Journal of Virological Methods 197 (2014) 14–18
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Development of a loop-mediated isothermal amplification assay combined with a lateral flow dipstick for rapid and simple detection of classical swine fever virus in the field Vinay Kumar Chowdry a , Yuzi Luo b , Frederik Widén a , Hua-Ji Qiu b , Hu Shan c , Sándor Belák a , Lihong Liu a,∗ a
Department of Virology, Immunobiology and Parasitology, National Veterinary Institute, Uppsala, Sweden State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin, China c Key Laboratory of Preventive Veterinary Medicine of Shandong Province, Qingdao Agricultural University, Qingdao, China b
a b s t r a c t Article history: Received 26 August 2013 Received in revised form 20 November 2013 Accepted 22 November 2013 Available online 1 December 2013 Keywords: Classical swine fever virus RT-LAMP Lateral flow dipstick Field diagnosis Molecular detection
Classical swine fever (CSF) is a highly contagious viral disease and may cause heavy economic loss to farmers. The rapid, simple and accurate diagnosis of the disease at the frontline, for example on the farms of concern is crucial for disease control. This study describes the development and evaluation of a new loop-mediated isothermal amplification (LAMP) assay coupled with lateral flow dipstick (LFD) for the detection of classical swine fever virus (CSFV). This RT-LAMP-LFD assay combines the efficient one-step isothermal amplification of CSF viral RNA and the simplicity of the LFD to read the results within two to five minutes. Seven genotypes (1.1, 1.2, 1.3, 2.1, 2.2, 2.3 and 3.1), but not genotype 3.4, were successfully detected by the RT-LAMP-LFD assay, indicating that the method has a broad range of detection and can be applied in different geographical areas where CSFV strains belonging to these genotypes are present. The performance of this RT-LAMP-LFD assay was similar to that of the real-time RT-PCR. The analytical sensitivity was about 100 copies per reaction when testing two genotypes (1.1 and 2.3). No cross-reactivity to non-CSFV pestiviruses was observed. This RT-LAMP-LFD assay can be a useful novel tool for the rapid, simple and economic diagnosis of classical swine fever in the field. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Classical swine fever virus (CSFV) is the causative agent of classical swine fever (CSF), a highly contagious viral disease. It is a small, enveloped, positive-sense, single-stranded RNA virus belonging to the genus Pestivirus of the family Flaviviridae (Pletnev et al., 2011). The other member of the genus include bovine viral diarrhea virus 1 (BVDV-1), bovine viral diarrhea virus 2 (BVDV-2) and border disease virus (BDV). The virus is categorized into three major genetic groups (Lowings et al., 1996), which are further divided into 10 sub-groups: 1.1, 1.2, 1.3, 2.1, 2.2, 2.3, 3.1, 3.2, 3.3, and 3.4 (Paton et al., 2000). Both domestic pigs and wild boars are natural host of CSFV and the disease can be mild, moderate or severe. CSF may cause heavy economic losses to farms. For example, outbreaks in The Netherlands during 1997/98 resulted in the slaughter of over
∗ Corresponding author at: Department of Virology, Immunobiology and Parasitology, National Veterinary Institute, SE-751 89 Uppsala, Sweden. Tel.: +46 18 674689; fax: +46 18 674669. E-mail address: [email protected] (L. Liu). 0166-0934/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2013.11.013
10 million pigs at a cost of over 2 billion US dollars (Pluimers et al., 1999). As the clinical signs vary from case to case, laboratory diagnosis utilizing different techniques is needed in order to either confirm or exclude the infection. While conventional virus isolation remains the “gold standard” method, novel molecular approaches, such as real-time RT-PCR are widely used in national and reference laboratories. A ring trial among 10 European laboratories has demonstrated reliability of the CSF diagnosis using real-time RT-PCR on an international level (Hoffmann et al., 2011). In the meantime, simple and rapid methods such as loop-mediated isothermal amplification (LAMP), published originally by Notomi et al. (2000), have been developed and evaluated for the detection of CSF viral nucleic acids (Chen et al., 2009; Yin et al., 2010; Zhang et al., 2010). Compared to virus isolation and real-time RT-PCR, the LAMP method is more suitable for field applications, since it does not require specialized and/or expensive equipment. In addition, LAMP results can be read by the naked eye, based on the change of turbidity. Alternatively, the LAMP products can be labeled with small molecules such as fluorescein isothiocyanate (FITC) and digoxigenin (DIG), and then separated on lateral flow strips by chromatographic force. Upon specific binding between the molecules
V.K. Chowdry et al. / Journal of Virological Methods 197 (2014) 14–18
15
Table 1 Virus isolates and comparison of the RT-LAMP-LFD and real-time RT-PCR assays. The results are the last dilution of the viruses and Ct values from real-time RT-PCR are presented in brackets. Isolates
Genotype
Country
RT-LAMP-LFD
Real-time RT-PCR
31240/96 Romania I 01 Alfort 187 Argentina 742/Ru 7/3 No. 3/brescia JIK/Ru VRI 4167 94-14901 97-7446/#4 907/1 VRI 2277 2000/8 V2/97 4905 I 97/03 V 273/89 P40/07/87 VA 531 2213/97 2699/Osterode Pomi/2004 30853 591/02 M7 19928/60
1.1 1.1 1.1 1.1 1.1 1.2 1.2 1.2 1.3 1.3 1.3 2.1 2.1 2.1 2.1 2.1 2.2 2.2 2.2 2.2 2.3 2.3*Rostock 2.3 2.3*Uelzen 2.3*Slovakia
Slovak Republic Romania France Argentina Russia Poland Romania Russia Malaysia Costa Rica Honduras Germany Malaysia Great Britain Germany Italy Germany Singapore Italy Czech Republic Germany Romania Israel Bulgaria Hungary
10−1 10−2 10−3 10−2 10−2 10−2 10−2 10−1 10−2 Original Negative 10−1 10−2 10−1 10−2 10−3 10−3 10−2 10−3 10−3 10−1 10−2 10−2 10−2 10−2
10−2 10−3 10−3 10−3 10−2 10−4 10−3 10−1 10−2 10−1 10−1 10−2 10−2 10−2 10−3 10−4 10−4 10−3 10−3 10−3 10−3 10−2 10−3 10−2 10−1
and antibodies embedded in the strip, a colored line appears indicating a positive reaction. A combination of LAMP and lateral flow dipstick (LFD) would make rapid diagnosis in the field or close to farms possible. The objective of this study was to develop and evaluate a one-step RT-LAMP assay combined with LFD as readout for the rapid detection of CSFV. The new assay offers a rapid, economic and simple-to-use novel diagnostic tool suitable for field application. 2. Materials and methods 2.1. Samples and RNA preparation A total of 105 samples were used in this study. Those included 25 CSF virus isolates of cell culture passages (Table 1) and 27 reference sera, kindly provided by the OIE and EU reference laboratory for classical swine fever, Hannover, Germany; 47 RNA preparations (Table 2) from a pestivirus ring trial panel (Hoffmann et al., 2011); and 6 pooled wild boar sera, kindly supplied by ANSES, Maisons Alfort, France. The samples covered eight subtypes (1.1, 1.2, 1.3, 2.1, 2.2, 2.3, 3.1, and 3.4). All the sera were positive for CSFV E2 antibody ELISA. RNA extraction from the 25 virus isolates was performed as described previously (Liu et al., 2011). RNeasy mini kit (Qiagen, Hilden, Germany) was used to extract RNA from serum samples, according to the manufacturer’s protocol. Ten-fold serial dilutions of RNA from virus isolates were prepared. Isolate Argentina (genotype 1.1) was used to optimize initially the RT-LAMP assay.
(35.92) (40.08) (42.52) (38.05) (36.54) (41.34) (38.93) (39.43) (37.45) (40.74) (37.59) (40.22) (36.99) (35.89) (39.50) (41.72) (37.89) (38.89) (38.88) (37.47) (36.62) (39.95) (39.73) (37.35) (32.53)
2.3. Optimization of the RT-LAMP-LFD assay Experiments were performed to optimize the RT-LAMP assay by testing different incubation times, Betaine concentrations and amplification temperature. The optimized CSFV RT-LAMP assay in a total reaction volume of 25 l consisted of 1× Thermo buffer, 0.33 mM dNTPs, 0.2 M F3, B3, Floop, and Bloop primers, 2 M FIP and BIP primers, 0.4 M Betaine (Sigma, St. Louis, MO), 16 U of Bst DNA polymerase (New England Biolabs, Herts, UK), 9 U of Cloned AMV-RT (Invitrogen, Carlsberg, CA) and 3 l of viral RNA. The reaction mixture was incubated on a thermocycler at 60 ◦ C for 60 min followed by 80 ◦ C for 2 min. Eight microliters of the RT-LAMP products were run on a 1.5% agarose gel to visualize the results, while 10–12 l were used in the lateral flow dipstick, HybriDetect 2T (Milenia Biotec, Gissen, Germany), for the detection of amplified products according to manufacturer’s instructions. 2.4. Comparison with CSFV real-time RT-PCR The RNA preparations from the serum samples were tested by a published CSFV real-time RT-PCR (Hoffmann et al., 2005) using SuperScript® III One-Step RT-PCR System (Invitrogen, Carlsberg, CA) in a RotorGene3000 instrument. For detection of CSF viral RNA from virus isolates and RNA panel, AgPath-ID One-step master mix (Applied Biosystems, Foster city, CA) was used. The reaction mixture consisted of 12.5 l of 2× RT-PCR buffer, 1 l of 10 M forward primer, 1 l of 10 M reverse primer, 0.5 l of 10 M probe, 1 l of 25× RT-PCR enzyme mix and 3 l of RNA template. Cycling steps were 45 ◦ C for 10 min, 95 ◦ C for 10 min, followed by 45 cycles of 95 ◦ C for 15 s and 60 ◦ C for 45 s.
2.2. Primer design Six specific primers targeting the 5 UTR of viral genome were designed using the online program Primer Explorer version 4 (http://primerexplorer.jp/elamp4.0.0/index.html). The primer set included two outer primers (F3 and B3), two inner primers (FIP and BIP), and two loop primers labeled with DIG and FITC, respectively (Table 3).
3. Results 3.1. Development of an RT-LAMP-LFD assay A simple, one-step RT-LAMP assay was developed in this study to amplify CSF viral RNA under constant temperature, which was followed by detection of the products in a lateral flow dipstick.
16
V.K. Chowdry et al. / Journal of Virological Methods 197 (2014) 14–18
Table 2 Pestiviral RNA ring trial panel. Virus species
Strain name
Genotype
Quantity (copies/l)
RT-LAMP-LFD
CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV BDV BDV BDV BDV BVDV BVDV BVDV BVDV BVDV BVDV Atypical pestivirus Atypical pestivirus CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV RSB50
C-strain Eystrup91 Alfort187 Koslov1128 Brescia Schweiz II Pader Bergen D4886/82/Ro Uelzen Spante Congenital Tremor Kanagawa Gifhom 137/4 Rudolph Isard Cp7 NADL Grub Munchen2 CS8644 Bure Hobi Giraffe H138 Alfort187 Alfort187 Alfort187 Alfort187 Alfort187 Alfort187 Alfort187 Spante Spante Spante Spante Spante Spante Spante Kanagawa Kanagawa Kanagawa Kanagawa Kanagawa Kanagawa Kanagawa –
1.1 1.1 1.1 1.2 1.2 2.1 2.1 2.2 2.2 2.3 2.3 3.1 3.4 3 2 1 4 1 1 1 2 2 2 – – 1.1 1.1 1.1 1.1 1.1 1.1 1.1 2.3 2.3 2.3 2.3 2.3 2.3 2.3 3.4 3.4 3.4 3.4 3.4 3.4 3.4 –
1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 103 4 × 103 8 × 102 1.6 × 102 3.2 × 101 6.4 × 100 1.28 × 100 2.56 × 10−1 4 × 103 8 × 102 1.6 × 102 3.2 × 101 6.4 × 100 1.28 × 100 2.56 × 10−1 4 × 103 8 × 102 1.6 × 102 3.2 × 101 6.4 × 100 1.28 × 100 2.56 × 10−1 –
Positive Positive Positive Positive Positive Positive Positive Positive Positive Positive Positive Positive Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Positive Positive Positive Positive Negative Negative Negative Positive Positive Positive Positive Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative
The optimal condition was incubation at 60 ◦ C with 0.4 M Betaine in the reaction. Compared to gel electrophoresis, the LFD format improved RT-LAMP detection limit in 9 samples (742/Ru, 7/3, No. 3/Brescia, V2/72, 4905 I 97/03, P40/07/87, VA 531, 591/02, and M7 19928/60) while reduced detection in 2 samples (94-14901/02-94 and 907/1). It reduced difficulties in interpreting results when a thick smeared band, instead of a typical ladder-like pattern, was observed after electrophoresis in a 1.5% agarose gel. In such cases, further dilution of the RT-LAMP products was made prior to gel electrophoresis. To evaluate the RT-LAMP-LFD assay, 10-fold serial
dilutions of 25 viral RNA preparations were tested by both the RT-LAMP-LFD and real-time RT-PCR (Hoffmann et al., 2005). The RT-LAMP-LFD assay detected 24 out 25 strains at different dilution levels (Table 1). The RT-LAMP-LFD had the same detection limit as real-time RT-PCR in 9 samples, a 10-fold less in 12 samples or a 100-fold less in 2 samples. The RT-LAMP-LFD performed better than the real-time RT-PCR in testing one sample. The RNA preparation of the isolate 97-7446/#4 was negative by the RT-LAMP-LFD but positive by real-time RT-PCR. The 10-fold dilution gave a Ct value of 37.59, indicating a very low viral load in the original RNA
Table 3 Primers used for CSFV LAMP assay. Primer
Type
Sequence (5 –3 )
FIP F3 BIP B3 Floop Bloop
Forward inner Forward outer Backward inner Backward outer Forward loop Reverse loop
GTCTTGGGCATGCCCTCGTCTTTTCGTCAGTAGTTCGACGTGAG GGGTGGTCTAAGTCCTGAGT ACACCTTAACCCTAGCGGGGGTTTTCAGCACCCTATCAGGTCGTA AGCCTAATAGTGGGCCTCTG [DIG]-GCATATCGAGGTGGGCTTCT [FITC]-CTAGGGTGAAATCACACCACGT
V.K. Chowdry et al. / Journal of Virological Methods 197 (2014) 14–18
Fig. 1. Examples of detection of classical swine fever viral RNA by the RT-LAMP-LFD assay lanes 1–6 are samples with one negative (lane 1) and five positive (lanes 2–6). Lane 7, water RNA extraction control and lane 8, water RT-LAMP-LFD control. Both are regarded as negative.
preparation that was below the detection limit of the RT-LAMPLFD. 3.2. Analytic sensitivity and specificity Analytic sensitivity and specificity of the RT-LAMP-LFD assay were evaluated by testing a well-defined pestiviral RNA panel, which included 13 CSFV strains of 7 genotypes, 4 BDV strains, 6 BVDV strains, 2 atypical pestiviruses, and serial dilutions of 3 strains (Table 2). The RT-LAMP-LFD assay detected 12 CSFV strains of genotypes 1.1, 1.2, 2.1, 2.2, 2.3, and 3.1. All the strains had a concentration of around 1 × 104 copies/l. The most divergent strain Kanagawa of genotype 3.4 was not detected, which might be due to mismatches between the primers and target. The RT-LAMP-LFD had an analytic sensitivity of about 100 copies per reaction in testing both genotypes 1.1 (strain Alfort/187) and 2.3 (strain Spante). As BVDV and BDV can also infect pigs, the non-CSFV pestiviruses included in the RNA panel were tested by the assay and found negative (Table 2). 3.3. Detection of CSFV in domestic swine sera and in French field sera The applicability of the RT-LAMP-LFD for field condition was further evaluated by testing 33 antibody-positive serum samples including 27 reference sera and 6 pooled wild boar sera. Six out of the 27 reference sera were found positive by the RT-LAMP-LFD assay and all six pooled sera were negative. Fig. 1 demonstrates the detection of CSFV in sera. The ability of the assay to detect viral RNA in serum samples suggested that it is applicable for field investigation of CSFV infection. 4. Discussion This report describes the development and evaluation of a new CSFV RT-LAMP-LFD assay, which combines the efficiency of one-step isothermal amplification of CSF viral RNA and the simplicity of the LFD to read the results within a few minutes. In addition, the LFD readout also improved RT-LAMP detection of viral RNA in certain samples. Compared with previous studies
17
(Chen et al., 2009; Yin et al., 2010; Zhang et al., 2010), the new assay was evaluated with a broad range of CSFV genotypes and a well-defined RNA panel of different pestiviruses. Thus, the new RT-LAMP-LFD assay has a great potential to be used in the field for the rapid and sensitive detection of CSFV. In this study, seven genotypes (1.1, 1.2, 1.3, 2.1, 2.2, 2.3 and 3.1) were successfully detected by the RT-LAMP-LFD assay, indicating that the method can be applied broadly in different geographical areas where CSFV strains belonging to these genotypes are present. The only exception is genotype 3.4, which is so divergent that mismatches between primers and viral genome might have occurred and this could be the reason why it was not detected by the assay. As the RT-LAMP has four primers targeting six different genomic regions with an amplicon (F3/B3) size of about 200 bp, accumulation of a couple of mismatches in each primer might decrease amplification efficiency or even lead to complete failure. Further adjustment of primer nucleotide sequences might be able to improve the detection range such that genotype 3.4 strains are efficiently detected. It has been reported that RT-LAMP assay can be as sensitive as real-time RT-PCR (Blomström et al., 2008). The best performance of this RT-LAMP-LFD assay was similar to that of the real-time RT-PCR as both assays were able to detect CSFV RNA to the same dilution levels of the nine samples belonging to six genotypes (1.1, 1.2, 1.3, 2.1, 2.2, 2.3). As determined by real-time RT-PCR, these dilutions had Ct values ranging from 36.54 to 42.52, which are close to cut-off values of a real-time RT-PCR. The analytical sensitivity was about 100 copies per reaction when testing two genotypes (1.1 and 2.3), and no cross-reactivity to non-CSFV pestiviruses was observed, which suggested the assay was specific. For the other 12 samples, the RT-LAMP-LFD detected viral RNA to the dilution levels 10-fold less than that by real-time RT-PCR. It seemed likely that the primer-binding regions of viral genomes differed within and among genotypes. Since the first description of the LAMP method in 2000, many LAMP assays have been developed for detection of pathogenic microorganisms, genetically modified ingredients, tumor detection, and embryo sex identification (Fu et al., 2011). And a new commercial Malaria LAMP kit has been developed and evaluated in a remote Ugandan clinic, with sensitivity similar to single-well nPCR in a UK reference laboratory (Hopkins et al., 2013). Herewith, we report a simple, rapid, sensitive and specific RT-LAMP-LFD assay, which allows a simple, economic and rapid diagnosis of CSF on the field. After a further optimization of the primer sequences, simplifying the sample preparation and streamlining the diagnostic procedure, this RT-LAMP-LFD assay has the capacity to be used by local veterinarians for the diagnosis of CSF in the field. Acknowledgements The authors wish to thank Drs. Katrin Pannhorst and Denise Meyer, EU and OIE Reference Laboratory for CSF, Hannover, Germany; and Prof. Marie-Frédérique Le Potier, ANSES, Ploufragan, France, for providing the serum samples. This study was supported by the European Union FP7 projects “Improve tools and strategies for the prevention and control of classical swine fever” (CSFV goDIVA, no. grant no. 227003) and “Rapid Field Diagnostics and Screening in Veterinary Medicine” (RAPIDIA-Field, no. 289364). HS would like to acknowledge the support by two projects “Important diseases of livestock and poultry epidemiological investigation” and “Pig expert creative team positions – disease control”. References Blomström, A.L., Hakhverdyan, M., Reid, S.M., Dukes, J.P., King, D.P., Belák, S., Berg, M., 2008. A one-step reverse transcriptase loop-mediated isothermal amplification
18
V.K. Chowdry et al. / Journal of Virological Methods 197 (2014) 14–18
assay for simple and rapid detection of swine vesicular disease virus. J. Virol. Methods 147 (1), 188–193. Chen, H.T., Zhang, J., Ma, L.N., Ma, Y.P., Ding, Y.Z., Liu, X.T., Chen, L., Ma, L.Q., Zhang, Y.G., Liu, Y.S., 2009. Rapid pre-clinical detection of classical swine fever by reverse transcription loop-mediated isothermal amplification. Mol. Cell Probes 23 (2), 71–74. Fu, S., Qu, G., Guo, S., Ma, L., Zhang, N., Zhang, S., Gao, S., Shen, Z., 2011. Applications of loop-mediated isothermal DNA amplification. Appl. Biochem. Biotechnol. 163 (7), 845–850. Hoffmann, B., Beer, M., Schelp, C., Schirrmeier, H., Depner, K., 2005. Validation of a real-time RT-PCR assay for sensitive and specific detection of classical swine fever? J. Virol. Methods 130 (1/2), 36–44. ˜ Hoffmann, B., Blome, S., Bonilauri, P., Fernández-Pinero, J., Greiser-Wilke, I., Haegeman, A., Isaksson, M., Koenen, F., LeBlanc, N., Leifer, I., Le Potier, M.F., Loeffen, W., Rasmussen, T.B., Stadejek, T., Ståhl, K., Tignon, M., Uttenthal, A., van der Poel, W., Beer, M., 2011. Classical swine fever virus detection: results of a realtime reverse transcription polymerase chain reaction ring trial conducted in the framework of the European network of excellence for epizootic disease diagnosis and control. J. Vet. Diagn. Invest. 23 (5), 999–1004. Hopkins, H., González, I.J., Polley, S.D., Angutoko, P., Ategeka, J., Asiimwe, C., Agaba, B., Kyabayinze, D.J., Sutherland, C.J., Perkins, M.D., Bell, D., 2013. Highly sensitive detection of malaria parasitemia in a malaria-endemic setting: performance of a new loop-mediated isothermal amplification kit in a remote clinic in Uganda. J. Infect. Dis. (Epub ahead of print). Liu, L., Xia, H., Everett, H., Sosan, O., Crooke, H., Meindl-Böhmer, A., Qiu, H.J., Moennig, V., Belák, S., Widén, F., 2011. A generic real-time TaqMan assay for specific
detection of lapinized Chinese vaccines against classical swine fever. J. Virol. Methods 175 (2), 170–174. Lowings, P., Ibata, G., Needham, J., Paton, D., 1996. Classical swine fever virus diversity and evolution. J. Gen. Virol. 77, 1311–1321. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28 (12), E63. Paton, D.J., McGoldrick, A., Greiser-Wilke, I., Parchariyanon, S., Song, J.Y., Liou, P.P., Stadejek, T., Lowings, J.P., Björklund, H., Belák, S., 2000. Genetic typing of classical swine fever virus. Vet. Microbiol. 73, 137–157. Pletnev, A., Gould, E., Heinz, F.X., Meyers, G., Thiel, H.J., Bukh, J., Stiasny, K., Collett, M.S., Becher, P., Simmonds, P., Rice, C.M., Monath, T.P., 2011. Flaviviridae. In: King, A.M., Adams, M.J., Carstens, E.B., Lefkowitz, E.J. (Eds.), Virus Taxonomy. Oxford, Elsevier, pp. 1003–1020. Pluimers, F.H., de Leeuw, P.W., Smak, J.A., Elbers, A.R., Stegeman, J.A., 1999. Classical swine fever in The Netherlands 1997–1998: a description of organisation and measures to eradicate the disease. Prev. Vet. Med. 42, 139–155. Yin, S., Shang, Y., Zhou, G., Tian, H., Liu, Y., Cai, X., Liu, X., 2010. Development and evaluation of rapid detection of classical swine fever virus by reverse transcription loop-mediated isothermal amplification (RT-LAMP). J. Biotechnol. 146 (4), 147–150. Zhang, X.J., Sun, Y., Liu, L., Belák, S., Qiu, H.J., 2010. Validation of a loop-mediated isothermal amplification assay for visualised detection of wild-type classical swine fever virus. J. Virol. Methods 167 (1), 74–78.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Development of a loop-mediated isothermal amplification assay combined with a lateral flow dipstick for rapid and simple detection of classical swine fever virus in the field Vinay Kumar Chowdry a , Yuzi Luo b , Frederik Widén a , Hua-Ji Qiu b , Hu Shan c , Sándor Belák a , Lihong Liu a,∗ a
Department of Virology, Immunobiology and Parasitology, National Veterinary Institute, Uppsala, Sweden State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin, China c Key Laboratory of Preventive Veterinary Medicine of Shandong Province, Qingdao Agricultural University, Qingdao, China b
a b s t r a c t Article history: Received 26 August 2013 Received in revised form 20 November 2013 Accepted 22 November 2013 Available online 1 December 2013 Keywords: Classical swine fever virus RT-LAMP Lateral flow dipstick Field diagnosis Molecular detection
Classical swine fever (CSF) is a highly contagious viral disease and may cause heavy economic loss to farmers. The rapid, simple and accurate diagnosis of the disease at the frontline, for example on the farms of concern is crucial for disease control. This study describes the development and evaluation of a new loop-mediated isothermal amplification (LAMP) assay coupled with lateral flow dipstick (LFD) for the detection of classical swine fever virus (CSFV). This RT-LAMP-LFD assay combines the efficient one-step isothermal amplification of CSF viral RNA and the simplicity of the LFD to read the results within two to five minutes. Seven genotypes (1.1, 1.2, 1.3, 2.1, 2.2, 2.3 and 3.1), but not genotype 3.4, were successfully detected by the RT-LAMP-LFD assay, indicating that the method has a broad range of detection and can be applied in different geographical areas where CSFV strains belonging to these genotypes are present. The performance of this RT-LAMP-LFD assay was similar to that of the real-time RT-PCR. The analytical sensitivity was about 100 copies per reaction when testing two genotypes (1.1 and 2.3). No cross-reactivity to non-CSFV pestiviruses was observed. This RT-LAMP-LFD assay can be a useful novel tool for the rapid, simple and economic diagnosis of classical swine fever in the field. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Classical swine fever virus (CSFV) is the causative agent of classical swine fever (CSF), a highly contagious viral disease. It is a small, enveloped, positive-sense, single-stranded RNA virus belonging to the genus Pestivirus of the family Flaviviridae (Pletnev et al., 2011). The other member of the genus include bovine viral diarrhea virus 1 (BVDV-1), bovine viral diarrhea virus 2 (BVDV-2) and border disease virus (BDV). The virus is categorized into three major genetic groups (Lowings et al., 1996), which are further divided into 10 sub-groups: 1.1, 1.2, 1.3, 2.1, 2.2, 2.3, 3.1, 3.2, 3.3, and 3.4 (Paton et al., 2000). Both domestic pigs and wild boars are natural host of CSFV and the disease can be mild, moderate or severe. CSF may cause heavy economic losses to farms. For example, outbreaks in The Netherlands during 1997/98 resulted in the slaughter of over
∗ Corresponding author at: Department of Virology, Immunobiology and Parasitology, National Veterinary Institute, SE-751 89 Uppsala, Sweden. Tel.: +46 18 674689; fax: +46 18 674669. E-mail address: [email protected] (L. Liu). 0166-0934/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2013.11.013
10 million pigs at a cost of over 2 billion US dollars (Pluimers et al., 1999). As the clinical signs vary from case to case, laboratory diagnosis utilizing different techniques is needed in order to either confirm or exclude the infection. While conventional virus isolation remains the “gold standard” method, novel molecular approaches, such as real-time RT-PCR are widely used in national and reference laboratories. A ring trial among 10 European laboratories has demonstrated reliability of the CSF diagnosis using real-time RT-PCR on an international level (Hoffmann et al., 2011). In the meantime, simple and rapid methods such as loop-mediated isothermal amplification (LAMP), published originally by Notomi et al. (2000), have been developed and evaluated for the detection of CSF viral nucleic acids (Chen et al., 2009; Yin et al., 2010; Zhang et al., 2010). Compared to virus isolation and real-time RT-PCR, the LAMP method is more suitable for field applications, since it does not require specialized and/or expensive equipment. In addition, LAMP results can be read by the naked eye, based on the change of turbidity. Alternatively, the LAMP products can be labeled with small molecules such as fluorescein isothiocyanate (FITC) and digoxigenin (DIG), and then separated on lateral flow strips by chromatographic force. Upon specific binding between the molecules
V.K. Chowdry et al. / Journal of Virological Methods 197 (2014) 14–18
15
Table 1 Virus isolates and comparison of the RT-LAMP-LFD and real-time RT-PCR assays. The results are the last dilution of the viruses and Ct values from real-time RT-PCR are presented in brackets. Isolates
Genotype
Country
RT-LAMP-LFD
Real-time RT-PCR
31240/96 Romania I 01 Alfort 187 Argentina 742/Ru 7/3 No. 3/brescia JIK/Ru VRI 4167 94-14901 97-7446/#4 907/1 VRI 2277 2000/8 V2/97 4905 I 97/03 V 273/89 P40/07/87 VA 531 2213/97 2699/Osterode Pomi/2004 30853 591/02 M7 19928/60
1.1 1.1 1.1 1.1 1.1 1.2 1.2 1.2 1.3 1.3 1.3 2.1 2.1 2.1 2.1 2.1 2.2 2.2 2.2 2.2 2.3 2.3*Rostock 2.3 2.3*Uelzen 2.3*Slovakia
Slovak Republic Romania France Argentina Russia Poland Romania Russia Malaysia Costa Rica Honduras Germany Malaysia Great Britain Germany Italy Germany Singapore Italy Czech Republic Germany Romania Israel Bulgaria Hungary
10−1 10−2 10−3 10−2 10−2 10−2 10−2 10−1 10−2 Original Negative 10−1 10−2 10−1 10−2 10−3 10−3 10−2 10−3 10−3 10−1 10−2 10−2 10−2 10−2
10−2 10−3 10−3 10−3 10−2 10−4 10−3 10−1 10−2 10−1 10−1 10−2 10−2 10−2 10−3 10−4 10−4 10−3 10−3 10−3 10−3 10−2 10−3 10−2 10−1
and antibodies embedded in the strip, a colored line appears indicating a positive reaction. A combination of LAMP and lateral flow dipstick (LFD) would make rapid diagnosis in the field or close to farms possible. The objective of this study was to develop and evaluate a one-step RT-LAMP assay combined with LFD as readout for the rapid detection of CSFV. The new assay offers a rapid, economic and simple-to-use novel diagnostic tool suitable for field application. 2. Materials and methods 2.1. Samples and RNA preparation A total of 105 samples were used in this study. Those included 25 CSF virus isolates of cell culture passages (Table 1) and 27 reference sera, kindly provided by the OIE and EU reference laboratory for classical swine fever, Hannover, Germany; 47 RNA preparations (Table 2) from a pestivirus ring trial panel (Hoffmann et al., 2011); and 6 pooled wild boar sera, kindly supplied by ANSES, Maisons Alfort, France. The samples covered eight subtypes (1.1, 1.2, 1.3, 2.1, 2.2, 2.3, 3.1, and 3.4). All the sera were positive for CSFV E2 antibody ELISA. RNA extraction from the 25 virus isolates was performed as described previously (Liu et al., 2011). RNeasy mini kit (Qiagen, Hilden, Germany) was used to extract RNA from serum samples, according to the manufacturer’s protocol. Ten-fold serial dilutions of RNA from virus isolates were prepared. Isolate Argentina (genotype 1.1) was used to optimize initially the RT-LAMP assay.
(35.92) (40.08) (42.52) (38.05) (36.54) (41.34) (38.93) (39.43) (37.45) (40.74) (37.59) (40.22) (36.99) (35.89) (39.50) (41.72) (37.89) (38.89) (38.88) (37.47) (36.62) (39.95) (39.73) (37.35) (32.53)
2.3. Optimization of the RT-LAMP-LFD assay Experiments were performed to optimize the RT-LAMP assay by testing different incubation times, Betaine concentrations and amplification temperature. The optimized CSFV RT-LAMP assay in a total reaction volume of 25 l consisted of 1× Thermo buffer, 0.33 mM dNTPs, 0.2 M F3, B3, Floop, and Bloop primers, 2 M FIP and BIP primers, 0.4 M Betaine (Sigma, St. Louis, MO), 16 U of Bst DNA polymerase (New England Biolabs, Herts, UK), 9 U of Cloned AMV-RT (Invitrogen, Carlsberg, CA) and 3 l of viral RNA. The reaction mixture was incubated on a thermocycler at 60 ◦ C for 60 min followed by 80 ◦ C for 2 min. Eight microliters of the RT-LAMP products were run on a 1.5% agarose gel to visualize the results, while 10–12 l were used in the lateral flow dipstick, HybriDetect 2T (Milenia Biotec, Gissen, Germany), for the detection of amplified products according to manufacturer’s instructions. 2.4. Comparison with CSFV real-time RT-PCR The RNA preparations from the serum samples were tested by a published CSFV real-time RT-PCR (Hoffmann et al., 2005) using SuperScript® III One-Step RT-PCR System (Invitrogen, Carlsberg, CA) in a RotorGene3000 instrument. For detection of CSF viral RNA from virus isolates and RNA panel, AgPath-ID One-step master mix (Applied Biosystems, Foster city, CA) was used. The reaction mixture consisted of 12.5 l of 2× RT-PCR buffer, 1 l of 10 M forward primer, 1 l of 10 M reverse primer, 0.5 l of 10 M probe, 1 l of 25× RT-PCR enzyme mix and 3 l of RNA template. Cycling steps were 45 ◦ C for 10 min, 95 ◦ C for 10 min, followed by 45 cycles of 95 ◦ C for 15 s and 60 ◦ C for 45 s.
2.2. Primer design Six specific primers targeting the 5 UTR of viral genome were designed using the online program Primer Explorer version 4 (http://primerexplorer.jp/elamp4.0.0/index.html). The primer set included two outer primers (F3 and B3), two inner primers (FIP and BIP), and two loop primers labeled with DIG and FITC, respectively (Table 3).
3. Results 3.1. Development of an RT-LAMP-LFD assay A simple, one-step RT-LAMP assay was developed in this study to amplify CSF viral RNA under constant temperature, which was followed by detection of the products in a lateral flow dipstick.
16
V.K. Chowdry et al. / Journal of Virological Methods 197 (2014) 14–18
Table 2 Pestiviral RNA ring trial panel. Virus species
Strain name
Genotype
Quantity (copies/l)
RT-LAMP-LFD
CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV BDV BDV BDV BDV BVDV BVDV BVDV BVDV BVDV BVDV Atypical pestivirus Atypical pestivirus CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV CSFV RSB50
C-strain Eystrup91 Alfort187 Koslov1128 Brescia Schweiz II Pader Bergen D4886/82/Ro Uelzen Spante Congenital Tremor Kanagawa Gifhom 137/4 Rudolph Isard Cp7 NADL Grub Munchen2 CS8644 Bure Hobi Giraffe H138 Alfort187 Alfort187 Alfort187 Alfort187 Alfort187 Alfort187 Alfort187 Spante Spante Spante Spante Spante Spante Spante Kanagawa Kanagawa Kanagawa Kanagawa Kanagawa Kanagawa Kanagawa –
1.1 1.1 1.1 1.2 1.2 2.1 2.1 2.2 2.2 2.3 2.3 3.1 3.4 3 2 1 4 1 1 1 2 2 2 – – 1.1 1.1 1.1 1.1 1.1 1.1 1.1 2.3 2.3 2.3 2.3 2.3 2.3 2.3 3.4 3.4 3.4 3.4 3.4 3.4 3.4 –
1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 104 1 × 103 4 × 103 8 × 102 1.6 × 102 3.2 × 101 6.4 × 100 1.28 × 100 2.56 × 10−1 4 × 103 8 × 102 1.6 × 102 3.2 × 101 6.4 × 100 1.28 × 100 2.56 × 10−1 4 × 103 8 × 102 1.6 × 102 3.2 × 101 6.4 × 100 1.28 × 100 2.56 × 10−1 –
Positive Positive Positive Positive Positive Positive Positive Positive Positive Positive Positive Positive Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Positive Positive Positive Positive Negative Negative Negative Positive Positive Positive Positive Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative
The optimal condition was incubation at 60 ◦ C with 0.4 M Betaine in the reaction. Compared to gel electrophoresis, the LFD format improved RT-LAMP detection limit in 9 samples (742/Ru, 7/3, No. 3/Brescia, V2/72, 4905 I 97/03, P40/07/87, VA 531, 591/02, and M7 19928/60) while reduced detection in 2 samples (94-14901/02-94 and 907/1). It reduced difficulties in interpreting results when a thick smeared band, instead of a typical ladder-like pattern, was observed after electrophoresis in a 1.5% agarose gel. In such cases, further dilution of the RT-LAMP products was made prior to gel electrophoresis. To evaluate the RT-LAMP-LFD assay, 10-fold serial
dilutions of 25 viral RNA preparations were tested by both the RT-LAMP-LFD and real-time RT-PCR (Hoffmann et al., 2005). The RT-LAMP-LFD assay detected 24 out 25 strains at different dilution levels (Table 1). The RT-LAMP-LFD had the same detection limit as real-time RT-PCR in 9 samples, a 10-fold less in 12 samples or a 100-fold less in 2 samples. The RT-LAMP-LFD performed better than the real-time RT-PCR in testing one sample. The RNA preparation of the isolate 97-7446/#4 was negative by the RT-LAMP-LFD but positive by real-time RT-PCR. The 10-fold dilution gave a Ct value of 37.59, indicating a very low viral load in the original RNA
Table 3 Primers used for CSFV LAMP assay. Primer
Type
Sequence (5 –3 )
FIP F3 BIP B3 Floop Bloop
Forward inner Forward outer Backward inner Backward outer Forward loop Reverse loop
GTCTTGGGCATGCCCTCGTCTTTTCGTCAGTAGTTCGACGTGAG GGGTGGTCTAAGTCCTGAGT ACACCTTAACCCTAGCGGGGGTTTTCAGCACCCTATCAGGTCGTA AGCCTAATAGTGGGCCTCTG [DIG]-GCATATCGAGGTGGGCTTCT [FITC]-CTAGGGTGAAATCACACCACGT
V.K. Chowdry et al. / Journal of Virological Methods 197 (2014) 14–18
Fig. 1. Examples of detection of classical swine fever viral RNA by the RT-LAMP-LFD assay lanes 1–6 are samples with one negative (lane 1) and five positive (lanes 2–6). Lane 7, water RNA extraction control and lane 8, water RT-LAMP-LFD control. Both are regarded as negative.
preparation that was below the detection limit of the RT-LAMPLFD. 3.2. Analytic sensitivity and specificity Analytic sensitivity and specificity of the RT-LAMP-LFD assay were evaluated by testing a well-defined pestiviral RNA panel, which included 13 CSFV strains of 7 genotypes, 4 BDV strains, 6 BVDV strains, 2 atypical pestiviruses, and serial dilutions of 3 strains (Table 2). The RT-LAMP-LFD assay detected 12 CSFV strains of genotypes 1.1, 1.2, 2.1, 2.2, 2.3, and 3.1. All the strains had a concentration of around 1 × 104 copies/l. The most divergent strain Kanagawa of genotype 3.4 was not detected, which might be due to mismatches between the primers and target. The RT-LAMP-LFD had an analytic sensitivity of about 100 copies per reaction in testing both genotypes 1.1 (strain Alfort/187) and 2.3 (strain Spante). As BVDV and BDV can also infect pigs, the non-CSFV pestiviruses included in the RNA panel were tested by the assay and found negative (Table 2). 3.3. Detection of CSFV in domestic swine sera and in French field sera The applicability of the RT-LAMP-LFD for field condition was further evaluated by testing 33 antibody-positive serum samples including 27 reference sera and 6 pooled wild boar sera. Six out of the 27 reference sera were found positive by the RT-LAMP-LFD assay and all six pooled sera were negative. Fig. 1 demonstrates the detection of CSFV in sera. The ability of the assay to detect viral RNA in serum samples suggested that it is applicable for field investigation of CSFV infection. 4. Discussion This report describes the development and evaluation of a new CSFV RT-LAMP-LFD assay, which combines the efficiency of one-step isothermal amplification of CSF viral RNA and the simplicity of the LFD to read the results within a few minutes. In addition, the LFD readout also improved RT-LAMP detection of viral RNA in certain samples. Compared with previous studies
17
(Chen et al., 2009; Yin et al., 2010; Zhang et al., 2010), the new assay was evaluated with a broad range of CSFV genotypes and a well-defined RNA panel of different pestiviruses. Thus, the new RT-LAMP-LFD assay has a great potential to be used in the field for the rapid and sensitive detection of CSFV. In this study, seven genotypes (1.1, 1.2, 1.3, 2.1, 2.2, 2.3 and 3.1) were successfully detected by the RT-LAMP-LFD assay, indicating that the method can be applied broadly in different geographical areas where CSFV strains belonging to these genotypes are present. The only exception is genotype 3.4, which is so divergent that mismatches between primers and viral genome might have occurred and this could be the reason why it was not detected by the assay. As the RT-LAMP has four primers targeting six different genomic regions with an amplicon (F3/B3) size of about 200 bp, accumulation of a couple of mismatches in each primer might decrease amplification efficiency or even lead to complete failure. Further adjustment of primer nucleotide sequences might be able to improve the detection range such that genotype 3.4 strains are efficiently detected. It has been reported that RT-LAMP assay can be as sensitive as real-time RT-PCR (Blomström et al., 2008). The best performance of this RT-LAMP-LFD assay was similar to that of the real-time RT-PCR as both assays were able to detect CSFV RNA to the same dilution levels of the nine samples belonging to six genotypes (1.1, 1.2, 1.3, 2.1, 2.2, 2.3). As determined by real-time RT-PCR, these dilutions had Ct values ranging from 36.54 to 42.52, which are close to cut-off values of a real-time RT-PCR. The analytical sensitivity was about 100 copies per reaction when testing two genotypes (1.1 and 2.3), and no cross-reactivity to non-CSFV pestiviruses was observed, which suggested the assay was specific. For the other 12 samples, the RT-LAMP-LFD detected viral RNA to the dilution levels 10-fold less than that by real-time RT-PCR. It seemed likely that the primer-binding regions of viral genomes differed within and among genotypes. Since the first description of the LAMP method in 2000, many LAMP assays have been developed for detection of pathogenic microorganisms, genetically modified ingredients, tumor detection, and embryo sex identification (Fu et al., 2011). And a new commercial Malaria LAMP kit has been developed and evaluated in a remote Ugandan clinic, with sensitivity similar to single-well nPCR in a UK reference laboratory (Hopkins et al., 2013). Herewith, we report a simple, rapid, sensitive and specific RT-LAMP-LFD assay, which allows a simple, economic and rapid diagnosis of CSF on the field. After a further optimization of the primer sequences, simplifying the sample preparation and streamlining the diagnostic procedure, this RT-LAMP-LFD assay has the capacity to be used by local veterinarians for the diagnosis of CSF in the field. Acknowledgements The authors wish to thank Drs. Katrin Pannhorst and Denise Meyer, EU and OIE Reference Laboratory for CSF, Hannover, Germany; and Prof. Marie-Frédérique Le Potier, ANSES, Ploufragan, France, for providing the serum samples. This study was supported by the European Union FP7 projects “Improve tools and strategies for the prevention and control of classical swine fever” (CSFV goDIVA, no. grant no. 227003) and “Rapid Field Diagnostics and Screening in Veterinary Medicine” (RAPIDIA-Field, no. 289364). HS would like to acknowledge the support by two projects “Important diseases of livestock and poultry epidemiological investigation” and “Pig expert creative team positions – disease control”. References Blomström, A.L., Hakhverdyan, M., Reid, S.M., Dukes, J.P., King, D.P., Belák, S., Berg, M., 2008. A one-step reverse transcriptase loop-mediated isothermal amplification
18
V.K. Chowdry et al. / Journal of Virological Methods 197 (2014) 14–18
assay for simple and rapid detection of swine vesicular disease virus. J. Virol. Methods 147 (1), 188–193. Chen, H.T., Zhang, J., Ma, L.N., Ma, Y.P., Ding, Y.Z., Liu, X.T., Chen, L., Ma, L.Q., Zhang, Y.G., Liu, Y.S., 2009. Rapid pre-clinical detection of classical swine fever by reverse transcription loop-mediated isothermal amplification. Mol. Cell Probes 23 (2), 71–74. Fu, S., Qu, G., Guo, S., Ma, L., Zhang, N., Zhang, S., Gao, S., Shen, Z., 2011. Applications of loop-mediated isothermal DNA amplification. Appl. Biochem. Biotechnol. 163 (7), 845–850. Hoffmann, B., Beer, M., Schelp, C., Schirrmeier, H., Depner, K., 2005. Validation of a real-time RT-PCR assay for sensitive and specific detection of classical swine fever? J. Virol. Methods 130 (1/2), 36–44. ˜ Hoffmann, B., Blome, S., Bonilauri, P., Fernández-Pinero, J., Greiser-Wilke, I., Haegeman, A., Isaksson, M., Koenen, F., LeBlanc, N., Leifer, I., Le Potier, M.F., Loeffen, W., Rasmussen, T.B., Stadejek, T., Ståhl, K., Tignon, M., Uttenthal, A., van der Poel, W., Beer, M., 2011. Classical swine fever virus detection: results of a realtime reverse transcription polymerase chain reaction ring trial conducted in the framework of the European network of excellence for epizootic disease diagnosis and control. J. Vet. Diagn. Invest. 23 (5), 999–1004. Hopkins, H., González, I.J., Polley, S.D., Angutoko, P., Ategeka, J., Asiimwe, C., Agaba, B., Kyabayinze, D.J., Sutherland, C.J., Perkins, M.D., Bell, D., 2013. Highly sensitive detection of malaria parasitemia in a malaria-endemic setting: performance of a new loop-mediated isothermal amplification kit in a remote clinic in Uganda. J. Infect. Dis. (Epub ahead of print). Liu, L., Xia, H., Everett, H., Sosan, O., Crooke, H., Meindl-Böhmer, A., Qiu, H.J., Moennig, V., Belák, S., Widén, F., 2011. A generic real-time TaqMan assay for specific
detection of lapinized Chinese vaccines against classical swine fever. J. Virol. Methods 175 (2), 170–174. Lowings, P., Ibata, G., Needham, J., Paton, D., 1996. Classical swine fever virus diversity and evolution. J. Gen. Virol. 77, 1311–1321. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28 (12), E63. Paton, D.J., McGoldrick, A., Greiser-Wilke, I., Parchariyanon, S., Song, J.Y., Liou, P.P., Stadejek, T., Lowings, J.P., Björklund, H., Belák, S., 2000. Genetic typing of classical swine fever virus. Vet. Microbiol. 73, 137–157. Pletnev, A., Gould, E., Heinz, F.X., Meyers, G., Thiel, H.J., Bukh, J., Stiasny, K., Collett, M.S., Becher, P., Simmonds, P., Rice, C.M., Monath, T.P., 2011. Flaviviridae. In: King, A.M., Adams, M.J., Carstens, E.B., Lefkowitz, E.J. (Eds.), Virus Taxonomy. Oxford, Elsevier, pp. 1003–1020. Pluimers, F.H., de Leeuw, P.W., Smak, J.A., Elbers, A.R., Stegeman, J.A., 1999. Classical swine fever in The Netherlands 1997–1998: a description of organisation and measures to eradicate the disease. Prev. Vet. Med. 42, 139–155. Yin, S., Shang, Y., Zhou, G., Tian, H., Liu, Y., Cai, X., Liu, X., 2010. Development and evaluation of rapid detection of classical swine fever virus by reverse transcription loop-mediated isothermal amplification (RT-LAMP). J. Biotechnol. 146 (4), 147–150. Zhang, X.J., Sun, Y., Liu, L., Belák, S., Qiu, H.J., 2010. Validation of a loop-mediated isothermal amplification assay for visualised detection of wild-type classical swine fever virus. J. Virol. Methods 167 (1), 74–78.
