Development of a Fluorescent Reporter System to Delineate Cancer Stem Cells in Triple-Negative Breast Cancer.

CANCER STEM CELLS

Department of 1Cellular and Molecular Medicine, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 44915, 2 USA; Molecular Medicine, Cleveland Clinic Lerner College of Medicine of Case Western Reserve University, Cleveland, OH 44195, USA; 3Stem Cell Biology and Regenerative Medicine, Lerner Research Institute, Cleveland 4 Clinic, OH 44195, USA; Case Compre‐ hensive Cancer Center, Cleveland, OH 44106, USA; 5Department of Pathology and Case Comprehensive Cancer Cen‐ ter, Case Western Reserve University, Cleveland, OH, 44106, United States Contact: Dr. Ofer Reizes, Department of Cellular and Molecular Medicine, Lerner Research Institute, 9500 Euclid Ave., NC10 , Cleveland, OH 44195, USA, [email protected], Phone ‐ 216.445.0880, Fax ‐ 216.444.8359; Dr. Justin D. Lathia, Department of Cellular and Molecular Medicine, Lerner Re‐ search Institute, 9500 Euclid Ave., NC10 , Cleveland, OH 44195, USA, la‐ [email protected], Phone ‐ 216.445.7475, Fax ‐ 216.444.8359; *These senior authors contributed equally Received August 07, 2014; accepted for publication February 28, 2015; available online without subscription through the open access option. ©AlphaMed Press 1066‐5099/2015/$30.00/0 This article has been accepted for pub‐ lication and undergone full peer review but has not been through the copyedit‐ ing, typesetting, pagination and proof‐ reading process which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1002/stem.2021

Development of a Fluorescent Reporter Sys‐ tem to Delineate Cancer Stem Cells in Triple‐ Negative Breast Cancer Praveena S. Thiagarajan1, Masahiro Hitomi1,2, James S. Hale1, Alvaro G. Alvarado1,2, Balint Otvos1, Maksim Sinyuk1, Kevin Stoltz1, Andrew Wiechert1, Erin Mulkearns‐ Hubert1, Awad Jarrar1, Qiao Zheng1, Dustin Thomas1,2, Thomas Egelhoff1,2,4, Jeremy N. Rich2,3,4, Huiping Liu4,5, Justin D. Lathia1,2,4*, and Ofer Reizes1,2,4* Key words. Cancer stem cell  triple‐negative breast cancer  NANOG  JAM‐ A  fluorescent reporter system ABSTRACT Advanced cancers display cellular heterogeneity driven by self‐renewing, tumorigenic cancer stem cells (CSCs). The use of cell lines to model CSCs is challenging due to the difficulty of identifying and isolating cell populations that possess differences in self‐renewal and tumor initiation. To overcome these barriers in triple‐negative breast cancer (TNBC), we developed a CSC system utilizing a green fluorescence protein (GFP) reporter for the pro‐ moter of the well‐established pluripotency gene NANOG. NANOG‐GFP+ cells gave rise to both GFP+ and GFP‐ cells, and GFP+ cells possessed in‐ creased levels of the embryonic stem cell transcription factors NANOG, SOX2 and OCT4 and elevated self‐renewal and tumor initiation capacities. GFP+ cells also expressed mesenchymal markers and demonstrated in‐ creased invasion. Compared with the well‐established CSC markers CD24‐ /CD44+, CD49f and aldehyde dehydrogenase (ALDH) activity, our NANOG‐ GFP reporter system demonstrated increased enrichment for CSCs. To ex‐ plore the utility of this system as a screening platform, we performed a flow cytometry screen that confirmed increased CSC marker expression in the GFP+ population and identified new cell surface markers elevated in TNBC CSCs, including junctional adhesion molecule‐A (JAM‐A). JAM‐A was highly expressed in GFP+ cells and patient‐derived xenograft ALDH+ CSCs compared with the GFP‐ and ALDH‐ cells, respectively. Depletion of JAM‐A compromised self‐renewal, whereas JAM‐A overexpression rescued self‐ renewal in GFP‐ cells. Our data indicate that we have defined and devel‐ oped a robust system to monitor differences between CSCs and non‐CSCs in TNBC that can be used to identify CSC‐specific targets for the develop‐ ment of future therapeutic strategies. STEM CELLS 2014; 00:000–000

STEM CELLS 2014;00:00‐00 www.StemCells.com

©AlphaMed Press 2014

2

CSC reporter system in triple-negative breast cancer

INTRODUCTION Breast cancer is the leading cause of cancer‐related deaths among women worldwide [1]. Despite signifi‐ cant advances in the development of hormonal and systemic chemotherapy, response rates remain 30‐60%, and even responsive cancers relapse and develop re‐ sistance [2]. The survival rates of metastatic breast can‐ cer are lower than 5% [3]. The molecular genetics of breast cancer have been extensively investigated, per‐ mitting the association between distinct molecular sub‐ types and patient outcome. Of the different breast can‐ cer subtypes, triple‐negative breast cancer (TNBC) is the most aggressive [4, 5]. TNBC lacks expression of the estrogen and progesterone receptors and does not overexpress ERBB2 [6]. TNBC constitutes 15%‐20% of all breast cancers and is characterized by poor prognosis and the lack of effective specific therapeutic options [7]. TNBC patients show higher rates of early relapse due to refractory drug‐resistant local and/or metastatic dis‐ ease even after an initial effective response to cytotoxic conventional chemotherapy, which remains the main‐ stay of TNBC treatment [8]. The hypothesis that a population of self‐renewing can‐ cer stem cells (CSCs) drives tumor recurrence and me‐ tastasis and underlies TNBC heterogeneity is well sup‐ ported [9‐11]. CSCs are characterized by their ability to propagate tumors and recapitulate the heterogeneity present in the original lesion [12, 13]. TNBCs are re‐ sistant to chemotherapy, and recurrence has been pos‐ tulated to be a result of the chemo‐ and radio‐ resistance exhibited by CSCs [14, 15]. Due to confound‐ ing factors such as cellular heterogeneity and an evolv‐ ing epigenetic state of CSCs, the mechanisms underlying their self‐renewal and role in tumor progression are being actively pursued [16]. While CSCs have been pos‐ tulated to be crucial for TNBC maintenance and pro‐ gression, studying the characteristics of TNBC CSCs re‐ mains a challenge. A major obstacle to the identification of CSC regulatory mechanisms is a lack of experimental systems that enable the reliable enrichment of CSCs from non‐CSCs for comparative analysis [17]. Many groups have isolated TNBC CSCs using CD24‐ negative/CD44‐positive (CD24‐/CD44+) cells and/or through high aldehyde dehydrogenase I activity (ALDH+) [18, 19]. These enrichment paradigms require refine‐ ment, as they are not universally applicable to all breast tumors [20‐22]. Additionally, many CSC studies have been performed primarily in vitro, and as a result, there is limited information regarding the contribution of CSCs to tumor phenotypes in vivo. The main models of in vitro studies have used high passage TNBC cell lines that have not been well‐characterized for CSC studies. Further complicating the study of CSCs in TNBC is the lack of a well‐defined system to analyze these cells in real time. To interrogate the molecular heterogeneity of TNBC cells, we developed a novel CSC reporter system using a www.StemCells.com

GFP reporter driven by the promoter of the embryonic stem cell transcription factor NANOG. NANOG is a stem cell transcription factor and a master regulator of stem cell self‐renewal [23, 24]. NANOG has emerged as a pro‐ carcinogenic factor [25], and immunostaining data show a strong correlation between NANOG and other cancer stem cell markers [25‐28]. NANOG silencing in cancer cells leads to reduced proliferation, self‐renewal based on tumorsphere assays, and tumor initiation in xeno‐ graft transplant studies [23, 29]. We generated two TNBC cell lines (MDA‐MB‐231 and HCC70) in which GFP+ and GFP‐ cells show differences in CSC marker expression and function [30, 31]. The cell surface signa‐ ture of both GFP+ and GFP‐ cells was evaluated using a high‐throughput screening method validated by our group, and we found that NANOG promoter‐driven GFP also enriches for TNBC cells positive for CSC surface markers. The screen revealed additional receptors en‐ riched in CSCs. Our approach has the ability to enrich for a population of CSCs, enabling interrogations to un‐ derstand the key roles of CSCs in TNBC initiation and progression.

MATERIALS AND METHODS Cell culture MDA‐MB‐231 and HCC70 breast cancer cells (American Type Culture Collection; Manassas, VA) were cultured in log‐growth phase in modified Eagle’s medium (MEM) supplemented with 1 mM sodium pyruvate (Cellgro, Kansas City, MO) and 10% heat‐inactivated fetal calf serum (FCS) at 37 °C in a humidified atmosphere (5% CO2).

Triple‐negative breast cancer patient‐derived xenograft tumors Triple‐negative patient‐derived xenograft (PDX)‐TN1 cells were procured and transduced with dTomato as previously described [32].

Immunoblotting Cells were lysed in 20 mM Tris‐HCl (pH 7.5), 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% NP‐40, 1% sodi‐ um pyrophosphate, 1 mM ‐glycerophosphate, 1 mM sodium orthovanadate, 1 ug/mL leupeptin, 20 mM NaF and 1 mM PMSF. Protein concentrations were meas‐ ured using Bradford reagent (BIO‐RAD, Hercules, CA). Lysates (20 g total protein) were resolved by 10% SDS‐ PAGE and electrotransferred to PVDF membrane. Membranes were incubated overnight at 4 °C with pri‐ mary antibodies against NANOG (Cell Signaling), GFP (Zymed), SOX2 (Cell Signaling), OCT4 (Cell Signaling), VIMENTIN (Cell Signaling), N‐CADHERIN (Millipore), GAPDH or ‐ACTIN (Santa Cruz, CA), followed by incuba‐ tion with secondary anti‐mouse or anti‐rabbit IgG anti‐ bodies conjugated to horseradish peroxidase (HRP)


3 (Thermo, Rockford, IL). Immunoreactive bands were visualized using ECL plus from Pierce (Rockford, IL, USA).

Quantitative real‐time PCR (qPCR) qPCR was performed using an ABI 7900HT system with SYBR‐Green MasterMix (SA Biosciences). Briefly, RNA from cells transduced with non‐targeting control or JAM‐A shRNA was extracted using the RNeasy kit (Qi‐ agen), and cDNA was synthesized using the Superscript III kit (Invitrogen, Grand Island, NY). For qPCR analysis, the threshold cycle (CT) values for each gene were nor‐ malized to expression levels of ‐ACTIN. Dissociation curves were evaluated for primer fidelity. The primers used were: ‐Actin Forward 5’‐AGAAAATCTGGCACCACACC‐3’ Reverse 5’‐AGAGGCGTACAGGGATAGCA‐3’ NANOG Forward 5’‐CCCAAAGGCAAACAACCCACTTCT‐3’ Reverse 5’‐AGCTGGGTGGAAGAGAACACAGTT‐3’

Flow cytometry analysis For flow cytometry analysis, MDA‐MB‐231 and HCC70 cells at a concentration of 1 million cells/ mL were sort‐ ed with a BD FACSAria II and subjected to FACS analysis using the following antibodies: phycoerythrin (PE)‐ conjugated Integrin α6 (1:100, BD Biosciences), APC‐ conjugated CD24 (1:100, BD Biosciences), and PE‐ conjugated CD44 (1:100, BD Biosciences). Appropriate isotype control antibodies were used to set gates. Data analysis was performed using the FlowJo software (Tree Star, Inc.). Flow analysis and sorting of PDX cells was performed using APC‐conjugated JAM‐A antibody (1:50, BD Biosciences). Collagen invasion assay The collagen invasion assay was performed as previous‐ ly described [33]. MDA‐MB‐231 and HCC70 GFP+ cells were stained with Vybrant DiO (green), and GFP‐ cells were stained with Vybrant Dil (red). Stained cells were then combined and co‐cultured with unstained macro‐ phages (BAC 1.2F5) in a glass‐bottom tissue culture dish. Cells were then overlaid with a 3 mg/ml collagen gel, bathed in complete DMEM (10% serum), and incu‐ bated overnight. Cells were then fixed with 4% para‐ formaldehyde and imaged using a spinning disk confo‐ cal microscope. A 100 m Z‐stack image series was gen‐ erated. Invasion was quantified as a percentage of green or red fluorescence above a 20 m threshold dis‐ tance from the top surface of the glass bottom dish.

Limiting dilution assays For tumorsphere formation assays, cells were cultured in duplicate rows of serial dilutions per well in a 96‐well plate per condition (Sarsted, Germany) with 200 μl se‐ rum‐free DMEM/F12 medium supplemented with 20 ng/ml basic fibroblast growth factor (Invitrogen), 10 ng/ml epidermal growth factor (BioSource, Grand Island, NY, USA), 2% B27 (Invitrogen), 10 μg/ml insulin, and 1 μg/ml hydrochloride (Sigma). Frequency of sphere www.StemCells.com

CSC reporter system in triple-negative breast cancer formation was calculated in such a way that a well with a tumorsphere was counted as a positive well and a well with no tumorspheres was counted as a negative well. Tumorspheres were counted after 2 weeks under a phase contrast microscope. The stem cell frequencies were calculated using an extreme limiting dilution algo‐ rithm (ELDA) (http://bioinf.wehi.edu.au/software/elda/) [34].

In vivo tumor formation NOD SCID gamma (NSG) mice were purchased from the Biological Resource Unit (BRU) at the Cleveland Clinic. All mice were maintained in microisolator units and provided free access to food and water. All mouse pro‐ cedures were performed under adherence to protocols approved by the Institute Animal Care and Use Commit‐ tee at the Lerner Research Institute, Cleveland Clinic. MDA‐MB‐231 and HCC70 NANOG‐GFP cells were flow sorted for both GFP+ and GFP‐ cells and transduced with a luciferase lentiviral vector construct. GFP+ and GFP‐ cells were then transplanted in serial dilutions of 1000, 10,000 and 100,000 MDA‐MB‐231 cells and 1000, 10,000 and 30,000 HCC70 cells into the right subcuta‐ neous flank of groups of female mice at 6 weeks of age. Mice were monitored every day until GFP+ tumors were palpable on day 12. Subsequent to this, biweekly bio‐ luminescence imaging was performed on the mice by IVIS following intraperitoneal luciferin injection. Mice were euthanized, and the tumors were resected to dis‐ sociate tumor cells using papain. The cells were then sorted for GFP expression to assess tumorsphere for‐ mation as described above.

Flow cytometry screening The BD Lyoplate Human Cell Surface Marker Screening Panel was purchased from BD Biosciences. The panel contains 242 purified monoclonal antibodies to cell sur‐ face markers and both mouse and rat isotype controls for assessing background signals. For the flow cytome‐ try screening procedure, MDA‐MB‐231 and HCC70 NANOG‐GFP cells were prepared in single‐cell suspen‐ sions in BD Pharmingen Stain Buffer (BD Biosciences) with the addition of 5 mM EDTA. The screening was performed as previously described [30]. A total of 80 million cells of each MDA‐MB‐231 and HCC70 NANOG‐ GFP cell line was stained with DRAQ5 (eBioscience, San Diego, CA) and pacific blue dyes (Life Technologies Grand Island, NY), respectively. The cells were then pooled and plated in 96‐well round‐bottom plates (BD Biosciences). Reconstituted antibodies were added to the wells as per the human lyoplate screening panel. The cells were washed with stain buffer and stained with APC‐labeled goat anti‐mouse IgG secondary anti‐ body (BD Biosciences). The cells were then stained with a live/dead fixable blue dead cell stain kit (Life Technol‐ ogies, Grand Island, NY). Cells were washed and ana‐ lyzed on an LSRII HTS system (BD Biosciences). Data were analyzed with FlowJo software. Positive immuno‐ reactivity was based on isotype controls. ©AlphaMed Press 2014


4 JAM‐A lentiviral short hairpin RNA (shRNA) and JAM‐A transducing lentiviruses were prepared as we previously reported [30, 34]. In short, using Lipofectamine 2000 (Invitrogen), 293FT cells were co‐transfected with the packaging vectors psPAX2 and pCI‐VSVG (Addgene) and lentiviral vectors directing expression of shRNA (Sigma) specific to JAM‐A (TRCN0000061649 (KD1), TRCN0000061650 (KD2), a non‐targeting control (NT) shRNA (SHC002)) and overexpression vector (Applied Biological Materials) for JAM‐A or a control vector. Me‐ dia of the 293FT cell cultures were changed 18 hours after transfection, and viral containing supernatants were collected 24 and 48 hours following the media change. Collected media were filtered for immediate use or concentrated with polyethylene glycol precipita‐ tion and stored at −80°C for future use.

Statistical analysis Values reported in the results are mean values +/‐ standard deviation. One‐way ANOVA was used to calcu‐ late statistical significance, and p‐values are detailed in the text and figure legends.

RESULTS CSC reporter system in TNBC A barrier to comprehensive CSCs studies in TNBC cell lines is the lack of the ability to monitor the stem cell state in real time and investigate cellular heterogeneity in vitro. To overcome this barrier, we developed report‐ er cell lines to track CSCs by transducing TNBC cells with a GFP reporter driven by the NANOG promoter (Fig. 1A). Cells expressing GFP represented cells with high NANOG promoter activity. GFP+ cells enriched by flow cytometry sorting gave rise to both GFP+ and GFP‐ cells as detected by flow cytometry analysis (Fig. 1B) and by fluorescent microscopy (Fig. 1C), demonstrating the development of cellular heterogeneity over time in vitro. The difference in GFP expression was validated by immunoblotting of GFP+ and GFP‐ cell lysates. The data indicated higher expression of GFP in the GFP+ cells compared with the GFP‐ cells (Fig. 1D). To validate that GFP expression identified NANOG‐expressing cells, NANOG mRNA and protein expression were assessed in the GFP+ and GFP‐ cells (Fig. 1E, F). A 16‐fold (MDA‐MB‐ 231) and a 2.3‐fold (HCC70) increase in NANOG mRNA expression were observed in the GFP+ population com‐ pared with the GFP‐ population as quantified by qPCR. In accordance with mRNA data, western blot analysis detected higher levels of NANOG protein expression in GFP+ cells than in GFP‐ cells. These observations demonstrated that our system can be used to detect cellular heterogeneity with respect to NANOG promoter activity.

www.StemCells.com

NANOG promoter reporter enriches for can‐ cer stem cells The prospective identification and isolation of TNBC CSCs are based on the expression of cell surface mark‐ ers including CD24‐/CD44+ [20]. CD24 is a cell surface glycoprotein, and CD44 is a cell surface receptor for the extracellular matrix protein hyaluronan [12, 13]. GFP+ cells of both TNBC lines were enriched for CD24‐CD44+ cells and compared with the GFP‐ cells (Fig. 2A). To ex‐ amine whether the NANOG promoter reporter could enrich for other CSC markers, cells were also stained for the expression of CD49f/Integrin 6. CD49f plays a cru‐ cial role in cell adhesion and has also been widely shown to enrich for TNBC CSCs [35]. Compared with GFP‐ cells, GFP+ cells demonstrated higher expression of CD49f (Fig. 2A). The percentage of GFP+ cells ex‐ pressing CD24‐/CD44+ was 2.1‐fold higher than the per‐ centage of GFP‐ cells in the top 20% of all cells express‐ ing CD24‐/CD44+ in MDA‐MB‐231 cells, whereas in HCC70 cells, the percentage of GFP+ cells expressing CD24‐/CD44+ was 3.5‐fold higher than the percentage of GFP‐ cells (Fig. 2A). In both the MDA‐MB‐231 and HCC70 TNBC cell lines, the protein levels of the three embryonic stem cell transcription factors OCT4, NANOG and SOX2 were greatly increased in GFP+ cells com‐ pared with GFP‐ cells (Fig. 2B). These findings validate the hypothesis that GFP+ cells are enriched for CSC markers.

GFP+ cells exhibit a mesenchymal phenotype Vimentin and N‐cadherin are markers associated with mesenchymal and invasive cellular behaviors [36]. We observed increased expression of these two markers in GFP+ cells compared with GFP‐ cells (Fig. 3A). To de‐ termine whether the GFP+ cells possessed increased intrinsic invasiveness, we performed a collagen‐based invasion assay to measure the distance GFP+ or GFP‐ cells migrated into the collagen matrix (schematized in Fig. 3B). GFP+ cells displayed higher invasive and migra‐ tory potential compared with the GFP‐ cells at the sin‐ gle‐cell level (Fig. 3C). The quantified average relative invasion results also showed a significant increase in the invasion of GFP+ cells compared with the GFP‐ cells (Fig. 3D). These results provide evidence that the GFP+ cells displayed an increased mesenchymal phenotype and invasive capacity compared with GFP‐ cells, which is consistent with studies suggesting increased mesen‐ chymal and metastatic potential of CSCs [36].

NANOG‐GFP+ cells exhibit increased self‐ renewal, a hallmark of CSCs To determine whether GFP+ cells demonstrated CSC characteristics as assessed by an enhanced capacity for self‐renewal, limiting dilution analyses for tumorsphere formation were performed with GFP+ and GFP‐ cells. The sphere‐forming cell frequencies in GFP+ MDA‐MB‐ 231 and HCC70 cells were calculated to be 1 in 5.46 and 1 in 13.3 cells, respectively, and 1 in 29.31 and 1 in 49.8 ©AlphaMed Press 2014

5 cells in the GFP‐ cells, respectively (Fig. 4A, B). Spheres formed from GFP+ and GFP‐ cells plated as single cells also showed the development of heterogeneity in tu‐ morspheres (Supplemental Fig. 1). We next compared our reporter enrichment paradigm with established enrichment protocols. MDA‐MB‐231 and HCC70 paren‐ tal cells were sorted for CD24‐/CD44+ and CD49f ex‐ pression, and limiting dilution analyses were performed. As previously reported, CD24‐/CD44+ and CD49fhi ex‐ pression enriched for cells with tumorsphere formation capacity [20, 35]. The sphere‐forming cell frequencies in CD24‐/CD44+ MDA‐MB‐231 and HCC70 cells were 1 in 12.4 and 1 in 15.8 cells, respectively, and 1 in 25.1 and 1 in 32.4 cells, respectively, in the CD24‐/CD44‐ cells (Fig. 4C, D). In CD49fhi cells, the sphere‐forming cell frequen‐ cies of MDA‐MB‐231 and HCC70 cells were 1 in 12.6 and 1 in 16.5 cells, respectively, whereas those of the CD49flo cells were 1 in 24.4 and 1 in 35.7 cells, respec‐ tively (Fig. 4E, F). ALDH+ cells also showed increased self‐renewal compared with the ALDH‐ cells, as reported previously [18, 19]. In ALDH+ cells, the stem cell fre‐ quency was 1 in 7.38 cells, whereas the stem cell fre‐ quency was 1 in 17.1 for ALDH‐ cells (Fig. 4G, H). Alt‐ hough these established protocols enriched for self‐ renewing cells, the NANOG‐GFP reporter system better enriched for self‐renewing cells.

NANOG‐GFP+ cells initiate tumor formation in vivo The gold standard assay to functionally validate CSCs is tumor initiation. We performed in vivo limiting dilution analysis of GFP+ and GFP‐ cells across a range of cell numbers for transplantation (1,000 – 100,000 cells). Both cell lines were transduced with a luciferase re‐ porter before subcutaneous injection. A significant dif‐ ference was detected between GFP+ and GFP‐ cells with respect to tumor initiation frequency (MDA‐MB‐231 GFP+: 1 in 10,858; MDA‐MB‐231 GFP‐: 1 in 225,232; p=1.5 x 10‐4 ; HCC70 GFP+: 1 in 1559; HCC70 GFP‐: 1 in 59747; p=1.35 x 10‐6) and tumor formation latency. Tu‐ mors were visible and palpable from day 12 post‐ subcutaneous injection in the group of mice injected with 100,000 MDA‐MB‐231 GFP+ cells. Bioluminescence imaging was performed on both groups of mice (Fig. 5A) until mice reached the end point of pre‐determined size (which was not achieved in the GFP‐ tumors even by day 40). The images were quantified, and the results were plotted to compare the group of mice injected with 100,000 GFP+ cells and those injected with 100,000 GFP‐ cells. A significant increase in tumor growth was observed in the group injected with GFP+ cells from day 12 until day 17 (Fig. 5B). To compare the molecular characteristics of pre‐ and post‐ transplantation xenografted NANOG‐GFP cells, limiting dilution tumorsphere formation analyses were per‐ formed on cells derived from the tumors. Increased sphere‐forming cell frequencies and self‐renewal were observed in GFP+ cells compared with the GFP‐ cells isolated from tumors that developed from mice injected www.StemCells.com

CSC reporter system in triple-negative breast cancer with either GFP+ or GFP‐ cells (Supplemental Fig. 2). Interestingly, the sphere‐forming cell frequencies of the pre‐ and post‐transplantation cells were similar to those determined in vitro prior to transplantation (Fig. 4A, Supplemental Fig. 2). Tumors formed from the injection of GFP+ cells showed a high percentage of GFP+ cells that ranged from 83% ‐ 99%. Of note, tumors initiated from GFP‐ cells contained GFP+ cells, which may either be due to a low percentage of GFP+ cells present in the post‐sorting GFP‐ population or the transition of GFP‐ to GFP+ cells in vivo. These findings validate that our sys‐ tem can reliably separate populations of cells with dif‐ ferences in tumor initiation capacity and confirm that GFP+ cells are functional CSCs.

High‐throughput flow cytometry screen iden‐ tified elevated junctional adhesion molecule‐ A (JAM‐A) in GFP+ cells To validate the utility of our reported system to identify CSC‐specific molecular pathways, we performed a high‐ throughput flow cytometry screen. Previous screening methods for CSCs in TNBC have proven challenging due to the inability to interrogate a pure CSC population. We previously used a flow cytometry‐based approach that enabled us to identify cell surface receptors in glio‐ blastoma CSCs [30]. This screening procedure also ena‐ bled us to study intact cells and identify differentially expressed cell surface receptors in MDA‐MB‐231 and HCC70 GFP‐ and GFP+ cells (Fig. 6A). Using a commer‐ cially available panel of cell surface antibodies, we ob‐ served an increase in the expression of well‐established CSC cell‐surface receptors including CD29 (integrin β1), CD44, and CD49f (data not shown) in GFP+ cells in both cell lines. GFP+ cells showed increased expression of JAM‐A compared with the GFP‐ cells in both MDA‐MB‐ 231 and HCC70 cells (Fig. 6B). Expression of JAM‐A has been shown to positively correlate with poor prognosis in patients with invasive breast cancer [37‐39], and we previously reported elevated JAM‐A in glioblastoma CSCs [30]. JAM‐A expression in PDX‐TN1 ALDH+ cells was observed to be 3‐fold higher compared with the PDX‐TN1 ALDH‐ cells by flow cytometry analysis (Fig. 6C) and by immunoblotting (Fig. 6D).To determine whether JAM‐A is involved in CSC maintenance, we in‐ hibited JAM‐A expression via shRNA (Fig. 6E) and ob‐ served a significant decrease in self‐renewal (Fig. 6G). JAM‐A overexpression in GFP‐ cells (Fig. 6F) significantly increased the frequency of self‐renewing cells com‐ pared with the control vector (Fig. 6H). Taken together, these data demonstrate that our NANOG promoter re‐ porter system can be used for discovery approaches and identifies JAM‐A as critical for self‐renewal in TNBC CSCs. ©AlphaMed Press 2014


6

DISCUSSION We have developed a novel TNBC CSC reporter system using a GFP reporter driven by the NANOG promoter. Although CSCs have been postulated to underlie tumor initiation, progression, invasion and recurrence, the impediment to studying CSCs has been the need for an improved definition and functional characterization [40, 41]. To achieve these goals, we transduced the NANOG‐ GFP reporter into two established TNBC cell lines and detected CSCs in TNBC cells in real time. Breast CSCs have been shown to express the cell surface markers CD24‐/CD44+ and possess high ALDH activity in breast cancer tissue, but specific TNBC CSC markers have not been identified [18‐22]. In our model, CSC phenotypes were enriched in sorted GFP+ cells. GFP+ CSCs demon‐ strated increased expression of the embryonic stem cell transcription factors NANOG, SOX2, and OCT4, provid‐ ing evidence that the GFP+ cells are stem cells. Fur‐ thermore, invasion assays demonstrated that GFP+ CSCs displayed a mesenchymal phenotype coupled with increased invasive ability. In vitro and in vivo limiting dilution analyses demonstrated that GFP+ cells possess increased self‐renewal and tumor initiation capacity. The ability of GFP+ cells to form tumorspheres demon‐ strated that enriching for GFP+ cells more specifically isolated self‐renewing TNBC CSCs than the use of other paradigms, including enrichment by CD24‐/CD44+, CD49fhi, and ALDH+. We also show that our model based on the promoter activity of the embryonic stem cell transcription factor NANOG has the conceptual ad‐ vantage of being able to define and functionally charac‐ terize CSCs in a more rigorous manner compared with the other established paradigms [42‐44]. The reporter system that we have developed tracks NANOG promot‐ er activity. Other reporter systems are based on tandem repeats of a composite response element or track a pseudogene, the expression pattern and functions of which are yet to be fully recognized [42, 43, 45]. While the tracking technique is similar among the reporter systems, our system is unique due to the nov‐ elty of a robust validation and characterization of CSCs in TNBC. Other promoter‐reporter construct‐based sys‐ tems that have been used to study CSCs lack such ex‐ tensive validation and application, further adding im‐ pact to our reporter system. We demonstrate that our reporter system in TNBC delineates pluripotency, self‐ renewal, CSC marker expression, invasiveness and in vivo tumor initiation by endogenous NANOG in two well‐established TNBC cell lines. Importantly, our re‐ porter system is more effective at enriching for self‐ renewing cells than conventional marker‐based ap‐ proaches and is amenable to screening in order to iden‐ tify additional pathways important for CSC maintenance [42, 43, 45]. Additionally, our approach has identified junctional adhesion molecule‐A (JAM‐A) as a novel CSC regulator in TNBC which has also been validated in a triple‐negative breast cancer patient‐derived xenograft model. The CSC reporter model system that we devel‐ www.StemCells.com

oped is able to detect whether cancer cells maintain cellular heterogeneity, which remains a substantial chal‐ lenge in the treatment of many advanced cancers in‐ cluding breast cancer. From a functional perspective, transplantation of GFP+ cells into immunodeficient mice recapitulated tumor heterogeneity. Dissociated tumors contained a heterogeneous population of GFP+ and GFP‐ cells that retained self‐renewal abilities similar to those of the populations prior to transplantation. Identification of novel cell surface markers enables pre‐ cise detection and characterization of TNBC CSCs in primary and metastatic breast cancer tissue samples. To identify novel cell surface markers of TNBC CSCs, we utilized our NANOG promoter reporter system to per‐ form a high‐throughput flow cytometry screen that identified a novel CSC marker, JAM‐A, for TNBC. JAM‐A is a cell‐cell adhesion protein that has been shown to influence the migration and morphology of epithelial cells [46‐48]. Increased JAM‐A expression in GFP+ and PDX‐TN1 ALDH+ cells indicates that this surface mole‐ cule is enriched in TNBC CSC populations. Furthermore, JAM‐A silencing and overexpression studies in TNBC cells demonstrated that JAM‐A is necessary and suffi‐ cient for CSC self‐renewal. A strong correlation has been observed between high JAM‐A protein expression and poor clinical outcome with reduced patient survival in invasive breast cancer [27, 37, 39, 49]. Furthermore, the existing literature provides evidence supporting the role of JAM‐A in invasive breast cancer [37, 39, 48]. Our study establishes that JAM‐A expression can be used to define and functionally characterize TNBC CSCs. JAM‐A may provide clinical utility as an independent prognos‐ tic marker predicting the outcome of TNBC patients. Our study demonstrates that the NANOG promoter reporter system can be used to identify CSC biomarkers and a TNBC gene signature for prognostic outcomes. Our reporter system may prove useful for the design of new screening strategies to identify and develop CSC‐ specific therapeutics for therapy‐refractory TNBC and other aggressive cancers. The targeting of CSCs will thereby improve patient survival outcome, especially in aggressive malignancies such as TNBC that lack effective therapies. CONCLUSIONS We have developed a reporter system based on NANOG promoter activity that enriches for functionally compe‐ tent CSCs. The reporter system can segregate CSCs with higher fidelity compared with conventional methods and can be adapted for screening approach‐ es to identify CSC‐specific therapeutic targets and prog‐ nostic gene signatures. These studies highlight the het‐ erogeneity present within TNBC lines and provide a sys‐ tem for subsequent CSC studies. ©AlphaMed Press 2014


7

ACKNOWLEDGMENTS We thank the members of the Lathia and Reizes labora‐ tories for constructive comments on the manuscript. We thank B. Cotleur, C. Shemo, P. Barrett and S. O’Bryant for flow cytometry assistance. This publication was made possible by the Clinical and Translational Sci‐ ence Collaborative of Cleveland, UL1TR000439, from the National Center for Advancing Translational Scienc‐ es (NCATS) component of the National Institutes of Health and NIH roadmap for Medical Research. Its con‐ tents are solely the responsibility of the authors and do not necessarily represent the official views of the NIH. This work was also supported by a National Institutes of Health grant (R21 CA191263) and a Cleveland Clinic Research Program Committee grant to JDL and OR. Work in the Reizes lab is also supported by Cleveland Clinic Foundation, Case Comprehensive Cancer Center Pilot grant and Special Funds in Aging Cancer Energy Balance Research (P30 CA043703), the American Cancer Society (grant number IRG‐91‐022‐15), and the Sam and Salma Gibara Fund. Work in the Lathia lab is also sup‐ ported by the Lerner Research Institute, Case Compre‐ hensive Cancer Center, Sontag Foundation, Voices

REFERENCES 1 AmericanCancerSociety. Breast Cancer Facts & Figures. American Cancer Society. 2011‐2012. 2 Gonzalez‐Angulo AM, Morales‐Vasquez F, Hortobagyi GN. Overview of resistance to systemic therapy in patients with breast cancer. Adv Exp Med Biol. 2007;608:1‐ 22. 3 Gluck S, Arteaga CL, Osborne CK. Optimizing chemotherapy‐free survival for the ER/HER2‐positive metastatic breast cancer patient. Clin Cancer Res. 2011;17:5559‐5561. 4 Dent R, Trudeau M, Pritchard KI et al. Triple‐ negative breast cancer: clinical features and patterns of recurrence. Clin Cancer Res. 2007;13:4429‐4434. 5 Rakha EA, El‐Sayed ME, Green AR et al. Prognostic markers in triple‐negative breast cancer. Cancer. 2007;109:25‐32. 6 Foulkes WD, Smith IE, Reis‐Filho JS. Triple‐ negative breast cancer. N Engl J Med. 2010;363:1938‐1948. 7 Metzger‐Filho O, Tutt A, de Azambuja E et al. Dissecting the heterogeneity of triple‐ negative breast cancer. J Clin Oncol. 2012;30:1879‐1887. 8 Andre F, Zielinski CC. Optimal strategies for the treatment of metastatic triple‐ negative breast cancer with currently approved agents. Ann Oncol. 2012;23 Suppl 6:vi46‐51. 9 de Beca FF, Caetano P, Gerhard R et al. Cancer stem cells markers CD44, CD24 and ALDH1 in breast cancer special histological types. J Clin Pathol. 2013;66:187‐191.

www.StemCells.com

Against Brain Cancer, Blast GBM, the Ohio Cancer Re‐ search Associates, NIH K99/R00 Pathway to Independ‐ ence Award (CA157948) and R01 (NS083629), V Scholar Award from the V Foundation for Cancer Research, and Grant IRG‐91‐022‐18 to the Case Comprehensive Cancer Center from the American Cancer Society. Work in the Egelhoff lab was supported by NIH grant GM50009. DGT was supported by NIH training grant R25CA148052. CONFLICT OF INTEREST None to declare

AUTHOR CONTRIBUTIONS Conception and design (P.S.T., M.H., J.D.L., O.R.); Finan‐ cial support (JDL, OR), Administrative support (J.D.L, O.R.); Provision of study material (HL), Collection and/or assembly of data (P.S.T., M.H., J.S.H., A.G.A., B.O., K.S., M.S., A.W., E.M.H., A.J., Q.Z., D.T.); Data analysis and interpretation (P.S.T., M.H., T.E., J.N.R., J.D.L., O.R.); Manuscript writing (P.S.T., J.D.L., O.R.) Final approval of manuscript (all authors)

10 Idowu MO, Kmieciak M, Dumur C et al. CD44(+)/CD24(‐/low) cancer stem/progenitor cells are more abundant in triple‐negative invasive breast carcinoma phenotype and are associated with poor outcome. Hum Pathol. 2012;43:364‐373. 11 Uchoa Dde M, Graudenz MS, Callegari‐ Jacques SM et al. Expression of cancer stem cell markers in basal and penta‐ negative breast carcinomas‐‐a study of a series of triple‐negative tumors. Pathol Res Pract. 2014;210:432‐439. 12 Meacham CE, Morrison SJ. Tumour heterogeneity and cancer cell plasticity. Nature. 2013;501:328‐337. 13 Shackleton M, Quintana E, Fearon ER et al. Heterogeneity in cancer: cancer stem cells versus clonal evolution. Cell. 2009;138:822‐829. 14 Chuthapisith S, Eremin J, El‐Sheemey M et al. Breast cancer chemoresistance: emerging importance of cancer stem cells. Surg Oncol. 2010;19:27‐32. 15 Phillips TM, McBride WH, Pajonk F. The response of CD24(‐/low)/CD44+ breast cancer‐initiating cells to radiation. J Natl Cancer Inst. 2006;98:1777‐1785. 16 Easwaran H, Tsai HC, Baylin SB. Cancer epigenetics: tumor heterogeneity, plasticity of stem‐like states, and drug resistance. Mol Cell. 2014;54:716‐727. 17 Schmitt F, Ricardo S, Vieira AF et al. Cancer stem cell markers in breast neoplasias: their relevance and distribution in distinct molecular subtypes. Virchows Arch. 2012;460:545‐553. 18 Charafe‐Jauffret E, Ginestier C, Iovino F et al. Breast cancer cell lines contain functional cancer stem cells with metastatic capacity and a distinct

molecular signature. Cancer Res. 2009;69:1302‐1313. 19 Charafe‐Jauffret E, Ginestier C, Iovino F et al. Aldehyde dehydrogenase 1‐positive cancer stem cells mediate metastasis and poor clinical outcome in inflammatory breast cancer. Clin Cancer Res. 2010;16:45‐55. 20 Al‐Hajj M, Wicha MS, Benito‐Hernandez A et al. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 2003;100:3983‐3988. 21 Ohi Y, Umekita Y, Yoshioka T et al. Aldehyde dehydrogenase 1 expression predicts poor prognosis in triple‐negative breast cancer. Histopathology. 2011;59:776‐780. 22 Tirino V, Desiderio V, Paino F et al. Cancer stem cells in solid tumors: an overview and new approaches for their isolation and characterization. FASEB J. 2013;27:13‐24. 23 Jeter CR, Badeaux M, Choy G et al. Functional evidence that the self‐renewal gene NANOG regulates human tumor development. Stem Cells. 2009;27:993‐ 1005. 24 Kashyap V, Rezende NC, Scotland KB et al. Regulation of stem cell pluripotency and differentiation involves a mutual regulatory circuit of the NANOG, OCT4, and SOX2 pluripotency transcription factors with polycomb repressive complexes and stem cell microRNAs. Stem Cells Dev. 2009;18:1093‐1108. 25 Nagata T, Shimada Y, Sekine S et al. Prognostic significance of NANOG and KLF4 for breast cancer. Breast Cancer. 2014;21:96‐101. 26 Ali HR, Dawson SJ, Blows FM et al. Cancer stem cell markers in breast cancer:



8 pathological, clinical and prognostic significance. Breast Cancer Res. 2011;13:R118. 27 Cariati M, Naderi A, Brown JP et al. Alpha‐ 6 integrin is necessary for the tumourigenicity of a stem cell‐like subpopulation within the MCF7 breast cancer cell line. Int J Cancer. 2008;122:298‐304. 28 Zhou L, Jiang Y, Yan T et al. The prognostic role of cancer stem cells in breast cancer: a meta‐analysis of published literatures. Breast Cancer Res Treat. 2010;122:795‐ 801. 29 Zheng Q, Banaszak L, Fracci S et al. Leptin receptor maintains cancer stem‐like properties in triple negative breast cancer cells. Endocr Relat Cancer. 2013;20:797‐808. 30 Lathia JD, Li M, Sinyuk M et al. High‐ throughput flow cytometry screening reveals a role for junctional adhesion molecule a as a cancer stem cell maintenance factor. Cell Rep. 2014;6:117‐129. 31 Sukhdeo K, Paramban RI, Vidal JG et al. Multiplex flow cytometry barcoding and antibody arrays identify surface antigen profiles of primary and metastatic colon cancer cell lines. PLoS One. 2013;8:e53015. 32 Liu H, Patel MR, Prescher JA et al. Cancer stem cells from human breast tumors are involved in spontaneous metastases in orthotopic mouse models. Proc Natl Acad Sci U S A. 2010;107:18115‐18120. 33 Goswami S, Sahai E, Wyckoff JB et al. Macrophages promote the invasion of breast carcinoma cells via a colony‐

stimulating factor‐1/epidermal growth factor paracrine loop. Cancer Res. 2005;65:5278‐5283. 34 Lathia JD, Gallagher J, Heddleston JM et al. Integrin alpha 6 regulates glioblastoma stem cells. Cell Stem Cell. 2010;6:421‐ 432. 35 Meyer MJ, Fleming JM, Lin AF et al. CD44posCD49fhiCD133/2hi defines xenograft‐initiating cells in estrogen receptor‐negative breast cancer. Cancer Res. 2010;70:4624‐4633. 36 Mani SA, Guo W, Liao MJ et al. The epithelial‐mesenchymal transition generates cells with properties of stem cells. Cell. 2008;133:704‐715. 37 Gotte M, Mohr C, Koo CY et al. miR‐145‐ dependent targeting of junctional adhesion molecule A and modulation of fascin expression are associated with reduced breast cancer cell motility and invasiveness. Oncogene. 2010;29:6569‐ 6580. 38 McSherry EA, McGee SF, Jirstrom K et al. JAM‐A expression positively correlates with poor prognosis in breast cancer patients. Int J Cancer. 2009;125:1343‐ 1351. 39 Murakami M, Giampietro C, Giannotta M et al. Abrogation of junctional adhesion molecule‐A expression induces cell apoptosis and reduces breast cancer progression. PLoS One. 2011;6:e21242. 40 Li X, Lewis MT, Huang J et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 2008;100:672‐679. 41 Stewart JM, Shaw PA, Gedye C et al. Phenotypic heterogeneity and instability

of human ovarian tumor‐initiating cells. Proc Natl Acad Sci U S A. 2011;108:6468‐ 6473. 42 Yu L, Liu S, Zhang C et al. Enrichment of human osteosarcoma stem cells based on hTERT transcriptional activity. Oncotarget. 2013;4:2326‐2338. 43 Tang B, Raviv A, Esposito D et al. A flexible reporter system for direct observation and isolation of cancer stem cells. Stem Cell Reports. 2015;4:155‐169. 44 Badeaux MA, Jeter CR, Gong S et al. In vivo functional studies of tumor‐specific retrogene NanogP8 in transgenic animals. Cell Cycle. 2013;12:2395‐2408. 45 Jeter CR, Liu B, Liu X et al. NANOG promotes cancer stem cell characteristics and prostate cancer resistance to androgen deprivation. Oncogene. 2011;30:3833‐3845. 46 Naik TU, Naik MU, Naik UP. Junctional adhesion molecules in angiogenesis. Front Biosci. 2008;13:258‐262. 47 Naik UP, Naik MU. Putting the brakes on cancer cell migration: JAM‐A restrains integrin activation. Cell Adh Migr. 2008;2:249‐251. 48 McSherry EA, Brennan K, Hudson L et al. Breast cancer cell migration is regulated through junctional adhesion molecule‐A‐ mediated activation of Rap1 GTPase. Breast Cancer Res. 2011;13:R31. 49 Goetsch L, Haeuw JF, Beau‐Larvor C et al. A novel role for junctional adhesion molecule‐A in tumor proliferation: modulation by an anti‐JAM‐A monoclonal antibody. Int J Cancer. 2013;132:1463‐ 1474.

See www.StemCells.com for supporting information available online. STEM CELLS ; 00:000–000

www.StemCells.com


9


Figure 1. Development and validation of a CSC TNBC reporter system. (A) Schematic demonstrates workflow of TNBC transduction with the NANOG‐GFP reporter. (B) Histograms of MDA‐MB‐231 GFP cells post transduction. Cells were sorted, and GFP+ cells were cultured for 7 days, after which flow cytometry analysis was repeated. (C) Photomicro‐ graphs of NANOG‐GFP reporter‐transduced TNBC cell lines MDA‐MB‐231 and HCC70 cultured for 7 days after sorting for GFP expression. Scale bar – 100 µM. (D) Immunoblots of MDA‐MB‐231 and HCC70 cells sorted for GFP and probed with anti‐GFP antibody. Actin was used as a loading control. (E) Quantification of NANOG mRNA expression in GFP‐ sorted MDA‐MB‐231 cells by qPCR. Actin was used as a control. (*** p

A flexible reporter system for direct observation and isolation of cancer stem cells.

Cancer stem cells in breast cancer.

Differentiation of Induced Pluripotent Stem Cells to Lentoid Bodies Expressing a Lens Cell-Specific Fluorescent Reporter.

Are breast cancer stem cells the key to resolving clinical issues in breast cancer therapy?

Rad51 inhibition sensitizes breast cancer stem cells to PARP inhibitor in triple-negative breast cancer.

Cancer stem cells and their implication in breast cancer.

Future Prospects in Breast Cancer Research - Cancer Stem Cells.

EpCAM Aptamer-mediated Survivin Silencing Sensitized Cancer Stem Cells to Doxorubicin in a Breast Cancer Model.

Cancer stem cells of the digestive system.

Response of breast cancer cells and cancer stem cells to metformin and hyperthermia alone or combined.

MicroRNA100 inhibits self-renewal of breast cancer stem-like cells and breast tumor development.

Silencing NOTCH signaling causes growth arrest in both breast cancer stem cells and breast cancer cells.

Biomarkers to Target Heterogeneous Breast Cancer Stem Cells.

Nanomedicine-Mediated Therapies to Target Breast Cancer Stem Cells.

Cancer stem cells and early stage basal-like breast cancer.

Identification of genes involved in breast cancer and breast cancer stem cells.

Challenges in the development of future treatments for breast cancer stem cells.

Detection of Pancreatic Cancer-Induced Cachexia Using a Fluorescent Myoblast Reporter System and Analysis of Metabolite Abundance.

Non-migratory tumorigenic intrinsic cancer stem cells ensure breast cancer metastasis by generation of CXCR4(+) migrating cancer stem cells.

New Findings on Breast Cancer Stem Cells: A Review.

Ubiquitin ligase CHIP suppresses cancer stem cell properties in a population of breast cancer cells.

Wound healing and cancer stem cells: inflammation as a driver of treatment resistance in breast cancer.

Role of nuclear receptors in breast cancer stem cells.

FASNating targets of metformin in breast cancer stem-like cells.