Journal of Microbiological Methods 115 (2015) 94–99

Contents lists available at ScienceDirect

Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth

Development of a quantitative PCR assay for rapid detection of Lactobacillus plantarum and Lactobacillus fermentum in cocoa bean fermentation Livia Schwendimann a, Peter Kauf b,c, Lars Fieseler a, Corinne Gantenbein-Demarchi a, Susanne Miescher Schwenninger a,⁎ a b c

Institute of Food and Beverage Innovation, Zurich University of Applied Sciences, Wädenswil, Switzerland Institute of Applied Simulation, Zurich University of Applied Sciences, Wädenswil, Switzerland PrognosiX AG, Wädenswil, Switzerland

a r t i c l e

i n f o

Article history: Received 27 April 2015 Received in revised form 25 May 2015 Accepted 25 May 2015 Available online 28 May 2015 Keywords: Lactobacillus plantarum Lactobacillus fermentum qPCR Cocoa bean fermentation

a b s t r a c t To monitor dominant species of lactic acid bacteria during cocoa bean fermentation, i.e. Lactobacillus plantarum and Lactobacillus fermentum, a fast and reliable culture-independent qPCR assay was developed. A modified DNA isolation procedure using a commercial kit followed by two species-specific qPCR assays resulted in 100% sensitivity for L. plantarum and L. fermentum. Kruskal–Wallis and post-hoc analyses of data obtained from experiments with cocoa beans that were artificially spiked with decimal concentrations of L. plantarum and L. fermentum strains allowed the calculation of a regression line suitable for the estimation of both species with a detection limit of 3 to 4 Log cells/g cocoa beans. This process was successfully tested for efficacy through the analyses of samples from laboratory-scale cocoa bean fermentations with both the qPCR assay and a culturedependent method which resulted in comparable results. © 2015 Elsevier B.V. All rights reserved.

1. Introduction The quality of chocolate is mainly determined by the quality of the raw material, particularly the fermented and dried cocoa beans. Cocoa bean quality itself greatly depends on good agricultural practices but also on post-harvest processing including the fermentation and drying processes. Without the latter processes, cocoa beans would have an excessively bitter and astringent flavor (Lima et al., 2011; Thompson et al., 2001; Schwan and Wheals, 2004). Cocoa bean fermentation is characterized by a distinct microbiota such as lactic and acetic acid bacteria, as well as yeasts, but bacilli and undesirable molds can also be present (Camu et al., 2007; Nielsen et al., 2007; Papalexandratou et al., 2011a,b). During the manual handling of the beans and later, when the beans are inoculated with residual mucilage present on the surface of boxes from previous fermentations, the fermentation process starts spontaneously (Thompson et al., 2001; Schwan and Wheals, 2004). During this spontaneous process, Lactobacillus fermentum and Lactobacillus plantarum are predominantly observed in the group of lactic acid bacteria and seem to play an important role in the overall fermentation, independent of the

⁎ Corresponding author at: Institute of Food and Beverage Innovation, Zurich University of Applied Sciences, Campus Grüental, 8820 Wädenswil, Switzerland. E-mail address: [email protected] (S. Miescher Schwenninger).

http://dx.doi.org/10.1016/j.mimet.2015.05.022 0167-7012/© 2015 Elsevier B.V. All rights reserved.

geographic location of the fermentation or the applied isolation method (Ardhana and Fleet, 2003; Camu et al., 2007, 2008; Carr et al., 1979; Garcia-Armisen et al., 2010; Kostinek et al., 2008; Lagunes Galvez et al., 2007; Ostovar and Keeney, 1973; Schwan, 1998; Thompson et al., 2001). In addition, both species have already been tested in starter cultures for cocoa bean fermentation (Lefeber et al., 2010, 2011). Lefeber et al. (2011) and Pereira et al. (2012) used L. fermentum in combination with other non-lactic acid bacteria and yeasts. The combination of both species, i.e. L. plantarum and L. fermentum, as a co-culture was described by Lefeber et al. (2010) in combination with Acetobacter pasteurianus. The development of the dominant lactic acid bacteria species L. plantarum and L. fermentum during cocoa bean fermentation seems to give an indication for the quality of the overall process (Papalexandratou et al., 2013). Quantification of the respective species might thus provide a means to monitor the overall fermentation process. Currently available culture-dependent methods for the quantification of microorganisms are time-consuming and sometimes unreliable. To date, culture-independent methods such as PCR–DGGE have been applied to study lactic acid bacteria communities in cocoa bean samples. However, PCR–DGGE does not permit a quantification of the target bacteria (Camu et al., 2007, 2008; Lefeber et al., 2011; Papalexandratou et al., 2011a,b, 2013; Santos et al., 2011). Quantification of lactic acid bacteria using qPCR has only been described in a few studies, e.g. for monitoring L. plantarum in grass silages, diverse Lactobacillus species in advanced dental caries, or fecal Lactobacillus species in infants

L. Schwendimann et al. / Journal of Microbiological Methods 115 (2015) 94–99

(Klocke et al., 2006; Byun et al., 2004; Haarman and Knol, 2006). The objective of this study was to develop a fast and reliable cultureindependent method based on qPCR to enable the monitoring of the two lactic acid bacteria species L. plantarum and L. fermentum during cocoa bean fermentation through the design and application of novel oligonucleotides. 2. Material and methods 2.1. Bacterial strains and growth conditions The microbial strains used in this study were obtained from the ZHAW (Zurich University of Applied Sciences, Institute of Food and Beverage Innovation) culture collection. They were previously isolated from cocoa bean fermentations in Brazil and Bolivia and identified by MALDI-TOF MS (Miescher Schwenninger et al., submitted for publication) (Table 2). Additional strains were obtained from ATCC (American type culture collection) and DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen). Lactic acid bacteria were propagated on De Man, Rogosa and Sharp Agar (De Man et al., 1960) (MRS agar with tween 80, Biolife, Milano, Italy) and in MRS broth (MRS broth, Oxoid, Hamshire, UK). Both media were incubated under anaerobic conditions (AnaeroGen™, Oxoid) at 37 °C for three days. Acetic acid bacteria were grown on YPM agar (yeast peptone medium agar, 0.5% yeast extract, SigmaAldrich, 0.3% peptone bacteriological, Biolife, 1.2% agar bios special LL, Biolife) and YPM broth (0.5% yeast extract, 0.3% peptone bacteriological) at 25 °C for five days. Propagation of other species was carried out with plate count agar (tryptic glucose yeast agar, Biolife) and BHI broth (brain heart infusion broth, Biolife) at 37 °C for one day. 2.2. Laboratory-scale cocoa bean fermentation and spiking experiments Cocoa bean samples were taken from two laboratory-scale fermentations, i) in Brazil where a batch of 3 kg cocoa beans was fermented for five days (Miescher Schwenninger et al., submitted for publication), and ii) in Switzerland, where portions of 500 g of cocoa beans were fermented for five days. The second fermentation was performed in an incubator with a temperature profile adapted from Dubon and Sanchez (2011) and an inoculation with 2% (w/v) sawdust obtained from a used fermentation box in Honduras. Samples of 4 g, corresponding to one cocoa bean including adherent pulp, were taken from each fermentation after 0, 24, 48, 72, 96, and 120 h of fermentation and stored at −20 °C until further analysis. For the spiking experiments, lactic acid bacteria were prepared as follows: Either L. plantarum DSM20174 or L. fermentum DSM20052 was transferred from an MRS agar plate to MRS broth, followed by incubation at 37 °C for 18 to 24 h and a serial dilution (ca. 9 to 1 Log cells/ml). The concentration of the cells in the dilution containing ca. 7 Log cells/ml was determined using a Neubauer Hemocytometer (Neubauer, 0.01 mm, 0.0025 mm2, Assistant, Sondheim, Germany) and a microscope (Leica DM LS2, Wetlar, Germany) and the preparation of the defined spiking levels was calculated. Samples of 4 g cocoa beans including adherent pulp were then prepared with defined spiking levels from 1 to 8 Log cells/g using cocoa fruits imported from Colombia (Globus, Zurich, Switzerland). The husk of the cocoa fruits was disinfected with ethanol before the fruit was opened under sterile conditions to avoid contamination with the putative lactic acid bacteria naturally present on the surface. 2.3. Culture-dependent quantification of microorganisms For culture-dependent analysis of cocoa beans, 180 ml of dilution solution (0.1% bacteriological peptone and 0.85% NaCl) was added to 20 g of pulp-bean mass in a sterile stomacher bag. The bag was then manually kneaded for 3 min and serial dilutions were plated on MRS agar.

95

2.4. Microbial DNA isolation from broth cultures DNA isolation from bacterial broth cultures was performed using Dneasy® Blood & Tissue Kits (Qiagen, Hilden, Germany) according to the manufacturer's instructions. 2.5. Microbial DNA isolation from cocoa bean samples Microbial DNA isolation from cocoa bean samples was performed using PowerFood™ Microbial DNA Isolation Kits from MO BIO Laboratories (Carlsbad, USA). Samples were prepared as follows: 4 g cocoa beans including adherent pulp were mixed with 12 ml 1 × PBS (phosphatebuffered saline according to Sambrook and Russel (2001)) and were then homogenized in a falcon tube on a vortex at maximum speed for 1 min. After homogenization the mixture was put into a stomacher bag using a filter. The filtrate was collected and added to a 15-ml falcon tube, centrifuged at 13,000 ×g and 4 °C for 3 min, vortexed, and centrifuged again at 13,000 ×g and 4 °C for 5 min. The extraction of the pellet was performed as described in the handbook of the PowerFood™ kit (PowerFood™ Instruction Manual) with the following modifications: The homogenate and the lysis buffer in the MicroBeads' tube were heated at 65 °C for 10 min and eluted with 80 μl of sterile elution buffer (supplied in the kit). 2.6. Primer and probe design For the detection of L. plantarum, primers and probe by Klocke et al. (2006) were used. For the detection of L. fermentum, the forward primer described by Byun et al. (2004) was used in combination with a reverse primer and probe that were designed in this study using the 16S rRNA gene of L. fermentum (NBRC 15885; Accession number AB626052) (Table 1). All primers and probes were checked for their specificity using the BioEdit Sequence alignment editor (version 7.1.11) and the following cocoa bean fermentation-relevant 16S rDNA sequences from the GenBank (with accession numbers): Lactobacillus brevis (NR_075024), L. casei (NR_075032), L. delbrueckii (NR_075019), L. mali (NR_044709), L. paracasei (JX987490), L. paraplantarum (JX974348), L. pentosus (AB778521), L. rossiae (NR_029014), L. acidophilus (NR_075049), L. fermentum (KC348395, AB626052), L. nagelii (AB370876, AB289206), L. plantarum (HF571129, X52653, AB795645.1, AB795646.1, NC_012984.1, NC_014554.1, NC_004567.2, NC_020229.1), Lactococcus lactis (NR_074949), Leuconostoc gasicomitatum (NR_074997), Leuconostoc mesenteroides (HF586418, NR_074957), Weissella cibaria (KC110687), Weissella paramesenteroides (AB778525), Bacillus subtilis (KC222510, KC405250, KC315772), Bacillus licheniformis (KC176365), Bacillus pumilus (KC315774), Erwinia soli (JQ836170), Gluconobacter oxydans (NR_074252), Acetobacter aceti (NR_026121), Acetobacter pasteurianus (KC310829). Moreover, the “Checklist for optimisation and validation for qPCR assay” from Raymaekers et al. (2009) was applied. To determine the melting temperature and GC-content, the Oligonucleotide Properties Calculator from Northwestern University (http://www.basic.northwestern.edu/biotools/ oligocalc.html) was used. Primers and probes were produced by Microsynth (Balgach, Switzerland). 2.7. qPCR conditions qPCR was performed using a LightCycler 480 (Roche, Basel, Switzerland) and the LightCycler® 480 Software release 1.5.0 (Roche). Cycling conditions for the quantification of L. plantarum were applied as described by Klocke et al. (2006) with a final reaction volume of 20 μl analyzed in a LightCycler® 480 Probes Master 2x (Roche). 3 μl of isolated DNA were applied as a template. Cycle conditions were applied as follows: initial pre-incubation at 95 °C for 5 min (ramp speed 4.4 °C/min), followed by 45 cycles with a sequence of 95 °C for 10 s (ramp speed 4.4 °C/min), 59 °C for 50 s (ramp speed 2.2 °C/min), and 72 °C for 1 s

96

L. Schwendimann et al. / Journal of Microbiological Methods 115 (2015) 94–99

Table 1 Primers and probes for qPCR (Yak-Yel = Yakima Yellow). Target strain/s

Target gene

Name of primer or probe

Sequence 5′–3′

Melting temperature [°C]

GC–Content [%]

L. plantarum

16S rDNA

PlanF PlanR Plan P

55 53 61

42 55 58

62

L. fermentum

16S rDNA

LFermF LFermR LFermP

TTACATTTGAGTGAGTGGCGAACT AGGTGTTATCCCCCGCTTCT Yak-Yel-GTGAGTAACACGTGGG WAACCTGCCC-BHQ-1 GCACCTGATTGATTTTGGTCG GGTATTAGCATCTGTTTCCAAATG FAM-CCAACGAGTGGCGGACGGGTGAG-BHQ-1

58 56 63

47 37 70

103

(ramp speed 4.4 °C/min). The final cooling step consisted of 40 °C for 10 s (ramp speed 1.5 °C/min). For qPCR quantification of L. fermentum, the following concentrations were applied: 500 nM forward primers (LFermF), 500 nM reverse primers (LFermR), and 200 nM probe (LFermP). The total reaction volume was 20 μl and a LightCycler® 480 Probes Master 2x (Roche) as for detection of L. plantarum was used but with 5 μl of isolated DNA. Optimized thermal cycling consisted of an initial pre-incubation at 95 °C for 5 min (ramp speed 4.4 °C/min), followed by 45 cycles with a sequence of 95 °C for 10 s (ramp speed 4.4 °C/min), 64 °C for 50 s (ramp speed 2.2 °C/min), and 72 °C for 1 s (ramp speed 4.4 °C/min). A final cooling step consisted of 40 °C for 10 s (ramp speed 1.5 °C/min). To reduce experimental setup variation, each qPCR reaction was replicated twice in the same reaction plate. To test the specificity of the qPCR assay, DNA isolated from broth cultures (3 to 9 Log cells/ml) was analyzed in three repetitions for each concentration and for each strain. qPCR analyses with microbial DNA isolated from cocoa beans spiked with L. plantarum DSM20174 or L. fermentum DSM20052 were repeated five times for each strain (spiking concentration from 0 to 8 Log cells/g). 2.8. Assay controls To test for false positive results during DNA isolation, a process control containing pure water was included in every DNA isolation run. A no template control (NTC) was included in qPCR where DEPC treated water (deionized, diethylpyrocarbonate) was applied instead of DNA. In addition, positive (L. plantarum DSM20174 and L. fermentum DSM20052) and negative (Escherichia coli ATCC25922) control samples were assayed. Three colonies of the respective bacterium were added to 100 μl DEPC water followed by DNA isolation as described above. The isolated DNA was diluted ten-fold and qPCR analysis was performed. In qPCR with microbial DNA isolated from cocoa bean samples an additional inhibition control was used to exclude the presence of PCR inhibitors. Therefore, a master mix containing probe master, primers, and DEPC water was spiked with 2 μl extracted DNA from a L. plantarum or L. fermentum broth culture. 2.9. Statistical analyses All statistical analyses were performed using R (version 3.1.1.). The tests' hypotheses were two-sided and statistical significance was accepted when p b 0.05. The limit of detection was defined using the Kruskal–Wallis test followed by post-hoc tests (pairwise Wilcoxon tests with error inflation correction following Holm). ANOVA was not applied, since data were not clearly compatible with normality assumptions (assessed through QQ-plots of residuals, Shapiro–Wilk and Kolmogorov–Smirnov tests). The limit of detection was defined if significant differences between concentration groups were observed. The relations between defined Log cell concentrations spiked on cocoa beans and Ct values obtained from qPCR were approximated by a linear model. With Shapiro–Wilk and Kolmogorov–Smirnov tests, normality of the residuals to these models was validated and prognosis

Amplicon length [bp]

Reference Klocke et al. (2006) Klocke et al. (2006) Klocke et al. (2006) Byun et al. (2004) This study This study

bands around the linear models could be computed based on normality assumptions. A regression line was needed to make an estimation of the number of lactic acid bacteria present in the fermented cocoa bean samples. This regression line with prognosis band (p = 0.95) was plotted from the limit of detection up to a concentration of 8 Log cells/g on cocoa beans or 9 Log cells/ml in broth cultures. qPCR data from cocoa bean fermentation samples were extended with 95% confidence intervals with a parametric bootstrap technique. Therefore, 1) the mean of two repetitions of Ct value measurements was calculated, 2) the 95%-prognosis band of the cocoa bean samples regression line at the level of this mean value was used to estimate the standard deviation induced by Ct value measurement (necessary assumptions of normal distribution of residuals were validated by QQplot, Shapiro–Wilk and Kolmogorov–Smirnov tests), 3) Ct value measurements were simulated (parametric bootstrap) using the normal distribution with standard deviation as determined in 2), and 4) the simulated Ct value measurements were transformed to concentrations (using the parameters of the linear regression model) resulting in a data model with an estimated distribution of cell concentrations related to the measured Ct values. Judging from the very high values of R2 obtained for the data model, uncertainty in the estimated parameters for the regression line in step 4) was neglected. The resulting information on the distribution of cell concentrations determined by qPCR was illustrated using boxplots (following standard definition of R, see http://stat.ethz.ch/R-manual/R-devel/library/ graphics/html/boxplot.html). To estimate the effect of time on concentrations, the ratio of variability as explained by the model and the total variability (η2) was computed. Values of η2 N 0.14 were considered high (following Brown (2007)). 3. Results 3.1. Sensitivity and specificity of qPCR for detection of lactic acid bacteria The qPCR assay for detection of L. plantarum and L. fermentum developed in this study was initially optimized by testing different concentrations of primers and probes, followed by determination of efficiency and limit of detection for both assays. The optimized qPCR assay for the detection of L. plantarum exhibited an efficiency of 86.01% and a correlation coefficient R2 of 0.9957 obtained from broth culture assays (Table 3). The limit of detection (LOD) was determined from applying serial dilutions of bacteria (Fig. 1). The data indicated that the LOD of this assay was 3 Log cells/ml (p b 0.0001). Fig. 1A shows the decrease in Ct value with Log cell concentration of L. plantarum in broth culture. As depicted in Table 2, the assay exhibited a specificity of 100%, because all tested L. plantarum strains revealed positive signals. Other bacteria did not reveal any signals in qPCR analyses with the exception of L. pentosus. The optimized qPCR assay for detection of L. fermentum showed an efficiency of 99.66% and a correlation coefficient R2 of 0.9923 obtained from broth culture assays (Table 3). A significant difference was observed (p b 0.0001) between all different concentration levels (3 to 9 Log cells/ml). Fig. 1B shows the decrease in Ct value with Log cell

L. Schwendimann et al. / Journal of Microbiological Methods 115 (2015) 94–99

97

Fig. 1. A: Regression line with confidence band using p = 0.68 for L. plantarum qPCR analysis with a broth culture of L. plantarum DSM20174 (○ ---; R2 = 0.9957) and L. plantarum DSM20174 inoculated on cocoa beans (Δ ––; R2 = 0.9708); B: Regression line with confidence band using p = 0.68 for L. fermentum qPCR analysis with a broth culture of L. fermentum DSM20052 (○---; R2 = 0.9923) and L. fermentum DSM20052 inoculated on cocoa beans (Δ ––; R2 = 0.9232).

Table 2 Bacterial stains used in this study and specificity for primers and probes for detection of L. plantarum and L. fermentum by qPCR. Genus/Species

Straina

qPCR L. plantarumb

qPCR L. fermentumb

Acetobacter pasteurianus Acetobacter pasteurianus Bacillus cereus Bacillus subtilis Bacillus subtilis Enterococcus sp. Enterococcus sp. Escherichia coli Escherichia coli Escherichia coli Escherichia coli Escherichia coli Escherichia coli Escherichia coli Gluconobacter oxydans Klebsiella oxytoca Klebsiella pneumoniae L. amylovorus L. delbrueckii subsp. bulgaricus L. fermentum L. fermentum L. fermentum L. fermentum L. fermentum L. johnsonii L. mali L. nagelii L. paracasei L. pentosus L. pentosus L. plantarum L. plantarum L. plantarum L. plantarum Leuconostoc pseudomesenteroides Ochrobactrum sp. Pantoea agglomerans Pantoea agglomerans Pediococcus acidilactici Pediococcus acidilactici Proteus mirabilis Providentia stuartii Saccharomyces cerevisiae Staphylococcus epidermidis

BoH0107002S BoE0107001S ATC11778 DSM347 DSM10888 BoM0108004CH BoM0106005CH ATC25922 BoE0207001S BoE0108002CH BoE0108004CH BRE0501282 BRE0501288 BoEE0108005S BRE0303171 BoE0200002S BoEE0100001S BoM0107003S DSM20081 BoM0107004S DSM20052 BRM0402224 BRM0403240 BRM0605400 DSM10533 BRM0503305 DSM13675 BRM0406268 BRM0606402 BRM0606410 DSM20174 BoM0102005S BRM0302165 BoM0101003S BoM0100001S BoEE0108004S BREE0505324 BREE0505330 BoM0109002S BoM0201002S BRE0501287 BoE0207002S BoH0100002S BoM0102001CH

− − − − − − − − − − − − − − − − − − − − − − − − − − − − + + + + + + − − − − − − − − − −

− − − − − − − − − − − − − − − − − − − + + + + + − − − − − − − − − − − − − − − − − − − −

concentration of L. fermentum in broth culture. Again, the LOD was 3 Log cells/ml. The assay exhibited a specificity of 100% for all L. fermentum strains tested. All tested non-L. fermentum strains revealed negative test results (Table 2). Slopes, intercepts, R2 and the efficiencies of both assays are summarized in Table 3. 3.2. Quantification of L. plantarum and L. fermentum on spiked cocoa beans using qPCR To determine the efficacy of the developed qPCR assays for the quantification of L. plantarum and L. fermentum on cocoa beans, spiked samples were analyzed and the data were compared with data derived from plate counting on MRS agar. Each sample of fermented cocoa beans was analyzed twice with the two different qPCR assays targeting L. plantarum and L. fermentum. The resulting data points were handled as single data. Significant differences (p b 0.0001) in Ct values were determined for L. plantarum DSM20174 spiked on cocoa beans in concentrations of 2 to 8 Log cells/g. The corresponding LOD was between 2 and 3 Log cells/g. The resulting slope showed an efficiency of 79.66% (see Table 3) and a correlation coefficient R2 of 0.9708 (Fig. 1A). Similarly, significant differences (p b 0.0001) in Ct values were determined for L. fermentum DSM20052 spiked on cocoa beans in concentrations of 2 to 8 Log cells/ g, corresponding to an LOD between 2 and 3 Log cells/g. The regression analysis showed a correlation coefficient R2 of 0.9232 (Fig. 1B) and an efficiency of 102.65% (see Table 3). 3.3. Monitoring of L. plantarum and L. fermentum during cocoa bean fermentation using qPCR As proof of concept, the qPCR assay for detection of L. plantarum and L. fermentum was applied on cocoa bean samples from laboratory-scale fermentations from Brazil and Switzerland. Data obtained by qPCR were compared with data from plate counting on MRS agar (Fig. 2). Plate counting on MRS agar of cocoa bean samples from Brazil revealed a lactic acid bacteria concentration of 2 Log CFU/g at the beginning of the fermentation (0 h) and 8 Log CFU/g after 120 h of

Table 3 Slope, intercept, R2 and efficiency of qPCR assays performed with bacteria from broth culture and after inoculation on cocoa beans. L. plantarum

a

Bo…, isolated from cocoa bean fermentation in Bolivia; BR…, isolated from cocoa bean fermentation in Brazil; DSM, obtained from DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen); ATCC, obtained from ATCC (American Type Culture Collection). b Results from real-time PCR were obtained in triplicate, “+” for positive results (CtValue b 40) and “−” for negative results (Ct-value ≥ 40).

Slope Intercept R2 Efficiency

L. fermentum

Broth culture

Cocoa beans

Broth culture

Cocoa beans

−3.71875 48.98202 0.9957 86.01%

−3.93269 50.08216 0.9708 79.66%

−3.33637 45.06798 0.9923 99.66%

−3.26774 46.23624 0.9232 102.65%

98

L. Schwendimann et al. / Journal of Microbiological Methods 115 (2015) 94–99

fermentation (Fig. 2A). Quantification of L. plantarum by qPCR resulted in 3 Log cells/g and 7 Log cells/g after 0 h and 120 h, respectively. For data obtained by qPCR, the η2-value between the different days was 0.79 for L. plantarum (data not shown). L. fermentum was not detected by qPCR. Plate counting on MRS agar of cocoa bean samples from Switzerland revealed a lactic acid bacteria concentration of 5 Log CFU/g after 0 h and 8 Log CFU/g after 120 h (Fig. 2B). Quantification of L. plantarum by qPCR resulted in 4 Log cells/g and 6 Log cells/g after 0 h and 120 h, respectively. Correspondingly, L. fermentum was quantified with 6 Log cells/g and 4 Log cells/g after 0 h and 120 h, respectively. For data obtained by qPCR, the η2-value between the different days was 0.90 for L. plantarum and 0.77 for L. fermentum (data not shown). 4. Discussion In this study, qPCR was shown to be an appropriate method for monitoring L. plantarum and L. fermentum during cocoa bean fermentation, as it met the criteria defined by Josefsen et al. (2012), i.e. the method is fast, sensitive, and specific. So far DGGE has been the only cultureindependent method described for monitoring the microbial diversity during cocoa bean fermentation (Camu et al., 2008; Papalexandratou et al., 2011b). Contrary to qPCR, DGGE only allowed a semiquantitative determination of bacteria (Schwan, 1998). The optimized qPCR assay for the detection of L. fermentum and L. plantarum on cocoa bean samples resulted in a method with a high specificity and sensitivity. With forward primer LfermF, described by Byun et al. (2004), and reverse primer LfermR and the probe LfermP designed in this study, the quantification of L. fermentum resulted in an efficiency of 99.66%. For quantification of L. plantarum primers PlanF and PlanR, and probe PlanP described by Klocke et al. (2006) were successfully applied resulting in an efficiency of 86.01%, which is close to the 90% acceptance described by Raymaekers et al. (2009). The specificity of the qPCR in targeting L. plantarum was 100% and the sensitivity with 97.5% was below 100% since L. pentosus was also detected using this assay. In the 16S rDNA fragment of L. plantarum and L. pentosus, no significant differences exist and differentiation of these species is only possible by sequences analyses, for example, of the recA gene (Felis and Dellaglio, 2007). This means that if L. pentosus is present, the qPCR targeting L. plantarum is not able to differentiate L. pentosus from L. plantarum. However, L. pentosus does not seem to be a dominant species during cocoa bean fermentation since it has only been found on cocoa beans by Lagunes Galvez et al. (2007) and Kostinek et al. (2008). Quantification of L. plantarum and L. fermentum in broth cultures revealed a limit of detection (LOD) of 3 to 4 cells/reaction for all assays. This value is comparable with the detection limit achieved by Martín et al. (2006) and Torija et al. (2010). In addition, data obtained by

qPCR assays developed in this study were closely located around the regression line (values of R2 close to 1) meaning that there is only a small variability (statistical fluctuation) in the measured data, i.e. the method provides reliable results. The LOD of the qPCR assays applied on spiked cocoa bean samples was with 2 to 3 Log cells/g sufficient for the monitoring of L. plantarum and L. fermentum during cocoa bean fermentation. This LOD was comparable to other studies using qPCR like Martín et al. (2006), who were able to detect 3 Log CFU/g of Lactobacillus sakei in fermented sausage and Furet et al. (2004) who analyzed L. acidophilus and L. johnsonii in fermented milk at a level of 3 Log CFU/ml. Furthermore, an LOD of 2 to 3 Log cells/g is sufficient for the monitoring of L. plantarum and L. fermentum during cocoa bean fermentation, since lactic acid bacteria have usually been determined in concentrations between 2 and 10 Log CFU/g (Nielsen et al., 2007; Pereira et al., 2012; Schwan, 1998). The regression line as well as the confidence and prognosis bands showed a broader prognosis band for cocoa bean samples compared to the broth cultures, meaning that the variability of the test results was higher for the cocoa bean samples (Fig. 1). The presence of putative residual inhibitors might be responsible for this higher variability but did not substantially disturb the qPCR. The evaluation of the developed method for the estimation of L. plantarum and L. fermentum on real samples from laboratory-scale cocoa bean fermentations from Brazil and Switzerland showed a high accuracy of the method. For samples from Brazil, lactic acid bacteria counts from plate-counting on MRS agar were comparable to data obtained by qPCR targeting L. plantarum, taking into consideration the simulated distribution around the measurements. Between the start of fermentation (0 h) and after 120 h of fermentation, an increasing concentration from 2 to 3 Log cells/g to 6 to 7 Log cells/g could be observed with both methods (Fig. 2). This was also confirmed by MALDI-TOF MS identification that detected only L. plantarum from day two to day six (data not shown). The growth of L. plantarum until the end of fermentation as measured in this study seemed not to correspond to the majority of the results described by other authors. As reported by Camu et al. (2007), Schwan (1998), or Nielsen et al. (2007), L. plantarum was mainly present at the beginning of cocoa bean fermentation but not at the end. In addition, qPCR for detection of L. fermentum in samples obtained from laboratory-scale cocoa bean fermentations from Brazil did not show a positive result (Ct value N 40) which was confirmed by MALDI-TOF MS identification of selected isolates (data not shown). Furthermore, data obtained by plate-counting on MRS agar of samples of laboratory-scale cocoa bean fermentation from Switzerland were comparable to data obtained by qPCR targeting L. plantarum. L. fermentum was quantified at a higher level than the overall lactic acid bacteria determined by plate counting and at decreasing levels after 120 h of fermentation, corresponding to the study of Papalexandratou et al. (2013) who showed presence of L. fermentum during the whole fermentation process. The observation

Fig. 2. Detection of L. plantarum (gray boxplots) and L. fermentum (white boxplots) by qPCR assays (cells/g) and with plate counting (x; Log CFU/g); A: Samples from laboratory-scale cocoa bean fermentation in Brazil; B: Samples from laboratory-scale fermentation in Switzerland. Black line: limit of detection of qPCR assays.

L. Schwendimann et al. / Journal of Microbiological Methods 115 (2015) 94–99

that qPCR led to higher cell counts than plate counting might be due to the presence of dead cells. To deal with this problem, differentiation between viable and dead cells using PMA (propidium monoazide) or EMA (ethidium monoazide) might be a helpful tool (Nocker et al., 2007). 5. Conclusion With the qPCR assay described in this study, a method for speciesspecific detection of L. plantarum and L. fermentum was successfully implemented allowing quantification just 4 h after sampling. In addition, an appropriate DNA isolation method for cocoa beans based on a commercial kit was successfully applied. With this method, L. plantarum and L. fermentum were successfully quantified in significant differences of concentration levels determined during fermentation and thus allowed monitoring of the two dominant species of lactic acid bacteria present during cocoa bean fermentation. This method can be used to better understand the development of single species during cocoa bean fermentation and thus permit a deeper insight into this complex process. Acknowledgments We would like to thank our students Linda Fenske, Tobias Lobmaier, and Katharina Bärtschi for their helpful contributions in the laboratoryscale cocoa bean fermentations, and Stella Cook for proofreading. This study was supported by Start-up Financing ZHAW 2011-1 and 2011-2. References Ardhana, M.M., Fleet, G.H., 2003. The microbial ecology of cocoa bean fermentations in Indonesia. Int. J. Food Microbiol. 86, 87–99. Brown, J.D., 2007. Statistics corner. Questions and Answers About Language Testing Statistics: Sample Size and PowerShiken: JALT Testing and Evaluation SIG Newsletter 11 pp. 31–35. Byun, R., Mangala, A., Nadkarni, K.C., Martin, F.E., Jaques, N.A., Hunter, N., 2004. Quantitative analysis of diverse Lactobacillus species present in advanced dental caries. J. Clin. Microbiol. 42, 3128–3136. Camu, N., De Winter, T., Verbrugghe, K., Cleenwerck, I., Vandamme, P., Takrama, J.S., Vancanneyt, M., De Vuyst, L., 2007. Dynamics and biodiversity of populations of lactic acid bacteria and acetic acid bacteria involved in spontaneous heap fermentation of cocoa beans in Ghana. Appl. Environ. Microbiol. 73, 1809–1824. Camu, N., González, Á., De Winter, T., Van Schoor, A., De Bruyne, K., Vandamme, P., Takrama, J.S., Addo, S.K., De Vuyst, L., 2008. Influence of turning and environmental contamination on the dynamics of populations of lactic acid and acetic acid bacteria involved in spontaneous cocoa bean heap fermentation in Ghana. Appl. Environ. Microbiol. 74, 86–98. Carr, J.G., Davies, P.A., Dougan, J., 1979. Cocoa Fermentation in Ghana and Malaysia. Tropical Products Institute, London. De Man, J.D., Rogosa, M., Sharpe, M.E., 1960. A medium for the cultivation of lactobacilli. J. Appl. Bacteriol. 23, 130–135. Dubon, A., Sanchez, J., 2011. Manual de produccion de Cacao. FHIA, La Lima, Cortés, Honduras, C.A. Felis, G.E., Dellaglio, F., 2007. Taxonomy of lactobacilli and bifidobacteria. Curr. Issues Intest. Microbiol. 8, 44–61. Furet, J.P., Quénée, P., Tailliez, P., 2004. Molecular quantification of lactic acid bacteria in fermented milk products using real-time quantitative PCR. Int. J. Food Microbiol. 97, 197–207. Garcia-Armisen, T., Papalexandratou, Z., Hendryckx, H., Camu, N., Vrancken, G., De Vuyst, L., Cornelis, P., 2010. Diversity of the total bacterial community associated with Ghanaian and Brazilian cocoa bean fermentation samples as revealed by a 16 SrRNA gene clone library. Appl. Microbiol. Biotechnol. 87, 2281–2292. Haarman, M., Knol, J., 2006. Quantitative qPCR analysis of fecal Lactobacillus species in infants receiving a prebiotic infant formula. Appl. Microbiol. Biotechnol. 72, 2359–2365.

99

Josefsen, M.H., Löfström, C., Hansen, T., Reynisson, E., 2012. Instrumentation and fluorescent chemistries used in qPCR. In: Fillion, M. (Ed.), Quantitative qPCR in Applied Microbiology (Chapter 2). Caister academic Press, Norfolk. Klocke, M., Mundt, K., Idler, C., McEniry, J., O'Kiely, P., Barth, S., 2006. Monitoring Lactobacillus plantarum in grass silages with the aid of 16S rDNA-based quantitative qPCR assays. Syst. Appl. Microbiol. 29, 49–58. Kostinek, M., Ban-Koffi, L., Ottah-Atikpo, M., Teniola, D., 2008. Diversity of predominant lactic acid bacteria associated with cocoa fermentation in Nigeria. Curr. Microbiol. 56, 306–314. Lagunes Galvez, S., Loiseau, G., Paredes, J.L., Barel, M., Guiraud, J.P., 2007. Study on the microflora and biochemistry of cocoa fermentation in the Dominican Republic. Int. J. Food Microbiol. 114, 124–130. Lefeber, T., Janssens, M., Camu, N., De Vuyst, L., 2010. Kinetic analysis of strains of lactic acid bacteria and acetic acid bacteria in cocoa pulp simulation media to compose a starter culture for cocoa bean fermentation. Appl. Microbiol. Biotechnol. 76, 7708–7716. Lefeber, T., Janssens, M., Moens, F., Gobert, W., De Vuyst, L., 2011. Interesting starter culture strains for controlled cocoa bean fermentation revealed by simulated cocoa pulp fermentations of cocoa-specific lactic acid bacteria. Appl. Microbiol. Biotechnol. 77, 6694–6698. Lima, L.J.R., Almeida, M.H., Nout, M.J.R., Zwietering, M.H., 2011. Theobroma cacao, “The food of the gods”: quality determinants of commercial cocoa beans, with particular reference to the impact of fermentation. Crit. Rev. Food Sci. Nutr. 51, 731–761. Martín, B., Jofré, A., Garriga, M., Pla, M., Aymerich, T., 2006. Rapid quantitative detection of Lactobacillus sakei in meat and fermented sausages by qPCR. Appl. Microbiol. Biotechnol. 72, 6040–6048. Miescher Schwenninger, S., Kroslakova, I., Freimüller Leischtfeld, S., Delueg, S., Peña Barrera, S., Fenske, L., Hinderling, C., Gantenbein-Demarchi, C., 2015. Highthroughput Identification of the Microbial Biodiversity of Cocoa Bean Fermentation by MALDI-TOF MS (submitted for publication, 2015). Nielsen, D.S., Teniola, O.D., Ban-Koffi, L., Owusu, M., Andersson, T.S., Holzapfel, W.H., 2007. The microbiology of Ghanaian cocoa fermentations analysed using culturedependent and culture-independent methods. Int. J. Food Microbiol. 114, 168–186. Nocker, A., Sossa, K.E., Camper, A.K., 2007. Molecular monitoring of disinfection efficacy using propidium monoazide in combination with quantitative PCR. J. Microbiol. Methods 70, 252–260. Ostovar, K., Keeney, P.G., 1973. Isolation and characterization of microorganisms involved in the fermentation of Trinidad's cacao beans. J. Food Sci. 38, 611–617. Papalexandratou, Z., Vrancken, G., De Bruyne, K., Vandamme, P., De Vuyst, L., 2011a. Spontaneous organic cocoa bean box fermentations in Brazil are characterized by a restricted species diversity of lactic acid bacteria and acetic acid bacteria. Food Microbiol. 28, 1326–1338. Papalexandratou, Z., Camu, N., Falony, G., De Vuyst, L., 2011b. Comparison of the bacterial species diversity of spontaneous cocoa bean fermentations carried out at selected farms in Ivory Coast and Brazil. Food Microbiol. 28, 964–973. Papalexandratou, Z., Lefeber, T., Bahrim, B., Lee, O.S., Daniel, H.M., De Vuyst, L., 2013. Acetobacter pasteurianus predominate during well-performed Malaysian cocoa bean box fermentations, underlining the importance of these microbial species for a successful cocoa bean fermentation process. Food Microbiol. 35, 73–85. Pereira, G.V.D.M., Pedrozo Miguel, M.G.C., Lacerda Ramos, C., Schwan, R.F., 2012. Microbiological and physicochemical characterization of small-scale cocoa fermentations and screening of yeast and bacterial strains to develop a defined starter culture. Appl. Environ. Microbiol. 78, 5395–5405. Raymaekers, M., Smets, R., Maes, B., Cartuyvels, R., 2009. Checklist for optimization and validation of qPCR assays. J. Clin. Lab. Anal. 23, 145–151. Sambrook, J., Russel, D.W., 2001. Molecular Cloning, a Laboratory Manual, Volume 3. Third Edition. CSHL press, New York. Santos, T.F., Santana, L.K.A., Santos, A.C.F., Silva, G.S., Romano, C.C., Dias, J.C.T., Rezende, R.P., 2011. Lactic acid bacteria dynamics during spontaneous fermentation of cocoa beans verified by culture-independent denaturing gradient gel electrophoresis. Genet. Mol. Res. 10, 2702–2709. Schwan, R.F., 1998. Cocoa fermentations conducted with a defined microbial cocktail inoculum. Appl. Microbiol. Biotechnol. 64, 1477–1483. Schwan, R.F., Wheals, A.E., 2004. The microbiology of cocoa fermentation and its role in chocolate quality. Crit. Rev. Food Sci. Nutr. 44, 205–221. Thompson, S.S., Miller, K.B., Lopez, A.S., 2001. Cocoa coffee. In: Doyle, M.P., Beuchat, L.R., Montville, T.J. (Eds.), Food Microbiology. Fundamentals and Frontiers (2. Ausg.). ASM Press, Washington. Torija, M.J., Mateo, E., Guillamón, J.M., Mas, A., 2010. Identification and quantification of acetic acid bacteria in wine and vinegar by TaqMan-MGB probes. Food Microbiol. 27, 257–265.