Nucleic Acids Research, Vol. 18, No. 23 7049
Determination of the cis sequence involved in catabolite repression of the Bacillus subtilis gnt operon; implication of a consensus sequence in catabolite repression in the genus Bacillus Yasuhiko Miwa and Yasutaro Fujita* Department of Biotechnology, Faculty of Engineering, Fukuyama University, Fukuyama 729-02, Japan Received July 24, 1990; Revised and Accepted November 5, 1990
ABSTRACT The mechanism underlying catabolite repression in Bacillus species remains unsolved. The gluconate (gnt) operon of Bacillus subtilis is one of the catabolic operons which is under catabolite repression. To identify the cis sequence involved in catabolite repression of the gnt operon, we performed deletion analysis of a DNA fragment carrying the gnt promoter and the gntR gene, which had been cloned into the promoter probe vector, pWP19. Deletion of the region upstream of the gnt promoter did not affect catabolite repression. Further deletion analysis of the gnt promoter and gntR coding region was carried out after restoration of promoter activity through the insertion of internal constitutive promoters of the gnt operon before the gntR gene (P2 and P3). These deletions revealed that the cis sequence involved in catabolite repression of the gnt operon is located between nucleotide positions + 137 and + 148. This DNA segment contains a sequence, ATTGAAAG, which may be implicated as a consensus sequence involved in catabolite repression in the genus Bacillus. INTRODUCTION In the genus Bacillus, catabolite repression is observed not only in adaptive enzyme synthesis but also at the onset of sporulation (1,2). Several research groups have inferred the existence of a common mechanism regulating gene expression of these systems (2,3). Catabolite repression in this genus cannot be explained by a mechanism involving a cyclic AMP receptor protein-cyclic AMP complex, such as that which has been well found in enteric bacteria (4,5), because vegetative cells of Bacillus species contain neither detectable cyclic AMP nor adenyl cyclase (6,7,8). Consequently, catabolite repression in the genus Bacillus is one of the unsolved problems in the regulation of gene expression. Moreover, recent research has suggested that cyclic AMP might not be the exclusive regulator of catabolite repression even in enteric bacteria (9). *
To whom correspondence should be addressed
Expression of the gluconate (gnt) operon of Bacillus subtilis, which is involved in the utilization of gluconate, is under catabolite repression (3,10). This operon consists of four genes, 5' gntR, gntK, gntP and gntZ 3'. The gntR, gntK and gntP genes encode the gnt repressor, gluconate kinase and permease, respectively; the function of the last gene (gntZ) is unknown (1 1,12,13). The operon is transcribed as a polycistronic message initiating at the gnt promoter upstream of the gntR gene and terminating downstream of the gntZ gene (11,14). mRNA synthesis is induced upon the addition of gluconate to the medium; this induction is subject to catabolite repression (1 1,14). Besides the gnt promoter, the gnt operon carries two internal tandem promoters in front of the gntZ gene (P2 and P3). mRNA synthesis from these promoters is constitutive and is not subject to catabolite repression (11). In this study, to reveal the mechanism underlying catabolite repression of the B. subtilis gnt operon, which is regulated at the transcriptional level, we performed deletion analysis of sequences of the gnt operon to identify the cis sequence which is involved in catabolite repression. This deletion analysis revealed the unexpected fact that the cis sequence involved in catabolite repression could be localized to the region downstream of the gnt promoter between nucleotide positions + 137 and + 148 (the transcription initiation nucleotide of the gnt operon is assigned as + 1). This region contains a sequence, ATTGAAAG, of which similar ones are found in the regions downstream of the transcription initiation sites of various Bacillus genes which are under catabolite repression. This is in clear contrast to the cis sequences in catabolic operons of Escherichia coli, to which a positive regulator of a cyclic AMP-cyclic AMP receptor protein complex binds, are located in the regions upstream of their promoters or very close to them (5).
METHODS Bacterial strains and plasmids B. subtilis strain 60015 (trpC2 metC7) was our standard strain. Strain DB204 (trpC2 lys-J phe-J nprR2 nprE2 aprA3 ispAl
7050 Nucleic Acids Research, Vol. 18, No. 23 chloramphenicol-resistant) is a triple mutant deficient in intracellular serine protease, and extracellular alkaline and neutral proteases (15,16,17). Promoter-probe plasmid pWP19, which was derived from plasmid pSB, is a plasmid pUBIIO derivative containing a promoterless subtilisin gene (aprA) preceded by the plasmid pUC 19 polylinker (17,18). Construction of plasmids pgnt34 and pgnt37, and deletion derivatives of plasmid pgnt37 (pgnt37dMSO, pgnt37dM34, pgnt37dM19, pgnt37dMlO and pgnt37dP27) was described previously (19). To construct plasmids pgnt37dM34SA and pgnt38, a 0.6-kb Sau3AI fragment which carries internal constitutive promoters upstream of the gntZ gene (11) was cloned into the BamHI site of plasmids pgnt37dM34 and pgnt37dp27, respectively.
Construction of deletion devivatives of plasmid pgnt38 Plasmids pgnt38d27/148 and pgnt38d27/149 were constructed as follows. Plasmid pgnt38 was digested with BamHI and Asp7l8I, respectively, filled in with the Klenow fragment of DNA polymerase I, ligated with KpnI and BamHI linkers (GGGTACCC and CGGATCCG), digested with KpnI and BamHI, and then recircularized after deletion of a portion. Construction of the plasmids was confirmed by sequencing. To construct plasmids pgnt38d27/109 and pgnt38dl34/148, plasmid pgnt38 was linearized with BamHI and KpnI, respectively, treated with BAL nuclease-S (Takara Shuzo Co., Ltd., Japan), filled in, ligated with BamHI and KpnI linkers, and digested with BamHI and KpnI, and then the respective BamHIKpnI fragments (the approximate lengths were 50 and 100 bps) were ligated with the BamHI-KpnI arm of plasmid pgnt38. Sequencing of the resulting deletion plasmids indicated that plasmid pgnt38d27/109 carried the largest deletion among deletions from the BamHI site and that plasmid pgnt38dl34/148 carried the smallest deletion among those from the KpnI site. To construct plasmids pgnt38d27/128 and pgnt38d27/136, gene cartridges carrying BamHI and KpnI cohesive ends (3 1-mer and 23-mer DNAs, and 23-mer and 15-mer DNAs) were chemically synthesized, respectively, and ligated with the BamHI-KpnI arm of plasmid pgnt38. Construction of the plasmids was confirmed by sequencing.
in the culture medium was assayed by the method of Millet (23) with modifications, as described previously (17).
Computer analysis Sequence homology among catabolite-sensitive Bacillus genes was searched for through the use of two-dimensional dot matrixes (Harr plots)(24) generated with a personal computer (NEC/PC9801) using the Genetyx program (Software Development Co., Ltd., Japan).
RESULTS Deletion of the gnt promoter and its upstream region does not affect catabolite repression of the gnt operon We attempted to identify the cis sequence which is involved in catabolite repression by deletion analysis of sequences of the gnt operon. As described previously (17,19), a series of deletion derivatives of plasmid pgnt34 was constructed by deletion from the 5'-end of a 1.7-kb insert which carries the gnt promoter, the gntR gene and the N-terminal portion of the gntK gene ending at nucleotide position +888 (Fig. 1). Plasmid pgnt37 and its derivatives (pgnt37dM50, pgnt37dM34 and pgnt37dp27) carry fragments possessing sequences extending from nucleotides -109, -50, -34 and +27 to nucleotide + 888, respectively. Synthesis of the reporter protein, subtilisin, in strain DB204 carrying plasmid pgnt34 was induced 16-fold upon the addition of gluconate to the medium, although a substantial level of its synthesis was observed without gluconate addition (Table 1). This induction was repressed to less than 2-fold the uninduced level
Transformation Ligated DNA was transferred to a competent culture of strain DB204 (20). Transformants which exhibited kanamycinresistance were selected on Tryptose Blood Agar Base (Difco Laboratories) plates containing 10 ,tg kanamycin per ml, which were then examined as to their halo-forming ability on Schaeffer's sporulation agar plates (21) containing 10 jig kanamycin per ml and 2% skim milk.
DNA sequencing Construction of deletion derivatives of plasmid pgnt38 was confirmed by DNA sequencing by the dideoxy chain termination method of Sanger and Coulson (22). Plasmids were purified through the use of agarose gel electrophoresis and annealed with a synthetic 17-mer primer whose sequence corresponds to nucleotide positions + 3963 to + 3979 of the gnt operon, and the DNA was then labelled with [a-32P]dCTP (Amersham).
Subtilisin assay Strain DB204 bearing a plasmid was grown to OD6w = 0.5 in Schaeffer's medium (21) containing 10 ,tg kanamycin per ml with or without 10 mM gluconate and/or glucose at 37°C. Subtilisin
Fiure 1. Structures of plasmid pgnt34 and its deletion derivatives. Plasmid pWPl9 is a plasmid pUBl 10 derivative containing a promoterless subtilisin gene (aprA); Km denotes the gene encoded in plasmid pUBI 10 for kanamycin nucleotidyltransferase (17). Construction of plasmid pgnt34 was described previously (17), which carries a 1.7-kb fragment containing the gnt promoter (Pgnt), the gntR gene and the N-terminal portion of the gntK gene ending at nucleotide +888. Construction of plasmid pgnt37 and its deletion derivatives (pgnt37dM50, pgnt37dM34 and pgnt37dP27) was described previously (19). The respective regions upstream of nucleotide positions -109, -50, -34 and +27 were deleted from plasmid pgnt34; dotted regions of the 1.7-kb fragment being deleted. The BamHI linker was attached to each of these deletion ends.
Nucleic Acids Research, Vol. 18, No. 23 7051 upon the simultaneous addition of glucose. In a similar manner, subtilisin synthesis, which had been induced by gluconate in strain DB204 carrying plasmid pgnt37 or pgnt37dM50, was repressed upon the addition of glucose to the medium (Table 1). The fact that deletion of the region upstream of the gnt promoter did not affect catabolite repression of subtilisin synthesis clearly indicates that the cis sequence involved in catabolite repression is located in the region downstream of nucleotide position -50. Further deletion destroyed the gnt promoter, so that subtilsin synthesis in strain DB204 carrying pgnt37dM34 or pgnt37dP27 was too low for us to judge whether it was under catabolite repression or not. To restore promoter activity for expression of the subtilisin gene and then to further localize the site of catabolite repression, a 0.6-kb Sau3AI fragment which carries the internal constitutive promoters upstream of the gntZ gene (11) was inserted into the BamHI sites of plasmids pWP19, pgnt37dM34 and pgnt37dP27; the sites of the latter two plasmids are located in front of the gntR gene. The respective resulting plasmids were designated plasmids as pWP19SA, pgnt37dM34SA and pgnt38 (Fig. 2). Table 1 shows that synthesis of subtilisin, which was constitutively synthesized without the addition of gluconate in strain DB204 carrying plasmid pgnt37dM34SA or pgnt38, was reduced to approximately 20%, whereas constitutive synthesis of subtilisin in strain DB204 bearing plasmid pWP19SA was reduced only to 80% upon its addition. The results of this deletion analysis indicated that the cis sequence involved in the catabolite repression is located in the region downstream of nucleotide position +27.
Finer localization of the cis sequence involved in catabolite repression To localize further the cis sequence involved in catabolite repression, we constructed a series of plasmid pgnt38 derivatives Table 1. Catabolite repression of subtilisin synthesis in strain DB204 bearing plasmid pgnt34 or pgnt37, or a derivative of the latter. Plasmid in strain DB204
Addition
pWPl9
None Gluconate Gluconate None Gluconate Gluconate None Gluconate Gluconate None Gluconate Gluconate None Gluconate Gluconate None Gluconate Gluconate None Glucose
pgnt34 pgnt37 pgnt37dM50 pgnt37dM34 pgnt37dP27
pWP19SA pgnt37dM34SA pgnt38
Subtilisin Activity
(units/OD6W
None Glucose None
Glucose
+ glucose + glucose + glucose + glucose + glucose
+ glucose
with deletions extending from its BamHI site; each deletion is illustrated in Fig. 2. As shown in Table 2, strain DB204 bearing plasmid pgnt38d27/109, pgnt38d27/128 or pgnt38d27/136 constitutively synthesized subtilisin without the addition of
A
B pgnt38 pgnt38d27/ 109 pgnt38d27/ 128 pgnt38d27/ 136 pgnt38d27/ 148 pgnt38d27/ 149
pgnt38dl34/1
per ml x 103)
2 1 1 49 796 88 54 638 58 41 634 78 5 4 3 6 7 4 222 190 95 18 99 22
Cells bearing each plasmid were grown with or without 10 mM glucose, and subtilisin in the medium was assayed as described under Methods.
Kpn I
G GTCTGATTGAAAGCGGTACC
+A4+136 +1AB-
Figure 2. Structures of plasmid pgnt38 and its deletion derivatives. A Structure of plasmid pgnt38. Plasmid pgnt38 consists of plasmid pUBi 10 derivative pWPl9 (Km and aprA denote the nucleotidyl transferase and subtilisin genes, respectively), a 1.0-kb BamHI-EcoRI fragment carrying the promoterless gntR gene and a 0.6-kb Sau3AI fragment carrying internal tandem promoters of the gnt operon (P2 and P3)(1 1). As shown in the lower part, the gnt operon possesses not only the gnt promoter (Pgnt) but also internal promoters in front of the gntZ gene, from which a 1.4-kb transcript was constitutively synthesized (11). B Structures of the deletion derivatives of plasmid pgnt38. These pgnt38 derivatives; pgnt38d27/109, pgnt38d27/128, pgnt38d27/136, pgnt38d27/148, pgntd38/149 and pgnt38dl34/148, carry deletions between nucleotide positions +27 to + 109, +27 to +128, +27 to +136, +27 to +148, +27 to +149, and +134 to +148, respectively; open regions between the BamHI and KpnI cleavage sites upstream of the aprA gene being deleted. At the bottom is shown the sequence between + 134 and + 152 containing the KpnI site (1 1,14). These deletions revealed that the cis sequence involved in catabolite repression of the gnt operon is located between + 137 and + 148. This DNA segment contains a sequence, ATTGAAAG (shown as bold-face), which might be a consensus sequence involved in catabolite repression in the genus Bacillus.
7052 Nucleic Acids Research, Vol. 18, No. 23
gluconate, and the synthesis was reduced to less than 25 % upon the addition of glucose. However, constitutive synthesis of subtilisin in strain DB204 carrying plasmid pgnt38d27/148 or pgnt38d27/149 was reduced to only approximately 80% upon the addition of glucose. The results clearly indicate that the cis sequence involved in catabolite repression is located between nucleotides + 137 and +148. To confirm this, we tried to introduce a deletion upstream from the KpnI site. Plasmid pgnt38dl34/148 carried the smallest deletion among the deletion plasmids constructed. Constitutive synthesis of subtilisin in strain DB204 carrying plasnid pgnt38dl34/148 was not repressed upon the addition of glucose. We conclude that the cis sequence involved in catabolite repression is located between nucleotides + 137 and + 148 (Fig. 2).
Search for a consensus sequence involved in catabolite repression in the genus Bacillus To search for a consensus sequence of catabolite repression in the genus Bacillus, we compared, by Harr plotting (24), a sequence of the gnt operon (+ 1 10 to + 170) with each of the sequences (-200 to +500) of the catabolite-sensitive Bacillus Table 2. Catabolite repression of subtilisin synthesis in strain DB204 bearing plasmid pgnt38 or its deletion derivative. Plasmid in strain DB204
Addition
pgnt38
None Glc None Glc None Glc None Glc None Glc None
pgnt38d27/109
pgnt38d27/128 pgnt38d27/136 pgnt38d27/148 pgnt38d27/149
pgnt38dl34/148
Subtilisin Activity (units/OD6(o per mI x
Ratio (%)
103) (Glc/None)
101 21 98 24 94 13 107 26 98 89 88 72 103 85
Glc None Glc
21 24
14 24 91 82 83
Cells bearing each plasmid were grown with or without 10 mM glucose (Gic), and subtilisin in the medium was assayed as described under Methods. Table 3. The deduced consensus sequence downstream from promoters of Bacillus genes subject to catabolite repression. Gene
Sequence
Reference
+140ATTGAAAG +147 +201 ATTGAAAC +208 +154TTTAAAAG +161 +29ATTGAAAG +36 +35TTTGAAAG +42
11,14 25 26 27 28
+179 A T T G G A A A +186
29
+1OATTGAAAG +17
30
B. subtilis
gnt hut citB sdh
amyE B. amyloliquefaciens amy B. licheniformis
amyL
A T T G A A A G (Consensus) 5 7 7 6 6 7 7 5 N/7
The transcription initiation nucleotide of each gene is assigned as + 1. A consensus sequence, ATTGAAAG, was deduced. N is the number of identical bases at the respective positions of the 7 sequences compared.
genes whose
transcription initiation bases had been identified (Table 3). We found that all the Bacillus genes compared contain a common sequence exhibiting homology to a sequence of the gnt operon (ATTGAAAG, + 140 to + 147). Interestingly, this sequence is located in the DNA segment (+ 137 to + 148) which was proved to be involved in catabolite repression of the gnt operon through the above deletion analysis (Fig. 2). As shown in Table 3, we infer that the sequence, ATTGAAAG, could be a consensus sequence involved in catabolite repression in the genus Bacillus.
DISCUSSION To identify the cis sequence which is involved in catabolite repression of the gnt operon, we performed deletion analysis after cloning the DNA fragment carrying the gnt promoter and the gntR gene into a promoter probe vector (pWP19) using the subtilisin gene as a reporter gene. Deletion of the region upstream of the gnt promoter did not affect catabolite repression of subtilisin synthesis. Further deletion of the gnt promoter and gntR coding region was performed after restoration of promoter activity through the insertion of internal constitutive promoters of the gnt operon before the gntR gene. The results indicated that the cis sequence involved in catabolite repression of the gnt operon is located between nucleotide positions + 137 and + 148. However, we could not exclude the possibility that another site might have been located elsewhere in the deleted region, which was masked owing to the presence of the currently identified sequence. When the sequence of the gnt operon (+ 1 10 to + 170) surrounding this region (+ 137 to + 148) was compared by Harr plotting with each of the sequences (-200 to +500) of the catabolite-sensitive Bacillus genes, a consensus sequence (ATTGAAAG) was found (Table 3), which is located in the DNA segment (+ 137 to + 148) that was concluded to be involved in catabolite repression of the gnt operon through the above deletion analysis. We propose that the sequence, ATTGAAAG, could be a consensus sequence of catabolite repression in the genus Bacillus which is recognized by some common factor involved in catabolite repression. Recently, similar deletion analysis of the site of catabolite repression of the B. subtilis hut operon (25) by Oda et al. revealed that the region involved in catabolite repression is located in the coding region of the hutP gene (ORF 1 )(presented at the Annual Meeting of the Japan Society for Bioscience, Biotechnology, and Agrochemistry, Fukuoka, 1990). This region contains the sequence, ATTGAAAC, which might be the cis sequence involved in catabolite repression of the hut operon according to our prediction (Table 3). On the other hand, Yoshikawa et al. (31) suggested that the cis sequence involved in catabolite repression of the amy gene of B. amyloliquefaciens was not located in its promoter region or the following coding region of the signal peptide of t-amylase, but that it might be located in the coding region of mature ce-amylase. This fact agrees with our prediction that the sequence, ATTGGAAA, located in the coding region of mature ao-amylase might be the cis sequence involved in catabolite repression of the amy gene. As shown in Table 3, the sequences (ATTGAAAG and TTTGAAAG) which were predicted to be responsible for catabolite represssion of the ct-amylase genes (amyL and amyE) of B. licheniformis and B. subtilis, respectively, are close to their transcription initiation sites. As described by Laoide and McConnell (32), the sequence, ATTGAAAG, for the amvL gene is included in the 108-bp sequence which was sufficient for mediation of catabolite
Nucleic Acids Research, Vol. 18, No. 23 7053 repression of the amyL gene. However, the sequence, TTTGAAAG, for the amyE gene is not included in but is very close to the operator-like sequence which is involved in catabolite repression, as reported by Nicolson et al. (28). The predicted sequences involved in catabolite repression in the genus Bacillus have all been located in the regions downstream of their promoters (Table 3). This location is in clear contrast to those of binding sites in the promoter region, with which the complex cyclic AMP-receptor protein-cyclic AMP interacts to activate many E. coli catabolic operons (5). Catabolite repression in the genus Bacillus is probably independent of the promoter used and of the distance of the expressed gene from the promoter which transcribes it, as shown for the B. subtilis gnt and hut operons (this work and Oda et al., presented at the above 1990 meeting), and the B. amyloliquefaciens amy (31) and B. licheniformis amyL (30) genes. Although catabolite repression in the genus Bacillus seems to be regulated at the transcriptional level, it is very hard to deduce the mechanism underlying catabolite repression in this genus without further information on the transcription of these catabolite-repressible systems. Currently, we are analyzing catabolite repression of the gnt operon on the basis of the following working hypothesis. Catabolite repression in the genus Bacillus involves transcription attenuation at a site with the consensus sequence. In the absence of glucose in the medium, transcription continues past this site but in the presence of glucose it terminates there. This repression might be mediated via a common negative factor (probably a protein) which recognizes this consensus sequence directly or indirectly. Very recently, Weickert and Chambliss found homologous sequences in catabolite-sensitive Bacillus promoters (33). There might be two distinct regulatory mechanisms underlying catabolite repression in this genus.
ACKNOWLEDGMENTS We are grateful to R. H. Doi for providing B. subtilis strain DB204 and plasmid pWP19. We thank T. Fujita for her help in construction of deletion plasmids. This work was supported in part by a Grand-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Science, and Culture of Japan.
REFERENCES 1. Freese, E., and Fujita, Y. (1976) In Schlessinger, D. (ed.), Microbiology-1976, American Society for Microbiology, Washington, D. C., pp. 164-184. 2. Sonenshein, A. L. (1989) In Smith, I., Slepecky, R. A., and Setlow, P. (eds.), Regulation of Procaryotic Development, American Society for Microbiology, Washington, D. C., pp. 109-130. 3. Nihashi, J., and Fujita, Y. (1984) Biochim. Biophys. Acta 798, 88-95. 4. Pastan, I., and Adhya, S. (1976) BacterioL Rev. 40, 527-551. 5. de Crombrugghe, B., Busby, S., and Buc, H. (1984) Science 224, 831-838. 6. Ide, M. (1971) Arch. Biochem. Biophys. 144, 262 -268. 7. Setlow, P. (1973) Biochem. Biophys. Res. Comnumn. 52, 365 -372. 8. Biville, F., and Guiso, N. (1985) J. Gen. Microbiol., 131, 2953-2960. 9. Ullmann, A., and Danchin, A. (1983) Adv. Cyclic Nucleotide Res., 15, 1-53. 10. Fujita, Y., Nihashi, J., and Fujita, T. (1986) J. Gen. Microbiol. 132, 161-169. 11. Fujita, Y., Fujita, T., Miwa, Y., Nihashi, J., and Aratani, Y. (1986) J. BioL Chem. 261, 13744-13753. 12. Fujita, Y., and Fujita, T. (1987) Proc. Natl. Acad. Sci. USA 84, 4524-4528. 13. Miwa, Y., and Fujita, Y. (1988) J. Biol. Chem. 263, 13252-13257. 14. Fujita, Y., and Fujita, T. (1986) Nucleic Acids Res. 14, 1237-1252. 15. Koide, Y., Nakamura, A., Uozumi, T., and Beppu, T. (1986) J. Bacteriol.
167, 110-116. Kawamura, F., and Doi, R. H. (1984) J. Bacteriol. 160, 442-444. Fujita, Y., and Miwa, Y. (1989) J. Biol. Chem. 264, 4201-4206. Wang, L., and Doi, R. H. (1987) Mol. Gen. Genet. 207, 114-119. Fujita, Y., Fujita, T., and Miwa, Y. (1990) FEBS Len. 267, 71-74. Shibata, T., and Saito, H. (1973) Mutat. Res. 20, 159-173. 21. Schaeffer, P., Ionesco, H., Ryter, A., and Balassa, G. (1965) Int. C. N. R. S. 124, 553-563. 22. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 23. Millet, J. (1970) J. Appl. Bacteiol. 33, 207-219. 24. Staden, R. (1982) Nucleic Acids Res. 10, 2951-2961. 25. Oda, M., Sugishita, A., and Furukawa, K. (1988) J. Bacteriol. 170 3199-3205. 26. Dingman, D. W., and Sonenshein, A. L. (1987) J. Bacteriol. 169, 3062-3067. 27. Melin, L., Magnusson, K., and Rutberg, L. (1987) J. Bacteriol. 169 3232-3236. 28. Nicholson, W. L., Park, Y. -K., Henkin, T. M., Won, M., Weickert, M. J., Gaskell, J. A., and Chambliss, G. H. (1987) J. MoL Biol. 198, 609-618. 29. Lehtovaara, P., Ulmanen, I., and Palva, I. (1984) Gene 30, 11-16. 30. Laoide, B. M., Chambliss, G. H., and McConnell, D. J. (1989) J. Bacteriol 171, 2435-2442. 31. Yoshikawa, H., Yamashita, S., Kazami, J., Kawamura, F., Takahashi, H., and Saito, H. (1988) In Ganesan, A. T., and Hoch, J. A. (eds.), Genetics and Biotechnology of Bacilli, vol. 2, Academic Press, New York, pp. 135-139. 32. Laoide, B. M., and McConnell, D. J. (1989) J. Bacteriol. 171, 2443 -2450. 33. Weickert, M. J., and Chambliss, G. H. (1990) Proc. Natl. Acad. Sci. USA 87, 6238-6242. 16. 17. 18. 19. 20.
Determination of the cis sequence involved in catabolite repression of the Bacillus subtilis gnt operon; implication of a consensus sequence in catabolite repression in the genus Bacillus Yasuhiko Miwa and Yasutaro Fujita* Department of Biotechnology, Faculty of Engineering, Fukuyama University, Fukuyama 729-02, Japan Received July 24, 1990; Revised and Accepted November 5, 1990
ABSTRACT The mechanism underlying catabolite repression in Bacillus species remains unsolved. The gluconate (gnt) operon of Bacillus subtilis is one of the catabolic operons which is under catabolite repression. To identify the cis sequence involved in catabolite repression of the gnt operon, we performed deletion analysis of a DNA fragment carrying the gnt promoter and the gntR gene, which had been cloned into the promoter probe vector, pWP19. Deletion of the region upstream of the gnt promoter did not affect catabolite repression. Further deletion analysis of the gnt promoter and gntR coding region was carried out after restoration of promoter activity through the insertion of internal constitutive promoters of the gnt operon before the gntR gene (P2 and P3). These deletions revealed that the cis sequence involved in catabolite repression of the gnt operon is located between nucleotide positions + 137 and + 148. This DNA segment contains a sequence, ATTGAAAG, which may be implicated as a consensus sequence involved in catabolite repression in the genus Bacillus. INTRODUCTION In the genus Bacillus, catabolite repression is observed not only in adaptive enzyme synthesis but also at the onset of sporulation (1,2). Several research groups have inferred the existence of a common mechanism regulating gene expression of these systems (2,3). Catabolite repression in this genus cannot be explained by a mechanism involving a cyclic AMP receptor protein-cyclic AMP complex, such as that which has been well found in enteric bacteria (4,5), because vegetative cells of Bacillus species contain neither detectable cyclic AMP nor adenyl cyclase (6,7,8). Consequently, catabolite repression in the genus Bacillus is one of the unsolved problems in the regulation of gene expression. Moreover, recent research has suggested that cyclic AMP might not be the exclusive regulator of catabolite repression even in enteric bacteria (9). *
To whom correspondence should be addressed
Expression of the gluconate (gnt) operon of Bacillus subtilis, which is involved in the utilization of gluconate, is under catabolite repression (3,10). This operon consists of four genes, 5' gntR, gntK, gntP and gntZ 3'. The gntR, gntK and gntP genes encode the gnt repressor, gluconate kinase and permease, respectively; the function of the last gene (gntZ) is unknown (1 1,12,13). The operon is transcribed as a polycistronic message initiating at the gnt promoter upstream of the gntR gene and terminating downstream of the gntZ gene (11,14). mRNA synthesis is induced upon the addition of gluconate to the medium; this induction is subject to catabolite repression (1 1,14). Besides the gnt promoter, the gnt operon carries two internal tandem promoters in front of the gntZ gene (P2 and P3). mRNA synthesis from these promoters is constitutive and is not subject to catabolite repression (11). In this study, to reveal the mechanism underlying catabolite repression of the B. subtilis gnt operon, which is regulated at the transcriptional level, we performed deletion analysis of sequences of the gnt operon to identify the cis sequence which is involved in catabolite repression. This deletion analysis revealed the unexpected fact that the cis sequence involved in catabolite repression could be localized to the region downstream of the gnt promoter between nucleotide positions + 137 and + 148 (the transcription initiation nucleotide of the gnt operon is assigned as + 1). This region contains a sequence, ATTGAAAG, of which similar ones are found in the regions downstream of the transcription initiation sites of various Bacillus genes which are under catabolite repression. This is in clear contrast to the cis sequences in catabolic operons of Escherichia coli, to which a positive regulator of a cyclic AMP-cyclic AMP receptor protein complex binds, are located in the regions upstream of their promoters or very close to them (5).
METHODS Bacterial strains and plasmids B. subtilis strain 60015 (trpC2 metC7) was our standard strain. Strain DB204 (trpC2 lys-J phe-J nprR2 nprE2 aprA3 ispAl
7050 Nucleic Acids Research, Vol. 18, No. 23 chloramphenicol-resistant) is a triple mutant deficient in intracellular serine protease, and extracellular alkaline and neutral proteases (15,16,17). Promoter-probe plasmid pWP19, which was derived from plasmid pSB, is a plasmid pUBIIO derivative containing a promoterless subtilisin gene (aprA) preceded by the plasmid pUC 19 polylinker (17,18). Construction of plasmids pgnt34 and pgnt37, and deletion derivatives of plasmid pgnt37 (pgnt37dMSO, pgnt37dM34, pgnt37dM19, pgnt37dMlO and pgnt37dP27) was described previously (19). To construct plasmids pgnt37dM34SA and pgnt38, a 0.6-kb Sau3AI fragment which carries internal constitutive promoters upstream of the gntZ gene (11) was cloned into the BamHI site of plasmids pgnt37dM34 and pgnt37dp27, respectively.
Construction of deletion devivatives of plasmid pgnt38 Plasmids pgnt38d27/148 and pgnt38d27/149 were constructed as follows. Plasmid pgnt38 was digested with BamHI and Asp7l8I, respectively, filled in with the Klenow fragment of DNA polymerase I, ligated with KpnI and BamHI linkers (GGGTACCC and CGGATCCG), digested with KpnI and BamHI, and then recircularized after deletion of a portion. Construction of the plasmids was confirmed by sequencing. To construct plasmids pgnt38d27/109 and pgnt38dl34/148, plasmid pgnt38 was linearized with BamHI and KpnI, respectively, treated with BAL nuclease-S (Takara Shuzo Co., Ltd., Japan), filled in, ligated with BamHI and KpnI linkers, and digested with BamHI and KpnI, and then the respective BamHIKpnI fragments (the approximate lengths were 50 and 100 bps) were ligated with the BamHI-KpnI arm of plasmid pgnt38. Sequencing of the resulting deletion plasmids indicated that plasmid pgnt38d27/109 carried the largest deletion among deletions from the BamHI site and that plasmid pgnt38dl34/148 carried the smallest deletion among those from the KpnI site. To construct plasmids pgnt38d27/128 and pgnt38d27/136, gene cartridges carrying BamHI and KpnI cohesive ends (3 1-mer and 23-mer DNAs, and 23-mer and 15-mer DNAs) were chemically synthesized, respectively, and ligated with the BamHI-KpnI arm of plasmid pgnt38. Construction of the plasmids was confirmed by sequencing.
in the culture medium was assayed by the method of Millet (23) with modifications, as described previously (17).
Computer analysis Sequence homology among catabolite-sensitive Bacillus genes was searched for through the use of two-dimensional dot matrixes (Harr plots)(24) generated with a personal computer (NEC/PC9801) using the Genetyx program (Software Development Co., Ltd., Japan).
RESULTS Deletion of the gnt promoter and its upstream region does not affect catabolite repression of the gnt operon We attempted to identify the cis sequence which is involved in catabolite repression by deletion analysis of sequences of the gnt operon. As described previously (17,19), a series of deletion derivatives of plasmid pgnt34 was constructed by deletion from the 5'-end of a 1.7-kb insert which carries the gnt promoter, the gntR gene and the N-terminal portion of the gntK gene ending at nucleotide position +888 (Fig. 1). Plasmid pgnt37 and its derivatives (pgnt37dM50, pgnt37dM34 and pgnt37dp27) carry fragments possessing sequences extending from nucleotides -109, -50, -34 and +27 to nucleotide + 888, respectively. Synthesis of the reporter protein, subtilisin, in strain DB204 carrying plasmid pgnt34 was induced 16-fold upon the addition of gluconate to the medium, although a substantial level of its synthesis was observed without gluconate addition (Table 1). This induction was repressed to less than 2-fold the uninduced level
Transformation Ligated DNA was transferred to a competent culture of strain DB204 (20). Transformants which exhibited kanamycinresistance were selected on Tryptose Blood Agar Base (Difco Laboratories) plates containing 10 ,tg kanamycin per ml, which were then examined as to their halo-forming ability on Schaeffer's sporulation agar plates (21) containing 10 jig kanamycin per ml and 2% skim milk.
DNA sequencing Construction of deletion derivatives of plasmid pgnt38 was confirmed by DNA sequencing by the dideoxy chain termination method of Sanger and Coulson (22). Plasmids were purified through the use of agarose gel electrophoresis and annealed with a synthetic 17-mer primer whose sequence corresponds to nucleotide positions + 3963 to + 3979 of the gnt operon, and the DNA was then labelled with [a-32P]dCTP (Amersham).
Subtilisin assay Strain DB204 bearing a plasmid was grown to OD6w = 0.5 in Schaeffer's medium (21) containing 10 ,tg kanamycin per ml with or without 10 mM gluconate and/or glucose at 37°C. Subtilisin
Fiure 1. Structures of plasmid pgnt34 and its deletion derivatives. Plasmid pWPl9 is a plasmid pUBl 10 derivative containing a promoterless subtilisin gene (aprA); Km denotes the gene encoded in plasmid pUBI 10 for kanamycin nucleotidyltransferase (17). Construction of plasmid pgnt34 was described previously (17), which carries a 1.7-kb fragment containing the gnt promoter (Pgnt), the gntR gene and the N-terminal portion of the gntK gene ending at nucleotide +888. Construction of plasmid pgnt37 and its deletion derivatives (pgnt37dM50, pgnt37dM34 and pgnt37dP27) was described previously (19). The respective regions upstream of nucleotide positions -109, -50, -34 and +27 were deleted from plasmid pgnt34; dotted regions of the 1.7-kb fragment being deleted. The BamHI linker was attached to each of these deletion ends.
Nucleic Acids Research, Vol. 18, No. 23 7051 upon the simultaneous addition of glucose. In a similar manner, subtilisin synthesis, which had been induced by gluconate in strain DB204 carrying plasmid pgnt37 or pgnt37dM50, was repressed upon the addition of glucose to the medium (Table 1). The fact that deletion of the region upstream of the gnt promoter did not affect catabolite repression of subtilisin synthesis clearly indicates that the cis sequence involved in catabolite repression is located in the region downstream of nucleotide position -50. Further deletion destroyed the gnt promoter, so that subtilsin synthesis in strain DB204 carrying pgnt37dM34 or pgnt37dP27 was too low for us to judge whether it was under catabolite repression or not. To restore promoter activity for expression of the subtilisin gene and then to further localize the site of catabolite repression, a 0.6-kb Sau3AI fragment which carries the internal constitutive promoters upstream of the gntZ gene (11) was inserted into the BamHI sites of plasmids pWP19, pgnt37dM34 and pgnt37dP27; the sites of the latter two plasmids are located in front of the gntR gene. The respective resulting plasmids were designated plasmids as pWP19SA, pgnt37dM34SA and pgnt38 (Fig. 2). Table 1 shows that synthesis of subtilisin, which was constitutively synthesized without the addition of gluconate in strain DB204 carrying plasmid pgnt37dM34SA or pgnt38, was reduced to approximately 20%, whereas constitutive synthesis of subtilisin in strain DB204 bearing plasmid pWP19SA was reduced only to 80% upon its addition. The results of this deletion analysis indicated that the cis sequence involved in the catabolite repression is located in the region downstream of nucleotide position +27.
Finer localization of the cis sequence involved in catabolite repression To localize further the cis sequence involved in catabolite repression, we constructed a series of plasmid pgnt38 derivatives Table 1. Catabolite repression of subtilisin synthesis in strain DB204 bearing plasmid pgnt34 or pgnt37, or a derivative of the latter. Plasmid in strain DB204
Addition
pWPl9
None Gluconate Gluconate None Gluconate Gluconate None Gluconate Gluconate None Gluconate Gluconate None Gluconate Gluconate None Gluconate Gluconate None Glucose
pgnt34 pgnt37 pgnt37dM50 pgnt37dM34 pgnt37dP27
pWP19SA pgnt37dM34SA pgnt38
Subtilisin Activity
(units/OD6W
None Glucose None
Glucose
+ glucose + glucose + glucose + glucose + glucose
+ glucose
with deletions extending from its BamHI site; each deletion is illustrated in Fig. 2. As shown in Table 2, strain DB204 bearing plasmid pgnt38d27/109, pgnt38d27/128 or pgnt38d27/136 constitutively synthesized subtilisin without the addition of
A
B pgnt38 pgnt38d27/ 109 pgnt38d27/ 128 pgnt38d27/ 136 pgnt38d27/ 148 pgnt38d27/ 149
pgnt38dl34/1
per ml x 103)
2 1 1 49 796 88 54 638 58 41 634 78 5 4 3 6 7 4 222 190 95 18 99 22
Cells bearing each plasmid were grown with or without 10 mM glucose, and subtilisin in the medium was assayed as described under Methods.
Kpn I
G GTCTGATTGAAAGCGGTACC
+A4+136 +1AB-
Figure 2. Structures of plasmid pgnt38 and its deletion derivatives. A Structure of plasmid pgnt38. Plasmid pgnt38 consists of plasmid pUBi 10 derivative pWPl9 (Km and aprA denote the nucleotidyl transferase and subtilisin genes, respectively), a 1.0-kb BamHI-EcoRI fragment carrying the promoterless gntR gene and a 0.6-kb Sau3AI fragment carrying internal tandem promoters of the gnt operon (P2 and P3)(1 1). As shown in the lower part, the gnt operon possesses not only the gnt promoter (Pgnt) but also internal promoters in front of the gntZ gene, from which a 1.4-kb transcript was constitutively synthesized (11). B Structures of the deletion derivatives of plasmid pgnt38. These pgnt38 derivatives; pgnt38d27/109, pgnt38d27/128, pgnt38d27/136, pgnt38d27/148, pgntd38/149 and pgnt38dl34/148, carry deletions between nucleotide positions +27 to + 109, +27 to +128, +27 to +136, +27 to +148, +27 to +149, and +134 to +148, respectively; open regions between the BamHI and KpnI cleavage sites upstream of the aprA gene being deleted. At the bottom is shown the sequence between + 134 and + 152 containing the KpnI site (1 1,14). These deletions revealed that the cis sequence involved in catabolite repression of the gnt operon is located between + 137 and + 148. This DNA segment contains a sequence, ATTGAAAG (shown as bold-face), which might be a consensus sequence involved in catabolite repression in the genus Bacillus.
7052 Nucleic Acids Research, Vol. 18, No. 23
gluconate, and the synthesis was reduced to less than 25 % upon the addition of glucose. However, constitutive synthesis of subtilisin in strain DB204 carrying plasmid pgnt38d27/148 or pgnt38d27/149 was reduced to only approximately 80% upon the addition of glucose. The results clearly indicate that the cis sequence involved in catabolite repression is located between nucleotides + 137 and +148. To confirm this, we tried to introduce a deletion upstream from the KpnI site. Plasmid pgnt38dl34/148 carried the smallest deletion among the deletion plasmids constructed. Constitutive synthesis of subtilisin in strain DB204 carrying plasnid pgnt38dl34/148 was not repressed upon the addition of glucose. We conclude that the cis sequence involved in catabolite repression is located between nucleotides + 137 and + 148 (Fig. 2).
Search for a consensus sequence involved in catabolite repression in the genus Bacillus To search for a consensus sequence of catabolite repression in the genus Bacillus, we compared, by Harr plotting (24), a sequence of the gnt operon (+ 1 10 to + 170) with each of the sequences (-200 to +500) of the catabolite-sensitive Bacillus Table 2. Catabolite repression of subtilisin synthesis in strain DB204 bearing plasmid pgnt38 or its deletion derivative. Plasmid in strain DB204
Addition
pgnt38
None Glc None Glc None Glc None Glc None Glc None
pgnt38d27/109
pgnt38d27/128 pgnt38d27/136 pgnt38d27/148 pgnt38d27/149
pgnt38dl34/148
Subtilisin Activity (units/OD6(o per mI x
Ratio (%)
103) (Glc/None)
101 21 98 24 94 13 107 26 98 89 88 72 103 85
Glc None Glc
21 24
14 24 91 82 83
Cells bearing each plasmid were grown with or without 10 mM glucose (Gic), and subtilisin in the medium was assayed as described under Methods. Table 3. The deduced consensus sequence downstream from promoters of Bacillus genes subject to catabolite repression. Gene
Sequence
Reference
+140ATTGAAAG +147 +201 ATTGAAAC +208 +154TTTAAAAG +161 +29ATTGAAAG +36 +35TTTGAAAG +42
11,14 25 26 27 28
+179 A T T G G A A A +186
29
+1OATTGAAAG +17
30
B. subtilis
gnt hut citB sdh
amyE B. amyloliquefaciens amy B. licheniformis
amyL
A T T G A A A G (Consensus) 5 7 7 6 6 7 7 5 N/7
The transcription initiation nucleotide of each gene is assigned as + 1. A consensus sequence, ATTGAAAG, was deduced. N is the number of identical bases at the respective positions of the 7 sequences compared.
genes whose
transcription initiation bases had been identified (Table 3). We found that all the Bacillus genes compared contain a common sequence exhibiting homology to a sequence of the gnt operon (ATTGAAAG, + 140 to + 147). Interestingly, this sequence is located in the DNA segment (+ 137 to + 148) which was proved to be involved in catabolite repression of the gnt operon through the above deletion analysis (Fig. 2). As shown in Table 3, we infer that the sequence, ATTGAAAG, could be a consensus sequence involved in catabolite repression in the genus Bacillus.
DISCUSSION To identify the cis sequence which is involved in catabolite repression of the gnt operon, we performed deletion analysis after cloning the DNA fragment carrying the gnt promoter and the gntR gene into a promoter probe vector (pWP19) using the subtilisin gene as a reporter gene. Deletion of the region upstream of the gnt promoter did not affect catabolite repression of subtilisin synthesis. Further deletion of the gnt promoter and gntR coding region was performed after restoration of promoter activity through the insertion of internal constitutive promoters of the gnt operon before the gntR gene. The results indicated that the cis sequence involved in catabolite repression of the gnt operon is located between nucleotide positions + 137 and + 148. However, we could not exclude the possibility that another site might have been located elsewhere in the deleted region, which was masked owing to the presence of the currently identified sequence. When the sequence of the gnt operon (+ 1 10 to + 170) surrounding this region (+ 137 to + 148) was compared by Harr plotting with each of the sequences (-200 to +500) of the catabolite-sensitive Bacillus genes, a consensus sequence (ATTGAAAG) was found (Table 3), which is located in the DNA segment (+ 137 to + 148) that was concluded to be involved in catabolite repression of the gnt operon through the above deletion analysis. We propose that the sequence, ATTGAAAG, could be a consensus sequence of catabolite repression in the genus Bacillus which is recognized by some common factor involved in catabolite repression. Recently, similar deletion analysis of the site of catabolite repression of the B. subtilis hut operon (25) by Oda et al. revealed that the region involved in catabolite repression is located in the coding region of the hutP gene (ORF 1 )(presented at the Annual Meeting of the Japan Society for Bioscience, Biotechnology, and Agrochemistry, Fukuoka, 1990). This region contains the sequence, ATTGAAAC, which might be the cis sequence involved in catabolite repression of the hut operon according to our prediction (Table 3). On the other hand, Yoshikawa et al. (31) suggested that the cis sequence involved in catabolite repression of the amy gene of B. amyloliquefaciens was not located in its promoter region or the following coding region of the signal peptide of t-amylase, but that it might be located in the coding region of mature ce-amylase. This fact agrees with our prediction that the sequence, ATTGGAAA, located in the coding region of mature ao-amylase might be the cis sequence involved in catabolite repression of the amy gene. As shown in Table 3, the sequences (ATTGAAAG and TTTGAAAG) which were predicted to be responsible for catabolite represssion of the ct-amylase genes (amyL and amyE) of B. licheniformis and B. subtilis, respectively, are close to their transcription initiation sites. As described by Laoide and McConnell (32), the sequence, ATTGAAAG, for the amvL gene is included in the 108-bp sequence which was sufficient for mediation of catabolite
Nucleic Acids Research, Vol. 18, No. 23 7053 repression of the amyL gene. However, the sequence, TTTGAAAG, for the amyE gene is not included in but is very close to the operator-like sequence which is involved in catabolite repression, as reported by Nicolson et al. (28). The predicted sequences involved in catabolite repression in the genus Bacillus have all been located in the regions downstream of their promoters (Table 3). This location is in clear contrast to those of binding sites in the promoter region, with which the complex cyclic AMP-receptor protein-cyclic AMP interacts to activate many E. coli catabolic operons (5). Catabolite repression in the genus Bacillus is probably independent of the promoter used and of the distance of the expressed gene from the promoter which transcribes it, as shown for the B. subtilis gnt and hut operons (this work and Oda et al., presented at the above 1990 meeting), and the B. amyloliquefaciens amy (31) and B. licheniformis amyL (30) genes. Although catabolite repression in the genus Bacillus seems to be regulated at the transcriptional level, it is very hard to deduce the mechanism underlying catabolite repression in this genus without further information on the transcription of these catabolite-repressible systems. Currently, we are analyzing catabolite repression of the gnt operon on the basis of the following working hypothesis. Catabolite repression in the genus Bacillus involves transcription attenuation at a site with the consensus sequence. In the absence of glucose in the medium, transcription continues past this site but in the presence of glucose it terminates there. This repression might be mediated via a common negative factor (probably a protein) which recognizes this consensus sequence directly or indirectly. Very recently, Weickert and Chambliss found homologous sequences in catabolite-sensitive Bacillus promoters (33). There might be two distinct regulatory mechanisms underlying catabolite repression in this genus.
ACKNOWLEDGMENTS We are grateful to R. H. Doi for providing B. subtilis strain DB204 and plasmid pWP19. We thank T. Fujita for her help in construction of deletion plasmids. This work was supported in part by a Grand-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Science, and Culture of Japan.
REFERENCES 1. Freese, E., and Fujita, Y. (1976) In Schlessinger, D. (ed.), Microbiology-1976, American Society for Microbiology, Washington, D. C., pp. 164-184. 2. Sonenshein, A. L. (1989) In Smith, I., Slepecky, R. A., and Setlow, P. (eds.), Regulation of Procaryotic Development, American Society for Microbiology, Washington, D. C., pp. 109-130. 3. Nihashi, J., and Fujita, Y. (1984) Biochim. Biophys. Acta 798, 88-95. 4. Pastan, I., and Adhya, S. (1976) BacterioL Rev. 40, 527-551. 5. de Crombrugghe, B., Busby, S., and Buc, H. (1984) Science 224, 831-838. 6. Ide, M. (1971) Arch. Biochem. Biophys. 144, 262 -268. 7. Setlow, P. (1973) Biochem. Biophys. Res. Comnumn. 52, 365 -372. 8. Biville, F., and Guiso, N. (1985) J. Gen. Microbiol., 131, 2953-2960. 9. Ullmann, A., and Danchin, A. (1983) Adv. Cyclic Nucleotide Res., 15, 1-53. 10. Fujita, Y., Nihashi, J., and Fujita, T. (1986) J. Gen. Microbiol. 132, 161-169. 11. Fujita, Y., Fujita, T., Miwa, Y., Nihashi, J., and Aratani, Y. (1986) J. BioL Chem. 261, 13744-13753. 12. Fujita, Y., and Fujita, T. (1987) Proc. Natl. Acad. Sci. USA 84, 4524-4528. 13. Miwa, Y., and Fujita, Y. (1988) J. Biol. Chem. 263, 13252-13257. 14. Fujita, Y., and Fujita, T. (1986) Nucleic Acids Res. 14, 1237-1252. 15. Koide, Y., Nakamura, A., Uozumi, T., and Beppu, T. (1986) J. Bacteriol.
167, 110-116. Kawamura, F., and Doi, R. H. (1984) J. Bacteriol. 160, 442-444. Fujita, Y., and Miwa, Y. (1989) J. Biol. Chem. 264, 4201-4206. Wang, L., and Doi, R. H. (1987) Mol. Gen. Genet. 207, 114-119. Fujita, Y., Fujita, T., and Miwa, Y. (1990) FEBS Len. 267, 71-74. Shibata, T., and Saito, H. (1973) Mutat. Res. 20, 159-173. 21. Schaeffer, P., Ionesco, H., Ryter, A., and Balassa, G. (1965) Int. C. N. R. S. 124, 553-563. 22. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 23. Millet, J. (1970) J. Appl. Bacteiol. 33, 207-219. 24. Staden, R. (1982) Nucleic Acids Res. 10, 2951-2961. 25. Oda, M., Sugishita, A., and Furukawa, K. (1988) J. Bacteriol. 170 3199-3205. 26. Dingman, D. W., and Sonenshein, A. L. (1987) J. Bacteriol. 169, 3062-3067. 27. Melin, L., Magnusson, K., and Rutberg, L. (1987) J. Bacteriol. 169 3232-3236. 28. Nicholson, W. L., Park, Y. -K., Henkin, T. M., Won, M., Weickert, M. J., Gaskell, J. A., and Chambliss, G. H. (1987) J. MoL Biol. 198, 609-618. 29. Lehtovaara, P., Ulmanen, I., and Palva, I. (1984) Gene 30, 11-16. 30. Laoide, B. M., Chambliss, G. H., and McConnell, D. J. (1989) J. Bacteriol 171, 2435-2442. 31. Yoshikawa, H., Yamashita, S., Kazami, J., Kawamura, F., Takahashi, H., and Saito, H. (1988) In Ganesan, A. T., and Hoch, J. A. (eds.), Genetics and Biotechnology of Bacilli, vol. 2, Academic Press, New York, pp. 135-139. 32. Laoide, B. M., and McConnell, D. J. (1989) J. Bacteriol. 171, 2443 -2450. 33. Weickert, M. J., and Chambliss, G. H. (1990) Proc. Natl. Acad. Sci. USA 87, 6238-6242. 16. 17. 18. 19. 20.
