Vol.

179,

September

No.

BIOCHEMICAL

3, 1991

30,

AND

BIOPHYSICAL

RESEARCH

COMMUNICATIONS Pages

1991

1255-1258

DETERMINATION OF THE 5’ EXON STRUCTURE OF THE HUMAN CARDIAC a-MYOSIN HEAVY CHAIN GENE+ Nigel J. Brand’, Nina Dabhade, Magdi Yacoub and Paul J.R. Barton Department of Cardiothoracic Surgery, National Heart and Lung Institute, Dovehouse St, London SW3 6LY, U.K. Received

June

11,

1991

We have deduced the exon structure of the 5’ untranslated region of the human cardiac a-myosin heavy chain gene by cloning a cDNA for this region using the polymerase chain reaction. Comparison of the cDNA and genomic DNA sequences demonstrates that the 5’ non-coding region of the o-myosin heavy chain gene is interupted by two introns of 645 and 337 nucleotides. Secondly we have identified the transcriptional start-site by primer extension, corroborating the previous putative assignment for the a-myosin heavy chain promoter based on comparisons between the rat and human genes. o 1991 +.cademlc pzps5.inc.

The two genes encoding the cardiac myosin heavy chain isoforms (I and 8 (a-MHC and B-MHC respectively) (1) and are separated

are arranged in tandem on chromosome 14qll.2 by less that

5-kb in both man and rat 12-5).

+ q13 Partial

complementary DNA (cDNA) sequences have been obtained for the coding regions of both of the human isoforms, and the genomic DNA sequence upstream of the coding regions has been determined, allowing the putative assignment of the gene promoters based on identification and CAAT boxes (4,5).

of consensus promoter sequences such as TATA

Similar sequences have been identified

upstream of the

first coding exon of the rat a-MHC gene (2). Further, these regions from both the rat and human a-MHC genes have been shown to function as promoters when cislinked to the chloramphenicol

acetyl transferase (CAT) gene from Escherchia &i

and expressed in a variety of cell types in culture, including cardiocytes (see 6 and references therein).

However, neither the 5’ exon structure or the precise location

of the start-site of transcription for the human a-MHC gene has, to our knowledge, been described. In man, 1.8-kb of sequence located immediately upstream of the

’ The nucleotide sequence reported in this paper will appear in the EMBL/GenBank database under the accession number X561 81. * To whom correspondence should be addressed.

1255

All

Cnpwight 0 1991 rights of rqrodlrction

0006-291X/91 $1.50 b! Academic Pwss. 1~. in an! form reserved.

Vol.

179, No. 3, 1991

BIOCHEMICAL

AND BIOPHYSICAL

RESEARCH COMMUNICATIONS

first coding exon has been published, but the determination of the size and structure of exons comprising the 5’ untranslated region (5’-UTR) has been hampered structure

by the presence of intron sequences.

Here, we describe the exon

of the 5’-UTR of the human a-MHC gene by cloning a specific 5’ cDNA

using polymerase transcription

chain reaction

(PCR) methodology,

and have identified

the

start-site by primer extension analysis. MATERIALS AND METHODS

PCR amolification and cloninq lpg of human atrial total RNA was reverse transcribed at 42% for 1 hr following standard protocols (7) in a 30 ~1 volume containing 50 pmol of an antisense primer 5’-GTCAAAGGGCCGGGTCTGGGCCTCTA-3’. 50 pmol of sense primer 5’TACGAATTGACAGATAGAGAGACTCTGCG-3’ (&gRI site underlined) and 1 U of m DNA polymerase (Northumbria Biotechnology) were added and 40 cycles of PCR performed (94X/l min; 50 “C/ 1.5 min; 72Wl min), followed by a final extension for 5 mins at 72°C. Ends were repaired by the addition of all four dNTPs and klenow fragment of DNA polymerase I (Northumbria Biologicals Ltd) using standard protocols and the resulting DNA fragment was purified from Nu-Sieve LMP agarose (FMC Bioproducts) using Mermaid (Bio 101, Inch before digestion with t&gRl and ligation into pBluescript (&gRl/mI digested). Sequence determination was carried out on single stranded DNA isolated from a selected clone (pMHA1) using the chain termination method under standard conditions. Primer extension analvsis Primer extension was carried out by annealing an antisense primer 5’CCTGGTTATCCCTTCACGG-3’, labelled at the 5’ end with 32P, to 30 ,ug of either human total atrial RNA or yeast tRNA, following standard procedures (8). RESULTS AND DISCUSSION In order to clone the 5’ region of the human cr-MHC mRNA we used published genomic sequence data for the 5’ flanking region of the human a-MHC gene (3-51 and synthesised

two oligonucleotide

primers, one complementary

to part of the

first coding exon (antisense), the other (sense) corresponding to a region located 20-35 bp downstream from a putative TATA box sequence identified within the genomic DNA sequence, and therefore presumed to span the o-MHC transcription start-site. PCR amplification using these primers and adult human atrial RNA as a template generated a cDNA fragment whose sequence contains the 5’-UTR and the beginning of the a-MHC coding region. No amplification ventricular practically

was seen using human

RNA consistent with the observation that in adult a-MHC is expressed exclusively in atrial muscle (3,9), and demonstrating the specificity of

the amplification protocol (data not shown). The PCR product was cloned into pBluescript and the sequence of the resulting clone, pMHA1, which contains a 173 bp insert, was found to be identical to three regions of the published genomic DNA sequence of the o-MHC gene (3-5). The 1256

Vol.

179,

No.

3, 1991

BIOCHEMICAL

AND

BIOPHYSICAL

RESEARCH

COMMUNICATIONS

A +1 .

El v E2

GAATTCACAGATAGAGAGACTCTGCGGCCCAG

1

ATTCTTCAGGATTCTCCGTGAA

E2 v E3 GGGATAACCAG

58

115

GGGAAGCACCAAGATGACCGATGCCCAGATGGCTGACTTTGGGGCAGCG MetThrAspAlaGlnMetAlaAspPheGlyAlaAla

12

GCCCAGTACCTCCGCAAGTCAGAGAAGGAGCGTCTAGAGGCCCAGACCCGGCCCTTTGAC AlaGlnTyrLeuArgLysSerGluLysGluArgLeuGluAlaGlnThrArgProPheAsp

32

B El

E2

E3

33 Fia. 1. Sequence

and organization

of the Tend

(337)

of the u-MHC

211 gene.

(A) DNA sequence of the PCR-generatedcDNA clone. pMHA1 for human cardiac (IMHC. The sequence spans three exons El, E2 and E3 (arrowheads denote exon junctions), as deduced by comparison to published genomic DNA data (3-5). and the transcription start-site (+ 1) is indicated. The DNA sequence is numbered at the left relative to the &QRI site bordering the clone. The amino acid sequence of the coding region is shown and numbered at the right. Underlined are the regions corresponding to the oligonucleotide primers used for PCR amplification. (B) Schematic representation of the organisation of the 5’ end of the human a-MHC gene, deduced from cDNA and genomic sequence data (2-5). The lengths in base pairs of exons El-3 and introns (parentheses)are shown. organisation

of these regions of identity

shows that the 5’ non-coding

region of

this gene is split into three exons El-E3, where E3 contains the start of the coding region (Fig. 1 A).

Fig. 1I3 shows schematically

end of the a-MHC

the exon-intron

structure

gene based upon our results and the published

of the 5’ genomic

sequence. In order to confirm

that all the 5’-UTR sequences had been identified,

and to

determine the exact start-point of transcription, an end-labelled antisense primer complementary to part of E2 was hybridised to atrial total RNA and extended using standard procedures.

This generated an extended product which was judged to be

56 nucleotides long and mapped the a-MHC transcription

start-site as being most

probably the adenosine underlined within the sequence 5’-CAGATAG-3’ on the coding strand (Fig. 2, arrowed and Fig. IA, + 1). Additionally, this result confirmed

that the cDNA clone contained

the complete

5’-UTR sequence.

No

extended product was obtained when the primer was hybridised to yeast tRNA, nor to total RNA prepared from adult ventricular muscle (data not shown). The startsite is positioned 23-bp downstream of the TATA-like sequence, corroborating the previous putative assignment of the a-MHC promoter from the genomic DNA 1257

Vol. 179, No. 3, 1991

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

TCGA

Fia. 2. Identification of the u-MHC transcription start-site by primer extension analysis. A 56-nucleotide extended product obtained from human atrial RNA using

an antisense primer 5’-CCTGGTTATCCCTTCACGG-3’ specific for E2 is indicated (arrow) alongside a sequencing ladder for the a-MHC cDNA generated using the same primer. sequence (3-5) and observations that the DNA sequences of the rat and human cMHC genes are well-conserved

in this region (2,3,5; our observations).

5’-UTR shows no DNA sequence homology should therefore

The a-MHC

with that of the B-MHC gene, and

serve as a useful specific probe for examining the pattern of o-

MHC expression. ACKNOWLEDGMENTS We thank

Drs. Sue Cotterill

oligonucleotides.

and Conrad

Lichtenstein

for the synthesis

of

This work was supported by the British Heart Foundation. REFERENCES

1.

2. 3. 4. 5. 6. 7.

a. 9.

Matsuoka R, Yoshida MC, Kanda N, Kimura M, Ozasa H and Takao A (1989). Am. J. Med. Genet. 2: 279-284. Mahdavi V, Chambers AP and Nadal-Ginard B (1984). Proc. Natl. Acad. Sci. USA a: 2626-2630. Saez LJ, Gianola KM, McNally EM, Feghali R, Eddy R, Shows TB and Leinwand LA (1987). Nucleic Acids Res. I&: 5443-59. Yamauchi-Takihara K, Sole MJ, Liew J, Ing D and Liew C-C (19891. Proc. Natl. Acad. Sci. USA &j: 3504-8. Yamauchi-Takihara K, Sole MJ, Liew J, Ing D and Liew C-C (1989). Proc. Natl. Acad. Sci. USA 8fi: 7416-7. Tsika RW, Bahl JJ, Leinwand LA and Morkin E (1990). Proc. Natl. Acad. Sci. USA 87: 379-383. Vallins WJ, Brand NJ, Dabhade N, Butler-Browne G, Yacoub MH and Barton PJR (1990). FEBS Letts. 270: 57-61. Gronemeyer H, Turcotte 8, Quirin-Stricker C, Bocquel MT, Meyer ME, Krozowski Z, Jeltsch J-M, Lerouge T, Garnier JM and Chambon P (1987). EMBO J. 6: 3985-94. Kurabayashi M, Tsuchimochi H, Komuro I, Takaku F and Yazaki Y (1988). J. Clin. Invest. 82: 524-531. 1258