetic oligonucleotides that hybridize to PCR products from target DNA or hybridization between two P C R - a m p l i f i e d p r o d u c t s f r o m g e n o m i c D N A . I f t h e r e is 1 G
A
T
C
1
2
3
4
234
56 1 107
-;!!;~i;61
A
2
3
4 ~ 50
70
)
~26
~*
A
;:= i ¸ ~
44
S
FIG. 2. (A) Direct sequencing of the PCR product from the human liver tumor cell line Hep-G-2. Arrow indicates the mutation site at codon 61 of the N-ras gene. The N-ras gene is heterozygous at codon 61 (CAA and CTA). (B) Identification of a mutation at the N-ras gene by the MREC method with E. coli MutY protein. N-ras DNAs from normal (lanes 1 and 2) and Hep-G-2 liver tumor (lanes 3 and 4) were amplified by PCR to generate 103-bp fragments, which were then hybridized to a 107-nucleotide synthetic probe (Chang 23) and labeled at the 3' end of the noncoding strand as described in Fig. 1. These DNA hybrids were cut with E. coli MutY enzyme (Fraction V) (lanes 2 and 4) and analyzed on an 8% sequencing gel with an unpurified 5' end-labeled synthetic 40-met as a size marker (lane 6). As a control, Fraction V was also used to cut a 120-bp synthetic fragment containing an A/G mismatch (annealed Chang A16 and Chang G16 and filled in with [~-32P]dCTP and followed by 4dNTP) (Yeh et aL, 1991) to generate a 70-nucleotide product (lane 5). (C) A shorter probe (Chang 31, 50-met) was used in the assay similar to that in (B). Lane 1, untreated normal DNA; lane 2, MutY-treated normal DNA; lane 3, untreated tumor DNA; and lane 4, MutY-treated tumor DNA. A specific 26-nucleotide cleavage product was generated in lane 4.
GENE DIAGNOSIS WITH MISMATCH REPAIR ENZYMES -V
+V
if
I i
-=
o
1
2
3
4
5
6
o
7
8 9101112
*- 4 4
FIG. 3. Sensitivity of the MREC method with E. coli MutY protein. The Hep-G-2 tumor DNA/probe hybrid was diluted with increasing amount of normal DNA/probe hybrid (1/0 to 1/100) (lanes 1-6) and then cleaved with Fraction V (lanes 7-12). The 44-nucleotide product can still be seen at 1/50 dilution. a n A / G or A / C m i s m a t c h , the E. coli M u t Y p r o t e i n (Lu a n d Chang, 1988; Au et al., 1989; T s a i - W u et al., 1991) nicks t h e h y b r i d D N A on t h e m i s p a i r e d adenine strand. A / G m i s m a t c h e s c a n be distinguished f r o m A / C mism a t c h e s b y t h e i r higher activity to M u t Y protein. I f t h e r e is p e r f e c t c o m p l e m e n t a r i t y or o t h e r t y p e s of mism a t c h e s , t h e E. coli M u t Y p r o t e i n will n o t cleave the D N A . T h i s powerful m e t h o d h a s b e e n applied to detect p o i n t m u t a t i o n s w i t h i n t h e N - r a s gene of h u m a n liver t u m o r cells. Several m e t h o d s h a v e b e e n developed to diagnose b a s e s u b s t i t u t i o n s (Cotton, 1989; L a n d e g r e n et al., 1988a). H y b r i d i z a t i o n or R N a s e m i s m a t c h assays occasionally give false positive or negative results due to t h e high b a c k g r o u n d or p o o r e n z y m e specificity ( C o n n e r et al., 1983; M y e r s et al., 1985; W i n t e r et al., 1985). T h e ligation m e t h o d is b a s e d on t h e ability of two oligonucleotides to a n n e a l i m m e d i a t e l y a d j a c e n t to each o t h e r on a c o m p l e m e n t a r y t a r g e t D N A molecule ( L a n d e g r e n et al., 1988b; Alves a n d Carr, 1988; W u a n d Wallace, 1989). T h e conditions of ligation m u s t be adjusted to m i n i m i z e ligation w h e n a m i s m a t c h occurs at either side of t h e p o i n t of ligation. T h e allele-specific amplification m e t h o d uses two p r i m e r s in a P C R reaction. One p r i m e r is p e r f e c t l y m a t c h e d w i t h the t e m p l a t e D N A , a n d the o t h e r p r i m e r is either m a t c h e d or m i s m a t c h e d at the 3' terminal with the template D N A after hybridization ( C h e h a b a n d K a n , 1989; G i b b s et al., 1989; N e w t o n et al., 1989; W u et al., 1989). C o n d i t i o n s m u s t be e s t a b l i s h e d such t h a t a P C R p r o d u c t is p r o d u c e d in the f o r m e r case b u t n o t in t h e latter case. T h i s m e t h o d s o m e t i m e s is unreliable due to c o n t a m i n a t i o n of n o r m a l sequences f r o m n o r m a l cells. S o m e m i s m a t c h e s (like G / T a n d A / C) c a n f o r m stable b a s e p a i r i n g a n d t h u s give false re-
253
sults. D N A sequencing is p r o b a b l y t h e m o s t accurate a s s a y b u t is laborious a n d insensitive ( W o n g et al., 1987). I t c a n n o t d e t e r m i n e u n a m b i g u o u s l y a b a s e change in a D N A s a m p l e c o n t a m i n a t e d w i t h m o r e t h a n 80% of n o r m a l D N A . T h e g r e a t e s t a d v a n t a g e of t h e M R E C m e t h o d is its high sensitivity relative to o t h e r m e t h o d s (Cotton, 1989; L a n d e g r e n et al., 1988a). T h e assay c a n detect t h e specific cleavage p r o d u c t even w h e n m u t a n t cells are only p r e s e n t e d in 1% of n o r m a l cell b a c k g r o u n d . F o r diagnosis of m u t a t i o n in h u m a n genetic disease, the high sensitivity of t h e a s s a y is n o t necessary, because cells are eit h e r h o m o z y g o u s or heterozygous. H o w e v e r , t h e presence of n o r m a l cells in t u m o r s is a significant p r o b l e m in cancer detection. D e t e c t i o n of m u t a t i o n s within oncogenes or t u m o r s u p p r e s s o r genes in t h e early developm e n t of h u m a n c a n c e r is i m p e d e d b y the low a b u n d a n c e of the t u m o r cells of early stages. Our assay c a n overcome this s a m p l e c o n t a m i n a t i o n p r o b l e m w i t h o u t the histological e n r i c h m e n t a n d cell sorting p r o c e d u r e s as used b y B u r m e r a n d L o e b (1989). T h e M R E C m e t h o d , like the R N a s e I cleavage a s s a y (Myers et al., 1985; W i n t e r et al., 1985), has the a d v a n t a g e of defining t h e location of t h e b a s e change. T h i s is useful in screening for new m u t a t i o n s . As listed in T a b l e 2, b y using all four probes, t h e M R E C assay c a n d e t e r m i n e t h e n a t u r e of a b a s e sequence. T h e r e f o r e t h e a s s a y not only detects m u t a t i o n s b u t also d e t e r m i n e s t h e sequence changes of m u t a t i o n s . T h i s c e r t a i n l y is simpler a n d m o r e sensitive t h a n direct sequencing. T h e M R E C a s s a y using E. coli M u t Y enzyme is especially useful for C / G to A / T t r a n s v e r s i o n m u t a t i o n s . In this case, no specific p r o b e is needed. G A
T C
1 2 3 4 12 210
:;:::
A ] A 61 ,--(C/a) 79
FIG. 4. (A) Direct DNA sequencing of the PCR product from human neuroblastoma cell line SK-N-SH. Arrow indicates the mutation site at codon 61 of the N-ras gene. * indicates the weak A band in SK-N-SH DNA sample and suggests that the majority of the population is normal cells and no more than 10% of the cell population contain AAA mutations. (B) PCR-amplified DNA (210 bp) from this cell line was labeled at both 5' ends with polynucleotide kinase and [.),_sup]. ATP. The PCR products were self-annealed to form A/G mismatches between normal and tumor DNAs (lane 1) and treated with E. coli MutY protein (lane 2). A 79-nucleotide digestion product shown in the autoradiogram was clearly present in the treated sample with very little background (compare lanes 1 and 2).
254
LU AND HSU
P C R - a m p l i f i e d D N A f r o m m u t a n t cells c a n b e h y b r i d i z e d t o D N A f r o m n o r m a l cells, a n d t h e A / G m i s m a t c h e s formed are sensitive to MutY protein. Recently, MutY h a s b e e n s h o w n t o a c t o n A / C - c o n t a i n i n g D N A , b u t 20f o l d m o r e e n z y m e is r e q u i r e d t o give t h e s a m e a c t i v i t y a s A / G - c o n t a i n i n g D N A ( T s a i - W u e t al., 1992). T h e r e f o r e , with higher enzyme concentration, the MREC method with MutY can also detect C/G to T/A or A/T to G/C transitions by direct hybridization between normal and mutant DNAs. Because transition mutations occur more frequently than transversions, detection of A/C m i s m a t c h e s is v a l u a b l e . A highly specific mismatch recognition endonuclease is u s e d in o u r a s s a y . I n a d d i t i o n t o t h e E . coli M u t Y , other DNA mismatch repair enzymes can be applied in this method. T/G mismatch-specific nicking enzymes f r o m H e L a n u c l e a r e x t r a c t ( W i e b a u e r a n d J i r i c n y , 1989, 1990) a n d f r o m E . coli ( H e n n e c k e e t al., 1991) h a v e b e e n described. Accordingly, specific probes can be designed as in T a b l e 2, a n d h y b r i d D N A c a n b e d i g e s t e d w i t h T / G - s p e c i f i c e n d o n u c l e a s e . T h i s T / G e n d o n u c l e a s e is most useful for detecting C/G to T/A transition mutations by hybridization between normal and mutant DNAs. The MREC assay could also use mismatch-recognition enzymes with lower mismatch specificity. The h u m a n a n d y e a s t a l l - t y p e e n d o n u c l e a s e ( Y e h e t al., 1991; C h a n g a n d L u , 1991) c a n n i c k all e i g h t - b a s e m i s m a t c h e s and can be employed for general screening for any mutat i o n s w i t h i n i n t e r v a l s . I n t h i s case, P C R p r o d u c t s f r o m normal and potential mutant DNAs can be hybridized and tested by the human or yeast all-type endonuclease. T h e d i s a d v a n t a g e o f u s i n g t h e a l l - t y p e e n z y m e s is t h a t d i f f e r e n t m i s m a t c h e s a r e r e c o g n i z e d w i t h d i f f e r e n t efficiencies and neighboring sequence environment has s o m e effect o n c l e a v a g e ( C h a n g a n d L u , 1991; Y e h e t al., 1991; Y e h a n d L u , u n p u b l i s h e d r e s u l t s ) . T h i s c o u l d b e overcome by labeling the PCR products at different ends. Using these different mismatch-recognition enzymes, the MREC method promises to be a useful tool for genetic screening.
ACKNOWLEDGMENTS This work was supported by Grant GM 35132 from the National Institute of General Medical Sciences (to A-L.L.), by Grant BS460 from the American Cancer Society, by Grant R-818104 from the Environmental Protection Agency (to I.-C.H.), and in part by a Special Research Initiative Support Award from UMAB Designated Research Initiative Fund. The authors thank Drs. R. Metcalf and R. Wade for critical reading of the manuscript. REFERENCES
Alves, A. M., and Cart, F. J. (1988). Dot-blot detection of point mutations with adjacently hybridizing synthetic oligonucleotide probes. Nucleic Acids Res, 16: 8723. Au, K. G., Clark, S., Miller, J. H., and Modrich, P. (1989). Escherichia coli m u t Y gene encodes an adenine glycosylase active on G-A mispairs. Proc. Natl. Acad. Sci. USA 8{}: 8877-8881. Barbacid, M. (1987). ras genes. Annu. Rev. Biochem. 56: 779-827.
Bos, J. L. (1989). ras oncogenes in human cancer: A review. Cancer Res. 49: 4682-4689. Burmer, G. C., and Loeb, L. A. (1989). Mutations in the K-ras2 oncogene during progressive stages of human colon carcinoma. Proc. Natl. Acad. Sci. USA 86: 2403-2407. Chang, D.-Y., and Lu, A-L. (1991). Base mismatch-specific endonuclease activity in extracts from Saccharomyces cerevisiae. Nucleic Acids Res. 19: 4761-4766. Chehab, F. F., and Kan, Y. W. (1989). Detection of specific DNA sequences by fluorescence amplification: A color complementation assay. Proc. Natl. Acad. Sci. USA 86: 9178-9182. Conner, B. J., Reye, A. A., Morin, C., Itakura, K., Teplitz, R. L., and Wallace, R. B. (1983). Detection of sickle cell ~S-globin allele by hybridization with synthetic oligonucleotides. Proc. Natl. Acad. Sci. USA 80: 278-282. Cotton, R. G. H. (1989). Detection of single base changes in nucleic acids. Biochem. J. 263: 1-10. Gibbs, R. A., Nguyen, P.-N., and Caskey, C. T. (1989). Detection of single DNA differences by competitive oligonucleotide priming. Nucleic Acids Res. 17: 2437-2448. Hennecke, F., Kolmar, H., Brundl, K., and Fritz, H.-J. (1991). The vsr gene product ofE. coli K-12 is a strand- and sequence-specific DNA mismatch endonuclease. Nature 353: 776-778. Hollstein, M., Sidransky, D., Vogelstein, B., and Harris, C. C. (1991). p53 mutations in human cancers. Science 253: 49-53. Hsu, I. C., Lipsky, M. M., Cole, K. E., Su, C. H., and Trump, B. F. (1985). Isolation and culture of hepatocytes from liver of immediate autopsy. I n Vitro Cell. Dev. Biol. 21: 154-160. Hsu, I. C., Metcalf, R. A., Su, T., Welsh, J. A., Wang, N. J., and Harris, C. C. (1991). p53 gene mutational hotspot in human hepatocellular carcinoma. Nature 350: 427-428. Hsu, I. C., Welsh, J. A., Metcalf, R. A., Brash, D., Su, T., and Harris, C. C. (1990). Oncogene mutation in human liver tumor cells determine by PCR amplification and direct DNA sequencing. Proc. Natl. Am. Assoc. Cancer Res. 31: 806. Landegren, U., Kaiser, R., Caskey, C. T., and Hood, L. (1988a). DNA diagnostics--Molecular techniques and automation. Science 242: 229-237. Landegren, U., Kaiser, R., Sanders, J., and Hood, L. (1988b). A ligasemediated gene detection technique. Science 241: 1077-1080. Lu, A-L., and Chang, D. Y. (1988). A novel nucleotide excision repair for the conversion of an A/G mismatch to C/G base pair in E. coli. Cell 54: 805-812. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982). "Molecular cloning: A Laboratory Manual," Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Maxam, A. M., and Gilbert, W. (1980). Sequencing end-labeled DNA with base-specific chemical cleavage. Methods Enzymol. 65: 499560. Myers, R. M., Latin, Z., and Maniatis, T. (1985). Detection of single base substitutions by ribonuclease cleavage at mismatches in RNA:DNA duplexes. Science 230: 1242-1246. Myers, R. M., Maniatis, T., and Lerman, L. S. (1987). Detection and localization of single base changes by denaturing gradient gel electrophoresis. Methods Enzymol. 155: 501-527. Newton, C. R., Graham, A., Heptinstall, L. E., Summers, S. J., Kalsheker, N., Smith, J. C., and Markham, A. F. (1989). Analysis of any point mutation in DNA, the amplification refractory mutation system (ARMS). Nucleic Acids Res. 17: 2503-2516. Nickerson, D. A., Kaiser, R., Lappin, S., Stewart, J., Hood, L., and Landegren, U. (1990). Automated DNA diagnostics using an ELISA-based oligonucleotide ligation assay. Proc. Natl. Acad. Sci. USA 87: 8923-8927. Saiki, R., Sharf, S., Foloona, F., Mullis, K., Horn, G., Erlich, H. A., and Arnheim, N. (1985). Enzymatic amplification of fl-globin geno-
GENE DIAGNOSIS W I T H MISMATCH REPAIR ENZYMES mic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 2 3 0 : 1350-1353. Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad, Sci. USA 74: 5463-5467. Taparowsky, E., Shimizu, K., Goldfarb, M., and Wigler, M. (1983). Structure and activation of the human N-ras gene. Cell 34: 581586. Tsai-Wu, J.-J., Radicella, J. P., and Lu, A-L. (1991). Nucleotide sequence of the Escherichia coli micA gene required for A/G-specific mismatch repair: Identity of MicA and MutY. J. Bacteriol. 173: 1902-1910. Tsai-Wu, J.-J., Liu, H.-F., and Lu, A-L. (1992). Escherichia coli MutY protein has both N-glycosylase and apurinic/apyrimidinic (AP) endonuclease activities on A/C and A/G mispairs. Proc. Natl. Acad. Sci. USA, in press. Weinberg, R. (1991). Tumor suppressor genes. Science 2 5 4 : 11381146. Wiebauer, K., and Jiricny, J. (1989). In vitro correction of G. T mispairs to G. C pairs in nuclear extracts from human cells. Nature 3 3 9 : 234-236. Wiebauer, K., and Jiricny, J. (1990). Mismatch-specific thymine DNA
255
glycosylase and DNA polymerase/~ mediate the correction of G. T mispairs in nuclear extracts from human cells. Proc. Natl. Acad. Sci. USA 87: 5842-5845. Winter, E., Yamamoto, F., Almoguera, C., and Perucho, M. (1985). A method to detect and characterize point mutations in transcribed genes: Amplification and overexpression of the mutant c-Ki-ras allele in human tumor cells. Proc. Natl. Acad. Sci. USA 82: 75757579. Wong, C., Dowling, C. E., Saiki, R. K., Higuchi, R. G., Erlich, H. A., and Kazazian, H. H., Jr. (1987). Characterization of ~-thalassemia mutations using direct genomic sequencing of amplified single copy DNA. Nature 3 3 0 : 384-386. Wu, D. Y., Ugozzoli, L., Pal, B. K., and Wallace, R. B. (1989). Allespecific enzymatic amplification of f~-globin genomic DNA for diagnosis of sickle cell anemia. Proc. Natl. Acad. Sci. USA 86: 27572760. Wu, D. Y., and Wallace, R. B. (1989). The ligation amplification reaction (LAR)-amplification of specific DNA sequences using sequential rounds of template-dependent ligation. Genomics 4: 560-569. Yeh, Y.-C., Chang, D.-Y., Masin, J., and Lu, A-L. (1991). Two nicking enzyme systems specific for mismatch-containing DNA in nuclear extracts from human cells. J. Biol. Chem. 2 6 6 : 6480-6484.
